InDel molecular marker combination, primer thereof and application thereof in identifying enshi yellow cattle breed in hubei province

By constructing a genetic variation information database of Enshi Yellow Cattle and an InDel molecular marker combination, the problem of the inability of existing technologies to effectively analyze the genetic resources of Enshi Yellow Cattle has been solved. This has enabled the accurate identification and breeding improvement of Enshi Yellow Cattle in Hubei Province compared with foreign cattle breeds, and promoted the development of the beef cattle industry.

CN115354082BActive Publication Date: 2026-06-26HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210238245.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-03-11
Publication Date
2026-06-26
Estimated Expiration
2042-03-11

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively utilize InDel markers for the analysis of genetic resources in cattle breeds, leading to the risk of loss of genetic resources for the Enshi Yellow Cattle breed in Hubei Province. Furthermore, the poor adaptability of introduced large beef cattle breeds in the hot and humid climate of southern China has affected the development of the beef cattle industry.

Method used

A genetic variation database of Enshi Yellow Cattle was constructed. Using InDel molecular marker combinations and specific primers, PCR amplification and sequencing technologies were employed to accurately locate the bloodline relationship between Enshi Yellow Cattle and foreign cattle breeds, providing a simple and accurate identification method.

Benefits of technology

It has enabled accurate identification of Enshi Yellow Cattle in Hubei Province and foreign cattle breeds, supporting purebred breeding, improvement and preservation, shortening the breeding cycle and promoting the long-term development of the beef cattle industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115354082B_ABST
    Figure CN115354082B_ABST
Patent Text Reader

Abstract

The application discloses an InDel molecular marker combination, primers thereof and application of the molecular marker combination in identifying Hubei Enshi yellow cattle breeds, and the molecular marker combination comprises four InDel molecular markers, namely InDel_2 located at 88012237 bp of a bovine chromosome 1, the nucleotide sequence of which is TAAGA, InDel_4 located at 59170765 bp of a bovine chromosome 11, the nucleotide sequence of which is G, InDel_8 located at 29286667 bp of a bovine chromosome 8, the nucleotide sequence of which is G, and InDel_14 located at 15978630 bp of a bovine chromosome 2, the nucleotide sequence of which is AGC. The molecular marker combination can be used as an effective target for identifying the bloodlines of existing bovine breeds, and is used for identifying Hubei Enshi yellow cattle and foreign bovine breeds or hybrid bovine breeds containing foreign bovine breed bloodlines. If the above characteristics are met, the bovine breed is Hubei Enshi yellow cattle; and if the above characteristics are not met, the bovine breed is a foreign bovine breed or a hybrid bovine breed containing a foreign bovine breed bloodline. The identification method provides necessary resources and methods for analyzing the bloodline sources of bovine breeds and subsequent crossbreeding improvement, and the identification method is simple, accurate and effective.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of cattle breed identification technology, and in particular to an InDel molecular marker combination and its primers, and their application in identifying the Enshi Yellow Cattle breed in Hubei Province. Background Technology

[0002] Enshi Yellow Cattle is one of the native beef cattle breeds in Hubei Province. It is a high-quality, small-sized beef cattle breed characterized by its tolerance to roughage, high reproductive capacity, and rapid weight gain in summer and autumn. As a livestock genetic resource, it has been included in the national breed list, and "Enshi Yellow Beef" has received national geographical indication product protection, becoming a major beef cattle breed developed in Hubei Province. In recent years, Hubei Province has continuously encouraged and developed beef cattle farming, introducing large-scale beef cattle breeds from other regions. These breeds have achieved a certain scale in some areas and are gradually becoming dominant in the beef cattle market. While these introduced breeds have an absolute advantage in meat production compared to native Hubei breeds, they have poor adaptability to the local environment, especially the hot and humid climate of southern China, which is not conducive to long-term stable breeding. Crossbreeding native Yellow Cattle with introduced breeds can, to some extent, increase beef production while retaining the superior characteristics of native Yellow Cattle, thus creating a high-yield improved beef cattle breed suitable for Hubei Province. This has potential application value for promoting the long-term development of Hubei's beef cattle farming industry and economy. However, the short-term yield increases achieved by using introduced breeds have jeopardized the commercial breeding, improvement, and preservation of native beef cattle breeds in Hubei Province. Furthermore, there is currently almost no research on the genetic resources of the Enshi Yellow Cattle breed in Hubei. If this continues, it will lead to the serious consequence of the loss of the genetic resources of the Enshi Yellow Cattle breed in Hubei Province.

[0003] Constructing a genetic variation database is fundamental to the effective preservation and analysis of genetic resources. Early methods primarily involved preserving and analyzing genetic resources from different breeds through unit-point screening and DNA library construction. The advent of SNP microarrays and next-generation high-throughput sequencing technologies has fundamentally eliminated the previously cumbersome and complex process, enabling the rapid acquisition of genetic variation information (including SNPs, InDels, CNVs, Satellites, etc.) across the entire genome of a breed. This provides an effective means of quickly preserving and analyzing unknown genetic resources in bovine breeds. Gibbs et al. used a microarray capable of detecting 37,470 SNPs to conduct genetic structure analysis on 497 individuals from 19 bovine breeds worldwide, providing a preliminary analysis of the pedigrees among different bovine breeds (Gibbs et al.). Chen et al. used high-throughput sequencing and SNP information to conduct an evolutionary analysis of 49 East Asian bovine breeds, discovering that East Asia may be another new origin point for cattle (Chen et al.). However, in the analysis of bovine pedigrees and evolutionary origins, previous studies only used SNPs as variation information, ignoring other variation information; and an increasing number of studies show that InDeL and CNV are also effective variation types for explaining species pedigree information. InDel refers to the insertion or deletion of nucleotide fragments of different sizes at the same locus in the genome of closely related species or different individuals of the same species, which is a phenomenon of gaps generated by homologous sequence comparison. InDeL markers have high accuracy and stability, and can amplify mixed DNA samples and highly degraded trace DNA samples, and perform effective typing.

[0004] This invention constructs a genetic variation database for Enshi Yellow Cattle, accurately locating the pedigree relationships between Enshi Yellow Cattle and foreign cattle breeds. This will facilitate the analysis of Enshi Yellow Cattle genetic resources and the selection of suitable foreign breeds for improvement. Furthermore, the construction of an Enshi Yellow Cattle DNA fingerprint can be used for rapid breed identification and pedigree analysis, which is beneficial for the preservation of purebred Enshi Yellow Cattle and allows for early selection in later breeding processes, shortening generation intervals and breeding cycles. Therefore, this invention will play a crucial role in the subsequent crossbreeding improvement, breed identification, and germplasm resource preservation of Enshi Yellow Cattle, and will positively promote the long-term development of the beef cattle industry in Hubei Province. Summary of the Invention

[0005] The first objective of this invention is to provide an InDel molecular marker combination that can be used to identify Enshi Yellow Cattle from Hubei Province with foreign cattle breeds or hybrid cattle containing foreign cattle breed bloodlines. It can also be applied to the pure breeding, improvement and preservation of cattle breeds.

[0006] The second objective of this invention is to provide a primer set for detecting the above-mentioned molecular marker combination. This primer set can be used to identify Hubei Enshi Yellow Cattle with foreign cattle breeds or hybrid cattle containing foreign cattle breed bloodlines, and can also be applied to the pure breeding, improvement and preservation of cattle breeds.

[0007] The third objective of this invention is to provide a method for identifying Hubei Enshi Yellow Cattle with foreign cattle breeds or hybrid cattle containing foreign cattle breed bloodlines. This method can be used to easily and accurately identify Hubei Enshi Yellow Cattle with foreign cattle breeds or hybrid cattle containing foreign cattle breed bloodlines.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] A combination of InDel molecular markers, comprising four InDel molecular markers: InDel_2 located at 88012237 bp on bovine chromosome 1, with a nucleotide sequence of TAAGA; InDel_4 located at 59170765 bp on bovine chromosome 11, with a nucleotide sequence of G; InDel_8 located at 29286667 bp on bovine chromosome 8, with a nucleotide sequence of G; and InDel_14 located at 15978630 bp on bovine chromosome 2, with a nucleotide sequence of AGC.

[0010] The application of the above molecular marker combination in identifying Hubei Enshi Yellow Cattle from foreign cattle breeds or hybrid cattle containing foreign cattle breed bloodlines is as follows: if the nucleotide sequence at 88012237 bp on chromosome 1 is TAAGA, the nucleotide sequence at 59170765 bp on chromosome 11 is G, the nucleotide sequence at 29286667 bp on chromosome 8 is G, and the nucleotide sequence at 15978630 bp on chromosome 2 is AGC, then it is Hubei Enshi Yellow Cattle or a hybrid cattle containing foreign cattle breed bloodlines; otherwise, it is a foreign cattle breed.

[0011] In this invention, foreign cattle breeds refer to purebred foreign cattle and hybrid cattle whose parents are different foreign cattle breeds. Hybrid cattle containing foreign cattle breed bloodlines refer to hybrid cattle that are crossbred with foreign cattle breeds and domestic cattle breeds (including Enshi Yellow Cattle of Hubei Province and non-Enshi Yellow Cattle of Hubei Province).

[0012] The application of the above molecular marker combinations in the purebred breeding, improvement, and preservation of cattle breeds shows that if the nucleotide sequence at 88012237 bp on chromosome 1 is TAAGA, the nucleotide sequence at 59170765 bp on chromosome 11 is G, the nucleotide sequence at 29286667 bp on chromosome 8 is G, and the nucleotide sequence at 15978630 bp on chromosome 2 is AGC, then the cattle are either Enshi Yellow Cattle from Hubei Province or hybrid cattle containing foreign cattle breed bloodlines; otherwise, they are foreign cattle breeds.

[0013] The primer set used to detect the above molecular marker combinations is as follows:

[0014] The primer nucleotide sequence of InDel_2 is as follows:

[0015] F: 5'TTTGGTCTTATGGCCTAC 3', as shown in SEQ ID No. 1;

[0016] R: 5'TGTATCACCGAGGAAGC 3', as shown in SEQ ID No. 2;

[0017] The primer nucleotide sequence of InDel_4 is as follows:

[0018] F: 5'TACCCGAGTTGATTGTA 3', as shown in SEQ ID No. 3;

[0019] R: 5'TTGGTATTAAGCCAGTT 3', as shown in SEQ ID No. 4;

[0020] The primer nucleotide sequence of InDel_8 is as follows:

[0021] F: 5'CAAGTTCTGCCAAAGG 3', as shown in SEQ ID No. 5;

[0022] R: 5'GACCCTCCAGTAACATTC 3', as shown in SEQ ID No. 6;

[0023] The primer nucleotide sequence of InDel_14 is as follows:

[0024] F: 5'GGAGGGTTTCAATCAGTAT 3', as shown in SEQ ID No. 7;

[0025] R: 5'GGTGTTATGGGACTTTACC 3', as shown in SEQ ID No. 8.

[0026] A method for identifying Hubei Enshi Yellow Cattle with foreign cattle breeds or hybrid cattle containing foreign cattle breed bloodlines, comprising the following steps:

[0027] (1) DNA was isolated and extracted from the tissues of the cattle to be identified;

[0028] (2) Using the above DNA as a template, polymerase chain reaction (PCR) was performed using four pairs of primers.

[0029] The four pairs of primers are as follows:

[0030] First pair: F: 5'TTTGGTCTTATGGCCTAC 3', as shown in SEQ ID No. 9;

[0031] R: 5'TGTATCACCGAGGAAGC 3', as shown in SEQ ID No. 10;

[0032] Second pair: F: 5'TACCCGAGTTGATTGTA 3', as shown in SEQ ID No. 11;

[0033] R: 5'TTGGTATTAAGCCAGTT 3', as shown in SEQ ID No. 12;

[0034] The third pair: F: 5'CAAGTTCTGCCAAAGG 3', as shown in SEQ ID No. 13;

[0035] R: 5'GACCCTCCAGTAACATTC 3', as shown in SEQ ID No. 14;

[0036] Fourth pair: F: 5'GGAGGGTTTCAATCAGTAT 3', as shown in SEQ ID No. 15;

[0037] R: 5'GGTGTTATGGGACTTTACC 3', as shown in SEQ ID No. 16;

[0038] (3) Sequencing the above PCR products and comparing the sequencing results, if the nucleotide sequence at 88012237bp on chromosome 1 is TAAGA, the nucleotide sequence at 59170765bp on chromosome 11 is G, the nucleotide sequence at 29286667bp on chromosome 8 is G, and the nucleotide sequence at 15978630bp on chromosome 2 is AGC, then it is Enshi Yellow Cattle of Hubei Province or a hybrid cattle with foreign cattle breed bloodline; otherwise, it is a foreign cattle breed.

[0039] In the above technical solution, the PCR amplification reaction procedure is as follows:

[0040] InDel_4: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 50℃ annealing for 30 s, 72℃ extension for 1 min, 32 cycles, 72℃ extension for 5 min;

[0041] InDel_2, InDel_8, InDel_14: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 1 min, 32 cycles, 72℃ extension for 5 min.

[0042] The beneficial effects of this invention are as follows: the InDel molecular marker combination of this invention can serve as an effective target for identifying the lineage of existing cattle breeds, and can be used to distinguish between Hubei Enshi Yellow Cattle and foreign cattle breeds or hybrid cattle containing foreign cattle breed lineage. It provides necessary resources and methods for analyzing the lineage of cattle breeds and subsequent crossbreeding improvement. The identification method is simple, accurate and effective. Attached Figure Description

[0043] Figure 1 Principal component analysis using InDel;

[0044] Figure 2 It is InDel's pedigree analysis;

[0045] Figure 3 It is the phylogenetic tree of InDel;

[0046] Figure 4 This is the Fst calculation result of the SNP;

[0047] Figure 5 This is the result of molecular marker combination electrophoresis;

[0048] Figure 6 This is a peak diagram of InDel_2 sequencing data from cattle in Enshi, Hubei.

[0049] Figure 7 This is a Limousin bovine InDel_2 sequencing peak diagram;

[0050] Figure 8 This is a peak diagram of InDel_4 sequencing data from cattle in Enshi, Hubei.

[0051] Figure 9 This is a Limousin bovine InDel_4 sequencing peak diagram;

[0052] Figure 10 This is a peak diagram of InDel_8 sequencing data from cattle in Enshi, Hubei.

[0053] Figure 11 This is a Limousin bovine InDel_8 sequencing peak diagram;

[0054] Figure 12 This is a peak diagram of InDel_14 sequencing data from cattle in Enshi, Hubei.

[0055] Figure 13 This is a Limousin bovine InDel_14 sequencing peak diagram. Detailed Implementation

[0056] The following embodiments are used to further illustrate this invention, but should not be construed as limiting the invention. Any optimizations and substitutions made to the invention without departing from its essence and spirit are within the scope of the invention.

[0057] Unless otherwise stated, the technical means involved in the following embodiments are all conventional techniques commonly used by those skilled in the art.

[0058] I. Materials and Methods

[0059] 1. Data Source

[0060] The specific information on the Hubei Enshi Yellow Cattle involved in this experiment and the foreign cattle breeds or hybrid cattle with foreign cattle breed bloodlines required for comparison is shown in Table 1.

[0061] Table 1. Detailed information on experimental samples

[0062] English name Chinese name quantity Angus Angus cattle 12 Ogaden Ogarden cattle 7 N'dama Daruma Ox 4 Muturu African cattle 3 Hereford Hereford Cow 12 Brahman Brahman Cow 4 Boran Polish cattle 7 Gir Gilniu 3 Kenanan Kena Bull 7 Holstein Holstein cattle 50 RedAngus Red Angus cattle 8 Nelore Nile cattle 6 Enshi Enshi Yellow Cattle 10 total 133

[0063] In addition to 10 Enshi Yellow Cattle, this invention tested a total of 123 foreign cattle of 12 different breeds. These 123 foreign cattle basically represent the mainstream foreign cattle breeds / hybrid cattle with foreign cattle breed bloodlines, and have a wide range of breeds. Their genetic variation information can be used to explain the differences in the genetic background between the Enshi Yellow Cattle of Hubei Province and the two groups of foreign cattle breeds or hybrid cattle with foreign cattle breed bloodlines.

[0064] 2 Experimental Materials

[0065] Pipettes, agarose, DNA samples of Enshi Yellow Cattle and foreign cattle breeds, PCR instrument, electrophoresis instrument, etc.

[0066] 3 Experimental Methods

[0067] 3.1 Constructing a genetic variation information database for Enshi Yellow Cattle and other representative cattle breeds worldwide

[0068] The second-generation high-throughput sequencing data of the above 10 Enshi cattle and the second-generation high-throughput sequencing data of 123 foreign cattle collected by the inventor were used to remove adapter sequences and low-quality sequences using NGStoolkit software, ensuring that the average base quality of all sequences was Q>20 and the proportion of low-quality bases in the sequences was less than 30%. The filtered sequences were aligned to the bovine reference genome using BWA software, and the SNP, InDel, and CNV information of each of the above 133 cattle were obtained using software such as GATK and CNVnator, and low-quality variant information was filtered out for subsequent analysis.

[0069] 3.2 Precise Positioning of Enshi Yellow Cattle in the World's Cattle Breeds' Bloodline Composition

[0070] (1) Principal Component Analysis: The population structure of 133 cattle was analyzed using the multidimensional scaling analysis method in Plink software. The clustering of Enshi Yellow Cattle and other cattle breeds was analyzed based on the PCA plotting results.

[0071] (2) Neighbor-joint clustering analysis: The genetic distance matrix between individuals was calculated using Plink software. Based on the genetic distance matrix, the population was clustered using the neighbor-joint method with PHYLIP software. Finally, Figtree software was used to plot the clustering results. The clustering results of Enshi Yellow Cattle and other cattle breeds were compared and verified based on the neighbor-joint clustering results and the multidimensional scaling analysis results, and the origin and evolutionary relationships between breeds were analyzed.

[0072] (3) Bloodline composition analysis: The population structure was analyzed using STRUCTURE software to analyze the degree of interbreeding between individuals and the bloodline relationship between Enshi Yellow Cattle and other cattle breeds. Combined with the results of multidimensional scaling analysis and neighbor clustering analysis, the relationship between Enshi Yellow Cattle and other cattle breeds was revealed.

[0073] 3.3 Construction of DNA fingerprinting of Enshi cattle

[0074] (1) Screening of genomic genetic variation combinations that can be used to identify the Hubei Enshi Yellow Cattle breed: Python scripts were used to statistically analyze the distributions of SNPs, InDel, and CNVs in Enshi Yellow Cattle and non-Enshi Yellow Cattle. The Fst index in the F-statistics algorithm was used to test the differences in the frequency distribution of genetic variations between Enshi Yellow Cattle and various non-Enshi Yellow Cattle. The obtained Fst indices were arranged in descending order, and the top 1% were selected as differential genetic variation sites between Enshi Yellow Cattle and non-Enshi Yellow Cattle. To avoid the influence of allele segregation during the genetic process, only InDel sites that were homozygous in all Enshi Yellow Cattle were retained. The top 20 differential sites with the most significant differences between Enshi Yellow Cattle and foreign cattle breeds were selected to form different variation combinations. A randomized computational model was used to evaluate the identification accuracy of these combinations for the Enshi Yellow Cattle breed.

[0075] (2) Verification of genetic variation combinations that can be used to identify the Enshi Yellow Cattle breed: Based on the information on the pedigree composition of Enshi Yellow Cattle, further refine the identifiable variation combinations to obtain genetic variation combinations that are relatively evenly distributed across pedigrees and have high reliability for subsequent verification. Design specific primers and use methods such as conventional PCR and sequencing to further verify the differential loci in the population, and finally obtain a DNA fingerprint that can be used for the identification of the Enshi Yellow Cattle breed.

[0076] II. Results and Analysis

[0077] 1. Mutation data

[0078] The FST results of the top 1% of Enshi Yellow Cattle and foreign cattle breeds were taken, and the 20 homozygous loci with the greatest differences in Enshi Yellow Cattle are shown in Table 2.

[0079] Table 2. 20 loci showing the greatest differences between Enshi Yellow Cattle and other cattle breeds

[0080]

[0081]

[0082]

[0083]

[0084] Continued

[0085]

[0086]

[0087]

[0088]

[0089] 2. Population Structure Analysis (InDel)

[0090] (1) Principal Component Analysis

[0091] Principal component analysis (PCA) was performed on the InDel data of the samples. PC1 and PC2 were selected during the calculation, and PCA was used to construct the plot. The PCA results show that the first principal component (PC1) divides all individuals into two main categories: European cattle and Asian zebu cattle, and African zebu cattle and African cattle. Enshi Yellow cattle are included in the category of Asian zebu cattle, African zebu cattle, and African cattle, indicating that Enshi Yellow cattle may be a breed resulting from the crossbreeding of African cattle and zebu cattle. See... Figure 1 .

[0092] (2) Admixture Analysis

[0093] Pedigree analysis shows that when K=2, the cattle population is divided into two main categories: European common cattle and Zephyrus, and African common cattle, with Enshi Yellow Cattle possessing both European and Zephyrus ancestry. When K=3, the population is divided into three main categories, with Holstein cattle separating from European common cattle. When K=4, the population is divided into four main categories, with Hereford cattle also separating from European common cattle. When K=5, the population is divided into five main categories, with African common cattle and Zephyrus separating. When K=6, Enshi Yellow Cattle separates from Asian Zephyrus. Therefore, Enshi Yellow Cattle is most closely related to Asian Zephyrus in terms of pedigree. See Figure 2 .

[0094] (3) Phylogenetic tree

[0095] The phylogenetic tree shows that all cattle individuals are divided into three groups: European common cattle, zebu cattle, and African common cattle. Enshi Yellow cattle and zebu cattle cluster together, and Enshi Yellow cattle are more closely related to African common cattle than European common cattle, indicating that they are most closely related to zebu cattle. See Figure 3 .

[0096] 3. Identification of genetic variation combinations in the Enshi Yellow Cattle breed (InDel)

[0097] Calculate the Fst of InDel. See Figure 4 The result of the Fst calculation for the SNP.

[0098] Compared to SNPs and CNVs, InDels are easier to detect in the genome, making InDels a more accurate and feasible method for screening and validating genetic variation combinations. In screening loci that can distinguish Enshi Yellow Cattle from other cattle breeds, the method used was to first sort all InDel loci according to their Fst values ​​from largest to smallest. Then, loci with homozygous variations in all Enshi Yellow Cattle were selected. Finally, the top 20 differentially expressed loci based on their Fst values ​​were chosen to form different variation combinations. A randomized computational model was then used to evaluate the recognizability of all possible combinations for Enshi Yellow Cattle. Furthermore, information on the pedigree composition of Enshi Yellow Cattle was used to further refine the identifiable variation combinations, resulting in a set of highly reliable genetic variation loci combinations. Table 3 shows the selected genetic variation combinations that can identify the Enshi Yellow Cattle breed. Experiments showed that these four loci were the most primer-specific and exhibited the greatest differentiation.

[0099] Table 3 Genetic Variation Combinations

[0100]

[0101] 4. Verify the genetic variation combinations of the Enshi Yellow Cattle breed

[0102] 4.1 PCR Validation

[0103] Primers were designed for InDel_2, InDel_4, InDel_8, and InDel_14 sites, and suitable annealing temperatures were determined. PCR amplification and electrophoresis were then performed using DNA samples from Enshi Yellow Cattle and Limousin Cattle. The PCR amplification reaction system is shown in Table 4, and the results are shown in [Table 4]. Figure 5 .

[0104] The mutant combination of Enshi Yellow Cattle and Limousin cattle DNA samples successfully amplified bands of the target size, namely InDel_2 436bp, InDel_4 426bp, InDel_8 397bp, and InDel_14 448bp, which is consistent with expectations.

[0105] Table 4 PCR amplification reaction system

[0106] DNA template 2μl 2*Phanta Max Master Mix 10μl upstream primer 1μl Downstream primer 1μl <![CDATA[H20]]> 6μl total 20μl

[0107] (1)InDel_2

[0108] Primer design:

[0109] F: 5'TTTGGTCTTATGGCCTAC 3'

[0110] R: 5'TGTATCACCGAGGAAGC 3'

[0111] Amplification reaction procedure:

[0112] Pre-denaturation at 94℃ for 3 min, denaturation at 94℃ for 30 s, annealing at 57℃ for 30 s, extension at 72℃ for 1 min, 32 cycles, extension at 72℃ for 5 min.

[0113] PCR products:

[0114] TTGTGGCCTGTTAGGATGATCCATGTCAGATTCAACTCGCAAGTGCTATTAAC AGCTTTGTCTTCATTTGTTTCTGTGGCATGTTTGGTCTTATGGCCTACGACTCATGGAAATCAAGCCTGGTTTCTAAAGTTTTGATTTTTTGCCTGTTTAAACC ATTAACTTGGGAGCAAGTTAATTGTGTGTCATATACACATGTAAGTACCATTTACAGAAAAGTTGTCTGCTTTTATGCGGGAAAACTCTTGGGCAATATGTAA TTTAAACATATGTGCATGGATTGTACATACACCTCCTGCCTTTTTCCTTCCTAATATCTCTTTGTGACAGTGATGGATGCTTCTGGTTATGCATAGAGTTCAGTT TGATCAGAGTCATTGGATTATAAGGCTTAAACTAGATAAGAGAACCAGAAT TTATTTAGGTTTTTTTCTTTTCTTCTACACTTGTGTCCATGTGTGCTCTGAACTTTTTAGCTGATGAGTAATATATACTTAATTTCAGCTTCCTCGGTGATACAGTGAATATATGAATTAGAAAATATAAGAAAATGGAATTAAATTTTAGATAATCAGAATTTTTAAGTGGAAAAGTTGGAGAAGGACAGCCTGTTCTAGAAACAA TTTAAGCAGCCAAGAACTGAGGAAAAGTAGAGTAGAGAAGAAGCAAACTGGTACCTAGAGAGTGGAACCTAATAGAAAACAACAAGTTTGAGTGTAATA AAAGCCAGTTCTTAAGAGCTCAGAAGCAAACATTTGAATGAAACCAGTGT TACTGGTAATTCTAGGGGAAGAAGTTTTC

[0115] (2)InDel_4

[0116] More:

[0117] F:5'TACCCGAGTTGATTGTA 3'

[0118] R:5'TTGGTATTAAGCCAGTT 3'

[0119] Amplification reaction procedure:

[0120] Pre-denaturation at 94℃ for 3 min, denaturation at 94℃ for 30 s, annealing at 50℃ for 30 s, extension at 72℃ for 1 min, 32 cycles, extension at 72℃ for 5 min.

[0121] PCR products:

[0122] TTTGCATAATTCTCTGGACATCTAGGTTATTGTGTTTATCGATAGTCTATTCT CTTTTATTTCTGTCTGCATTCCATGTTACAGATGTAATACAAATTAACATAAACTTGTTGAAAAATACCCGAGTTGATTGTAATTTTTTAAACTATAACAAGC ACGGATGTCATAAAAAATATTACCCCTGTACTAAATATATATGTTAGTTTTGTACCATCGAAGTGCACTTTTGTTCATTTTTATAGCATTTCAGGATGCTAATGA ATATTAGGTATTGAAAATCATAGGCTGTTTCTGAAAAACAACAACTTGATTTTTTCTAAAAAATTAAACTTTGTATGTTGAGATAATCATAGAGTCACATGCAG TTGAAACAAATAATACAGAGATCTGTTTTACTATTTGTCCAGCTCACTTCTAATAGTAATAATTTTATATGATAAAATAATTTTATATGATAAATTTTATAATTTTA ATTTTATATGATAAAGATGGCTTATTTGTCTCTCAGAATGTAACAACATCTTA TTAACTGGCTTAATACCAAAAAATCCCTATAGATCATTAGATGAATTACTT AAACTTTACATAAAGAGATATACCATAATATGTTCAGGTCATCAAAGTTTTATCTTTTCCATATTTTGAGGGCATTTAACAAAGCAGCAGCCTGCCTGAGGCT GAAACTATAACATAATCAATATTTAAAATCCATCTTTTAAACAGAAATTATTC TTACTGTACCTTTATGAGTGATATTAAAAACTAGAAATGCTACAATTGTTCTATTATGGCAAATTGTTATATAAGTATTGTATACCCTATAAAGGTATATTATATTA GTTTAAAACAAAGATTTCAAAGCATTTTTAAAATGTGGAGAAGTGTTCACTATAAAATACTTCCTTAAATATTGAGTTAAAAGAAAAATATGTGCAGAACTTGCACTGGGTTGTGTGTATACTCAGTTTGTGTCTGTTTGTGACCCCATGGACTGT AGCCCA

[0123] (3)InDel_8

[0124] Primer design:

[0125] F: 5'CAAGTTCTGCCAAAGG 3'

[0126] R: 5'GACCCTCCAGTAACATTC 3'

[0127] Amplification reaction procedure:

[0128] Pre-denaturation at 94℃ for 3 min, denaturation at 94℃ for 30 s, annealing at 57℃ for 30 s, extension at 72℃ for 1 min, 32 cycles, extension at 72℃ for 5 min.

[0129] PCR products:

[0130] TGTTCGGTATTGTTTTATACTGCTGTTCTTATATTGTGCGTTGCTTTATTCCCC ACCACAGATTTGTTCAACAGTAAGTCATCTAATCAGACTTTCAGATACTTTATTTGCAGCCTGTGATGTTTTATGGAGATTTTGTTTTTGAATCAGTACTTGAAG CATTTTTAGTCTCGCTGGCTGAGCGCATCTTCACACTTTCCATAGCCCACCCCCAAGTTCTGCCAAAGGAAGCAGATCAAGGTTTGCTTTTGTTCATGCAGTT AAGAATCTTAAAGCAATTAAGCTCCGTGGGCCACAGAGGTTACAGGACTCCTGCATGTGCAGAAGCTGGGTTGTGTCCACACACGTGGAGTCTCAAGTGT GGGAGAGTGTCTTAGGAGCCAGAGAGACTTGATGGTATCTGAGTGGCCCTTGAGAAGCTGGGGCACACAGATCCTCAGAAGGACAGAGCTAGGCTGC CTGGAGAAAATGACACTCATTTCCAGACTTCAGAAACAGGCGCCAAGTGAG AAGTTGCTGTGGTTTGTCTTGTTTCCTTTTGGCTGTTGATAGCTCTACACAGCTCTATGTAAAATTTCCTACCTCTGTCTGAATGTTACTGGAGGGTCAGTTC AACCTAAAATTATGGAGCATGTCCAAGGATGGCTCAACTAATAACTTTTAGAAAGTTAATAAACTTTAGTTTTTGAGCAGATTTAGTTTTATAGGAAGATTGAG CAGAAAGTACAGAGAGTTCTCACGTTCCCTGTCCCAGTTTCCCAGTTATTAACATCTTGGTTTAGTCTGGTATGTTTGCTACAACTGATGCCAATAAC. ATTATCTAAAGCTCATAGTTTATATTAGGGTTCAGTATTAGTGTTGTTTCTTCTGTGTGTTTTGACAAATGTATACTGACATGCATCCACTATCACAGTGGTAAC ATTTTCAGTGTGTTTTAGGGAAAAAAAAAACCCACAACTTTTCTTTGATTGGCCTGGGGTAGAAAGGGGAAGAGAGG

[0131] (4)InDel_14

[0132] Primer design:

[0133] F: 5'GGAGGGTTTCAATCAGTAT 3'

[0134] R: 5'GGTGTTATGGGACTTTACC 3'

[0135] Amplification reaction procedure:

[0136] Pre-denaturation at 94℃ for 3 min, denaturation at 94℃ for 30 s, annealing at 57℃ for 30 s, extension at 72℃ for 1 min, 32 cycles, extension at 72℃ for 5 min.

[0137] PCR products:

[0138] CATGAATTGTCTGAGGAGACTCATGTGCTGACAAAGCAAGAGATTTGATTG GGAAAGGGCACCCGGGTGGAGAGCAGTAGGGTAAGGGAACCCAGGAGAACTGCTCTGCCACGTGGCTCACAGTCTCAGGTTTTATGGTGATGGGATTAG TTTCTGGGTGGTCTTTGGCCAATCATTCTAATTCAGGGTCTTTCCTGGTGGCACACGCATCACTCAGCCAAGATGAATGCTGGCAAGAGGAATTCTGGGAAG TGGGTGGACACGCGGTGTCTCCTTTCGACCTTTCCCGAAATCTTCCGGTTG GTGGTGGCTTATTAGTTCTGTATTCCTTATCAGGATCTCCTGTCATAAAACAACTCACACAAATGTTACTATGGTGCCTGGCCAGGGTGGAGGGTTTCAATC AGTATGCTTCCCCTAACAACTCAAATGGTGACTCTGGTGGGACTCTTCTTTGCTGAGACTGACATCCTGACCACTCGGGGTAAGGACCAGACCCAGGCCAC AACTGGGACCCTTTTGTCCCTGGTCTCCTCCTGAGGCGGAAAACTGGCCAGAATGCCCCGATCGGTAAGGAACAAGAGACTTTATTGACCTCTCTCCCCTT CTCTCTCTCTTTCCTCTCATTAACTCTTCCTATCCTTCCCCGTTTTTCTAGTCCCCTGGTCCTGGACGCAGGAATCTGGTTGAAGGGCCCTCAGCCTGAGCTG AGGATTGGAGACTGATCACCTCCTCTTGGCAGAGAACTCAAATTCTGGTTCTGGTCTGGTTTGATTTCTGGTAAGGCCAAGTTCCAGTCCTCCCTTCTCTGG AGGCCCAGGGTAAAGTCCCATAACACCTGGGTATCTGCAGGTGGCAGGAGACATCTGTAAGGCCACCCTTTTTGCACCCTCTCCCGCCTCTTCCCCCTTCTTCTTCAACCTGGTTTCCTTTCCTCGCTTTGAAATCTTGGAAGCTGTTAGTACTTGGATCTGAAGTTCTGTGTCTCTACAGGAGGTTT

[0139] 4.2 Sequencing of PCR products

[0140] The PCR products were sent for sequencing, yielding eight sequencing peaks at four loci (InDel_2, InDel_4, InDel_8, and InDel_14) in Enshi Yellow Cattle and Limousin cattle, respectively. (See...) Figure 6-13 .

[0141] The sequencing results of Enshi Yellow Cattle and Limousin cattle were compared and verified. It was confirmed that the Enshi Yellow Cattle had insertion mutations at the InDel_2 and InDel_14 sites and deletion mutations at the InDel_4 and InDel_8 sites. The Limousin cattle did not have any mutations at any of the four sites. The combination of mutations was successfully verified and can be used to distinguish the Enshi Yellow Cattle.

[0142] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention. sequence list <110> Huazhong Agricultural University <120> An InDel molecular marker combinatorial system and its primers and their application in identifying the Enshi Yellow Cattle breed in Hubei Province. <140> 2022102382452 <141> 2022-03-11 <160> 16 <170> SIPOSequenceListing 1.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <400> 1 tttggtctta tggcctac 18 <210> 2 <211> 17 <212> DNA <213> Artificial Sequence <400> 2 tgtatcaccg aggaagc 17 <210> 3 <211> 17 <212> DNA <213> Artificial Sequence <400> 3 tacccgagtt gattgta 17 <210> 4 <211> 17 <212> DNA <213> Artificial Sequence <400> 4 ttggtattaa gccagtt 17 <210> 5 <211> 16 <212> DNA <213> Artificial Sequence <400> 5 caagttctgc caaagg 16 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <400> 6 gaccctccag taacattc 18 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <400> 7 ggagggtttc aatcagtat 19 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <400> 8 ggtgttatgg gactttacc 19 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <400> 9 tttggtctta tggcctac 18 <210> 10 <211> 17 <212> DNA <213> Artificial Sequence <400> 10 tgtatcaccg aggaagc 17 <210> 11 <211> 17 <212> DNA <213> Artificial Sequence <400> 11 tacccgagtt gattgta 17 <210> 12 <211> 17 <212> DNA <213> Artificial Sequence <400> 12 ttggtattaa gccagtt 17 <210> 13 <211> 16 <212> DNA <213> Artificial Sequence <400> 13 caagttctgc caaagg 16 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <400> 14 gaccctccag taacattc 18 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <400> 15 ggagggtttc aatcagtat 19 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <400> 16 ggtgttatgg gactttacc 19

Claims

1. A primer set for amplifying and identifying InDel molecular marker combinations of Enshi Yellow Cattle from Hubei Province, characterized in that, The InDel molecular marker set includes four markers: InDel_2, InDel_4, InDel_8, and InDel_14; the primer set consists of four pairs of primers with the following nucleotide sequences: InDel_2 primers: F: 5' TTTGGTCTTATGGCCTAC 3' (SEQ ID No. 1), R: 5' TGTATCACCGAGGAAGC 3' (SEQ ID No. 2); InDel_4 primers: F: 5' TACCCGAGTTGATTGTA 3' (SEQ ID No. 3), R: 5'TTGGTATTAAGCCAGTT 3' (SEQ ID No. 4); InDel_8 primers: F: 5' CAAGTTCTGCCAAAGG 3' (SEQ ID No. 5), R: 5' GACCCTCCAGTAACATTC 3' (SEQ ID No. 6); InDel_14 Primers: F: 5' GGAGGGTTTCAATCAGTAT 3' (SEQ ID No. 7), R: 5'GGTGTTATGGGACTTTACC 3' (SEQ ID No. 8); The primer set is used to distinguish between Enshi Yellow Cattle of Hubei Province and foreign cattle breeds or hybrid cattle containing foreign cattle breed bloodlines. The foreign cattle breeds are Angus, Ogaden, Damo, African Common Cattle, Hereford, Brahman, Bolognese, Gir, Kena, Holstein, Red Angus, and Nile.

2. A method for identifying Enshi Yellow Cattle of Hubei Province with foreign cattle breeds or hybrid cattle containing foreign cattle breed bloodlines, characterized in that... Includes the following steps: (1) DNA was isolated and extracted from the tissues of the cattle to be identified; (2) Using the DNA as a template, perform PCR amplification using the primer set described in claim 1; (3) Sequencing and comparing the PCR products to determine the cattle breed to be identified; the foreign cattle breeds are Angus, Ogaden, Damo, African Common, Hereford, Brahman, Bolognese, Gir, Kena, Holstein, Red Angus, and Nile.

3. The identification method according to claim 2, characterized in that, The PCR amplification reaction program was as follows: InDel_4: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, **50℃** annealing for 30 s, 72℃ extension for 1 min, 32 cycles, 72℃ extension for 5 min; InDel_2, InDel_8, InDel_14: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, **57℃** annealing for 30 s, 72℃ extension for 1 min, 32 cycles, 72℃ extension for 5 min.

Citation Information

Patent Citations

  • Detection method for 4 repeated deletion polymorphism sites of Chinese yellow cattle PPP2R2B gene and application of method

    CN109628609A

  • Method for individual identification and method for parentage test of cattle using single nucleotide polymorphism

    JP2009219451A