Cell lysate for extracting nucleic acid and use thereof

Abstract

The present application relates to a cell lysis solution for extracting nucleic acid and its application. The cell lysis solution of the present application comprises: 5-20 mM NaOH; 1-10% (w / v) Chelex-100; 0.05-0.5% (v / v) NP40; and 0.05-5 mM EDTA. The cell lysis solution of the present application is fast and simple for extracting nucleic acid, reduces the loss of nucleic acid and the possibility of sample cross-contamination, is low in cost and suitable for DNA preparation of trace cell samples.

Description

TECHNICAL FIELD

[0001] The present application relates to a cell lysis solution for extracting nucleic acid and its application. BACKGROUND

[0002] Cells obtained after gene editing need to extract DNA for genotype identification to determine the success of gene targeting cell lines. The traditional method of obtaining DNA is to use fresh, -70℃ or liquid nitrogen stored specimens as materials, to digest with proteinase K, to extract with phenol and chloroform, and to extract nucleic acid by combining with a centrifugal column method or a magnetic bead method. In 1987, Fey et al. first successfully extracted DNA with a high molecular weight from bone marrow smears for Southern blot analysis using NP40, but this method requires proteinase K digestion, phenol and chloroform extraction, and ethanol precipitation, and is complex, time-consuming and requires a large amount of sample. At the same time, it needs to be transferred between multiple centrifugal tubes, which can cause loss of nucleic acid and cross contamination between specimens. Since PCR technology has relatively low requirements for the purity and molecular weight of DNA samples, a small amount of DNA can be amplified, and partially degraded DNA can also be detected by PCR. Therefore, the crude extract product digested with NP40 and proteinase K can also be used for PCR. Later, it was found that the HOTSHOT DNA digestion method can be used for more concise and effective PCR identification of DNA extraction from mouse tails or ear samples. In recent years, Chelex-100 has been widely used for detection of less material or only a small amount of DNA. Chelex-100 is a chemical integrated resin composed of styrene and divinylbenzene copolymer, containing paired iminodiacetate ions, which can chelate divalent metal ions to inhibit DNAase and reduce DNA degradation. Chelex-100 combined with proteinase K digestion method is widely used in forensic science, tumor identification and molecular biology experiments. Identification of gene edited embryonic stem cells can only obtain about 10 cells for identification, and proteinase K digestion takes a long time, so a faster and more sensitive DNA extraction method from gene edited embryonic stem cells is needed. SUMMARY

[0003] In order to solve the above technical problems existing in the prior art, the present application develops a nucleic acid extraction method combining Chelex-100 and HOTSHOT, provides a cell lysis solution, a nucleic acid extraction method based on the lysis solution and a method of directly performing PCR using the cell lysate based on the lysis solution. In the cell lysis solution provided by the present application, the cell membrane structure can be rapidly destroyed by chemical principle to achieve the purpose of lysing cells and releasing nucleic acid, and the DNAase activity is inhibited to reduce DNA degradation, the use of transfer tubes is reduced, the loss of trace nucleic acid caused by liquid movement between centrifugal tubes and pipette tips is avoided, and the nucleic acid extraction efficiency is further improved.

[0004] To this end, in a first aspect, the present application provides a cell lysis solution for extracting nucleic acid, comprising:

[0005]

[0006] In some embodiments, the concentration of NaOH in the cell lysis solution can be 5 mM, 7.5 mM, 10 mM, 12.5 mM, 15 mM, 17.5 mM, 20 mM, or any value therebetween.

[0007] In some embodiments, the concentration of Chelex-100 in the cell lysis solution is 1% (w / v), 2% (w / v), 3% (w / v), 4% (w / v), 5% (w / v), 6% (w / v), 7% (w / v), 8% (w / v), 9% (w / v), 10% (w / v), or any value therebetween.

[0008] In some embodiments, the concentration of NP40 in the cell lysis solution is 0.05% (v / v), 0.1% (v / v), 0.15% (v / v), 0.2% (v / v), 0.25% (v / v), 0.3% (v / v), 0.35% (v / v), 0.4% (v / v), 0.45% (v / v), 0.5% (v / v), or any value therebetween.

[0009] In some embodiments, the concentration of EDTA in the cell lysis solution is 0.05 mM, 0.1 mM, 0.5 mM, 1 mM, 1.5 mM, 2 mM, 2.5 mM, 3 mM, 3.5 mM, 4 mM, 4.5 mM, 5 mM, or any value therebetween.

[0010] In some embodiments, the cell lysis solution comprises:

[0011]

[0012] In some embodiments, it comprises 10 mM NaOH, 5% (w / v) Chelex-100, 0.1% (v / v) NP40, and 0.1 mM EDTA.

[0013] In some embodiments, the cell lysis solution does not comprise Triton X-100. The inventors have found that the exclusion of Triton X-100 from the cell lysis solution of the present application can significantly improve the efficiency of cell identification. It is postulated that the co-use of Triton X-100 and NP-40 can reduce the secondary structure of DNA and increase the amplification of template genes, and the double use of Triton X-100 and NP-40 can significantly increase non-specific amplification, thereby affecting the identification of cells.

[0014] In a second aspect, the present application provides a method for extracting nucleic acid, comprising the step of mixing cells with the cell lysis solution of the first aspect.

[0015] In some embodiments, the method comprises the following steps:

[0016] Mixing cells cultured in a 96-well plate with the cell lysis solution and incubating;

[0017] Centrifuging the 96-well plate containing the cell lysis solution to remove the precipitate.

[0018] In some embodiments, the method further comprises storing the extracted solution obtained before the PCR reaction at 4°C and centrifuging again.

[0019] In some embodiments, the amount of the cell lysis solution added is 15-25 μL. In some embodiments, the amount of the cell lysis solution added can be 15 μL, 16 μL, 17 μL, 18 μL, 19 μL, 20 μL, 21 μL, 22 μL, 23 μL, 24 μL, 25 μL, and any value therebetween.

[0020] In some embodiments, the temperature of the incubation is 92-98°C and the time is 15-40 minutes. In some embodiments, the temperature of the incubation is 92°C, 93°C, 94°C, 95°C, 96°C, 97°C, 98°C, or any value therebetween. In some embodiments, the time of the incubation is 15 minutes, 20 minutes, 25 minutes, 30 minutes, 35 minutes, 40 minutes, or any value therebetween.

[0021] In some embodiments, the speed of the centrifugation is 13000-16000 r / min, for example, 13000 r / min, 14000 r / min, 15000 r / min, 16000 r / min, or any value therebetween.

[0022] In some embodiments, the time of the centrifugation is 2-3 minutes.

[0023] In some embodiments, the method comprises the following steps:

[0024] (1) mixing the cultured cells in a 96-well plate with the cell lysis solution;

[0025] (2) incubating the mixture obtained in step (1) to break the cells and denature the proteins;

[0026] (3) centrifuging the 96-well plate after incubation in step (2) to remove the precipitate;

[0027] (4) The extract solution obtained in step (3) is stored at 4℃ and centrifuged again before the PCR reaction.

[0028] In the nucleic acid extraction method of the present application, after removing the culture solution of the cells cultured in the 96-well plate, the lysis solution is directly added for mixing and incubation. The present application combines the HOTSHOT nucleic acid extraction method with Chelex-100, and the obtained crude nucleic acid extract can be directly subjected to PCR. Compared with the existing PCR method, the DNA purification step is bypassed, time and labor are saved, and various animal cells in trace amounts can be simply, quickly and efficiently processed for direct PCR amplification identification. The method is particularly suitable for high-throughput cell identification of trace gene editing animal cells.

[0029] The present application also provides a PCR method which directly uses the cell lysate obtained by the method according to the second aspect of the present application for PCR.

[0030] In a third aspect, the present application provides a use of the cell lysate according to the first aspect or the method according to the second aspect in the identification of gene editing cells.

[0031] In some embodiments, the gene editing cells are gene editing embryonic stem cells.

[0032] Compared with the prior art, the cell lysate provided by the present application has the following advantages for nucleic acid extraction: fast, time-consuming about 0.5-1 hour; simple, saving the use of proteinase K and its incubation step; no liquid movement between test tubes, reducing nucleic acid loss and the possibility of sample cross contamination; low cost; avoiding the use of harmful chemicals; importantly, it is suitable for DNA preparation of trace cell samples.

[0033] The following examples and drawings are provided to help understand the present application. It should be understood that these examples and drawings are only used to illustrate the present application, but do not constitute any limitation. The actual protection scope of the present application is set forth in the claims. It should be understood that any modification and change can be made without departing from the spirit of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 The agarose gel electrophoresis result diagram using different cell lysates according to Example 1 of the present application is shown.

[0035] Figure 2 The agarose gel electrophoresis result diagram using different cell lysates according to Comparative Example 1 of the present application is shown. DETAILED DESCRIPTION

[0036] Definitions

[0037] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural forms, and vice versa.

[0038] Unless the context clearly indicates otherwise, the terms “a” and “an” as used herein include plural references. For example, reference to “a cell” includes multiple such cells and equivalents known to those skilled in the art, etc.

[0039] The term "Chelex-100" refers to a chemical chelating resin composed of styrene and divinylbenzene copolymers. It contains paired iminodiacetate ions, which can chelate multivalent ions, particularly exhibiting a high affinity and chelating effect for high-valence metal ions. Under low ionic strength, alkaline, and boiling conditions, it can rupture cell membranes and denature proteins. Centrifugation removes the Chelex particles, separating the bound substances from DNA.

[0040] The term "NP 40" refers to ethyl phenyl polyethylene glycol, a nonionic detergent and surfactant used for tasks such as cleaving, melting, stabilizing proteins, and electrophoresis.

[0041] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention in any way. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concepts of this disclosure. Such structures and techniques have also been described in many publications.

[0042] Example 1

[0043] S1: Culture mouse Wwc2floxed heterozygous gene-edited cells in 96-well plates, discard the cell culture medium, and add 20 μL of the following cell lysis buffer to 2 wells of each group:

[0044] #1: NaOH is 10mM, NP40 is 0.1% (v / v), EDTA is 0.1mM;

[0045] #2: Proteinase K was 100 g / ml, Chelex-100 was 5% (w / v), NP40 was 0.1% (v / v), and EDTA was 0.1 mM;

[0046] #3: NaOH is 10mM, Chelex-100 is 5% (w / v), NP40 is 0.1% (v / v), and EDTA is 0.1mM;

[0047] #4: Proteinase K is 100 g / ml, NP40 is 0.1% (v / v), and EDTA is 0.1 mM.

[0048] S2: #2 and #4 are incubated at 56°C for 60 minutes and then at 95°C for 15 minutes; #1 and #3 are incubated at 98°C for 40 minutes.

[0049] S3: The test tube is centrifuged at high speed for 2-3 minutes to precipitate impurities.

[0050] S4: The sample tube is stored at 4°C before the PCR reaction and is centrifuged again to precipitate the Chelex particles.

[0051] S5: 0.5 μL of the supernatant after centrifugation is taken as a DNA template. 0.2 μL of GreenTaq enzyme, 0.3 μmol of primer, and ddH2O are added to make up to 9.5 μL, and the DNA template is added.

[0052] PCR amplification conditions: 95°C, 120 s; (94°C, 15 s, 60°C, 30 s, 72°C, 60 s), 35 cycles; 72°C, 10 min; 4°C, hold.

[0053]

[0054] The sequences used in the experiment are as follows (the WT band is 257 bp; the Floxed band is 405 bp):

[0055] Wwc2FF88 CAGTGGGGCTGTGTCTATGG

[0056] Wwc2R1074 ATCCTCAGGCAGACCTAAACC

[0057] S6: After amplification, 5 μL of the amplification product is taken for 1.5% agarose gel analysis, and the results are shown in the following table. Figure 1

[0058] The results show that cell lysates #1 to #3 have obvious Floxed and WT bands, while cell lysate #4 cannot detect the Floxed genotype product, indicating that the traditional proteinase K lysate is not suitable for microcell samples. Cell lysates #1-3 show different band strengths, with cell lysate #3 being the strongest, indicating that the cell lysate of the present application can efficiently obtain nucleic acids from microcell samples.

[0059] Comparative Example 1

[0060] ​​The same method as that of cell lysate #3 in Example 1 was used, except that the cell lysate (cell lysate #5) was: NaOH 10 mM, Chelex-100 5% (w / v), NP40 0.1% (v / v), EDTA 0.1 mM; Triton X-100 1% (v / v). After the amplification, 5 μL of the amplification product was taken for 1.5% agarose gel analysis, and the results are shown in Figure 2

[0061] The results show that cell lysate #5 (Triton X-100+) has stronger non-specific amplification bands (as shown by arrows) than cell lysate #3 (Triton X-100-). This is because Triton X-100 and NP-40 are both non-ionic detergents, which can reduce the secondary structure of DNA and increase the amplification of template genes, but the double use of Triton X-100 and NP-40 can significantly increase non-specific amplification, and the effect of NP-40 is more moderate, so in order to reduce non-specific amplification, only NP-40 is used in the cell lysate of the present application, and Triton X-100 is not used. Figure 2

[0062] The technical solutions of the present application are not limited to the above specific examples, and any technical variations made according to the technical solutions of the present application fall within the scope of protection of the present application.​​

Claims

1. A cell lysis solution for extracting nucleic acids, consisting of: 5-20 mM NaOH; 1-10% w / v Chelex-100; 0.05-0.5% v / v NP40; and 0.05-5 mM EDTA.

2. The cell lysate of claim 1, wherein, The cell lysis solution consists of: 5-15 mM NaOH; 5-10% w / v Chelex-100; 0.1-0.3% v / v NP40; and 0.1-5 mM EDTA.

3. The cell lysate according to claim 1 or 2, characterized in that, The cell lysis solution consists of 10 mM NaOH, 5% w / v Chelex-100, 0.1% v / v NP40 and 0.1 mM EDTA.

4. A method for extracting nucleic acids, comprising the step of mixing cells with the cell lysis solution of any one of claims 1-3.

5. The method of claim 4, wherein, The method comprises the steps of: mixing cells cultured in a 96-well plate with the cell lysis solution and incubating; centrifuging the 96-well plate containing the cell lysis solution to remove the precipitate.

6. The method according to claim 4 or 5, characterized in that, The method further comprises storing the extract obtained before the PCR reaction at 4°C and centrifuging again.

7. The method of claim 5, wherein, The cell lysis solution is added in an amount of 15-25 μL; and / or The incubation is at a temperature of 92-98°C for a time of 15-40 minutes; and / or The centrifugation is at a speed of 13000-16000 r / min for a time of 2-3 minutes.

8. Use of the cell lysis solution according to any one of claims 1-3 or the method according to any one of claims 4-7 in the identification of gene edited cells.

9. Use according to claim 8, characterized in that, The gene edited cells are gene edited embryonic stem cells.

Images