A gene SlCAS1 that promotes tomato fruit ripening and its regulation method
The CRISPR/Cas system targeted editing of tomato SlCAS1 gene was used to promote tomato fruit ripening by Agrobacterium infection, solving the problem of uneven ripening of tomato fruits, and achieving early ripening of fruits and improving economic benefits.
Patent Information
- Application Number
- CN202211135305.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-19
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2042-09-19
AI Technical Summary
The existing technology is difficult to effectively regulate the ripening process of tomato fruits, resulting in uneven ripening of fruits, affecting transportation, storage and sales, and causing waste of resources and economic losses.
The SlCAS1 gene in tomatoes is targeted by the CRISPR/Cas system, and the edited genes are introduced into tomato plants by Agrobacterium infectious method to promote fruit maturation.
The tomato fruits have been ripened early, the commercial nature of the fruits and the economic benefits of growers have been improved, and the problem of uneven fruit ripening has been solved.
Smart Images

Figure CN115466743B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of bioengineering technology, relates to a gene promoting tomato fruit ripening and a regulation method thereof, and particularly relates to a cyanalanine synthase encoding gene SlCAS1 and application of the gene in promoting tomato fruit ripening. Background Art
[0002] Tomato (Solanum lycopersicum), also known as tomato, is an annual or perennial herbaceous plant in the Solanaceae family, Solanales order. Native to South America, tomatoes are widely cultivated in both northern and southern China. Tomato fruit is highly nutritious and has a distinctive flavor. Tomato fruit ripening is a unique physiological characteristic of the plant, playing an important role in seed dispersal and plant reproduction. As a classic model for respiratory climacteric fruit, tomato (Solanum lycopersicum) has been extensively studied regarding fruit ripening and senescence. Identifying new functional genes involved in regulating fruit ripening remains a key goal in horticulture, contributing to increasing the commercial value of crops.
[0003] It's well known that ethylene promotes fruit ripening in plants. However, when ethylene is produced by the oxidation of ACC by ACC oxidase (ACO), it also produces equal amounts of HCN and CO2. Cyanide, however, inhibits the respiratory chain and generally reduces plant growth. Mitigating the toxicity of cyanide produced by cyanogenic glycosides and cyanoesters is one of the many complex factors influencing tomato fruit ripening. The decyanation pathway in plants involves cyanoalanine synthase (CAS), which catalyzes the synthesis of the non-protein amino acid cyanoalanine from Cys and HCN. Knockout of AtCYS-C1, encoding the mitochondrial β-cyanoalanine synthase, increases cyanide levels in roots, inhibiting root hair formation. In avocado and carnation flowers, when ethylene production is increased hundreds-fold, HCN levels become almost undetectable, while CAS enzyme activity increases, indicating that cyanoalanine synthase (CAS) plays a powerful role in decyanation. Furthermore, CAS activity levels are significantly higher in climacteric fruit than in non-climacteric fruit. For example, MdCAS1 and MdCAS2 can detoxify cyanide during apple ripening. These studies suggest that CAS is a key enzyme in plant decyanation. Although CAS has been reported to be downstream of the ethylene production pathway, whether CAS directly regulates fruit ripening remains unclear.
[0004] Although tomato cultivation continues to expand, tomato consumption in many regions is still limited by factors such as transportation, storage, and sales. August and September are the peak season for tomato ripening. During this period, tomato supply exceeds demand, and sales are slow, causing many tomatoes to mold and rot, affecting their quality. This not only wastes resources but also causes economic losses for producers. Breeding early-maturing tomato varieties can mitigate these losses. Early-maturing tomatoes have a shorter growth cycle, faster coloring, and earlier fruit maturity, allowing them to be marketed earlier. This not only improves the marketability of tomatoes, but also increases the economic benefits for growers and regulates off-season market supply.
[0005] The CRISPR / Cas system consists of two components: clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated proteins (Cas). The system requires small guide RNA (sgRNA) and a PAM (5′-NGG) structure in the gene sequence to direct the Cas protein's endonuclease activity. Numerous types of Cas proteins are known, with the most widely used, Cas9, belonging to the Type II system. Cas9 binds to the sgRNA to form a complex, undergoing a conformational change. Guided by the sgRNA, the complex recognizes the PAM site in the gene sequence and anchors to the target site. The Cas protein's endonuclease creates a precise double-strand break at the target site, triggering the cell's self-repair mechanisms. Genetic modification of the target gene occurs through non-homologous end joining or homologous recombination. Summary of the Invention
[0006] The object of the present invention is to provide a gene S1CAS1 that promotes tomato fruit ripening and a regulation method thereof.
[0007] To achieve the above-mentioned and other related purposes, the present invention provides a technical solution: a gene SlCAS1 that promotes tomato fruit ripening, the nucleotide sequence of which is shown in Seq No.1.
[0008] To achieve the above-mentioned and other related purposes, the present invention provides a technical solution: a method for promoting tomato fruit ripening, comprising the following steps:
[0009] Step 1: Dilute target 1 forward primer-F1, target 1 reverse primer-R1, target 2 forward primer-F2, and target 2 reverse primer-R2 with sterile ddH2O to a concentration of 1 μM. Place the mixture in a PCR instrument and incubate at 88-92°C for 25-35 seconds. Then cool to room temperature to complete target primer annealing and obtain a target adapter primer mixture.
[0010] Target one forward primer-F1: 5′- GTCACATCAATGGCGTCGTTGGTG -3′;
[0011] Target one reverse primer-R1: 5′- AAACCACCAACGACGCCATTGATG -3′;
[0012] Target two forward primer-F2: 5′- GTCAGACTACTGGCCCTGAAATC -3′;
[0013] Target two reverse primer-R2: 5′- AAACGATTTCAGGGCCAGTAGTC -3′;
[0014] Step 2: Prepare an enzyme digestion and ligation reaction solution containing the target adapter primer mixture in step 1, and use the cleavage and ligation method to connect the target adapter to the gRNA expression cassette to amplify the gRNA expression cassette;
[0015] Step 3: Using the product obtained in step 2 as a template, perform the first round of PCR amplification;
[0016] Step 4: Using the first-round PCR amplification product obtained in step 3 as a template, perform a second round of PCR amplification and estimate the product concentration after amplification is completed;
[0017] Step 5: Mix equal amounts of the two second-round PCR products obtained in step 4, purify them using a DNA product purification kit, and then take 2 μL of the purified product for agarose gel electrophoresis to check the purification effect of the product. If the concentration is not less than 5 ng / μL, proceed to the next step;
[0018] Step 6: Use the cut-and-ligate method to connect the gRNA expression cassette and the Cas9 plasmid;
[0019] Step 7: After the ligation is completed, the ligation product of step 6 is transformed into Escherichia coli DH5α by chemical heat shock method, and the plasmid is extracted and sequenced;
[0020] Step 8: Crispr / Cas9- SlCAS1 The plasmid was transformed into EHA105 Agrobacterium competent cells;
[0021] Step 9: Place the Crispr / Cas9- SlCAS1 Agrobacterium EHA105 carrying the plasmid infected tomato cotyledons and obtained transgenic positive seedlings CAS1 .
[0022] Step 10: Using tomato cDNA as a template, two rounds of primers were designed based on the mRNA sequence. The first round of primers had no restriction enzyme cleavage site. The second round of upstream primers must start at the start codon or a few bases before the start codon, and the downstream primer must start at the stop codon. Both rounds of primers must include restriction enzyme cleavage sites. PCR amplification was performed using upstream primer-F and downstream primer-R. After purification of the PCR amplification product, the target gene fragment was obtained.
[0023] First-round forward primer-F1: 5′-AGAGATAGACATTTACAGGCTTCA-3′;
[0024] First-round reverse primer-R1: 5′-TTGAACACTAATCAACTGATACAGG-3′;
[0025] Second-round forward primer-F2: 5′-CGCGGATCCATAAATTTCATCAATGGCGTCGTTG-3′;
[0026] Second-round reverse primer-R2: 5′-CCGCTCGAGATCAACTGATACAGGTTGCATGTTT-3′;
[0027] Step 11: Double-digest the vector pBI121 with restriction endonucleases BamHI and XhoI. Purify the digestion product to obtain the linearized pBI121 vector.
[0028] Step 12: The target gene fragment and the linearized pBI121 vector are recombined to obtain the CAS1-pBI121 plasmid;
[0029] Step 13: Transform the CAS1-pBI121 plasmid into EHA105 Agrobacterium competent cells;
[0030] Step 14: Agrobacterium EHA105 containing the CAS1-pBI121 plasmid was used to infect tomato cotyledons and obtain transgenic positive seedlings SlCAS1-OE.
[0031] The preferred technical solution is: in step 2, the enzyme digestion and ligation reaction solution is: 1 μL of 10× cutsmart buffer, 20 ng of pYLgRNA-AtU# plasmid, 0.5 μL of target adapter primer, 0.4 μL of BsaI, 0.1 μL of T4 DNA ligase, 0.4 μL of T4 DNA ligase buffer, and ddH2O is added to 10 μL; PCR amplification parameters are: 37°C, 5 min; 20°C, 5 min; 5 cycles.
[0032] The preferred technical solution is: the first round of PCR amplification in step 3 includes:
[0033] First-round PCR amplification reaction 1: 1 μL of the product obtained in step 2, 4 μL of primer pair UF / R1, 1 μL of dNTPs, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5× Super-Fidelity DNA Polymerase buffer, 33 μL of ddH2O; PCR conditions: 95°C, 1 min; 95°C, 10 s; 60°C, 15 s; 72°C, 15 s; 25 cycles; 72°C, 10 min; 4°C, ∞; obtain first-round PCR amplification product 1;
[0034] First-round PCR amplification reaction II: 1 μL of the product obtained in step 2, 4 μL of primer pair UF / R2, 1 μL of dNTPs, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5× Super-Fidelity DNA Polymerase buffer, 33 μL of ddH2O; PCR conditions: 95°C, 1 min; 95°C, 10 s; 60°C, 15 s; 72°C, 15 s; 25 cycles; 72°C, 10 min; 4°C, ∞; obtain first-round PCR amplification product II;
[0035] First-round PCR amplification reaction three: 1 μL of the product obtained in step 2, 4 μL of primer pair UF / F1, 1 μL of dNTPs, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5× Super-Fidelity DNA Polymerase buffer, 33 μL of ddH2O; PCR conditions: 95°C, 1 min; 95°C, 10 s; 60°C, 15 s; 72°C, 15 s; 25 cycles; 72°C, 10 min; 4°C, ∞; to obtain first-round PCR amplification product three;
[0036] First-round PCR amplification reaction four: 1 μL of the product obtained in step 2, 4 μL of primer pair UF / F1, 1 μL of dNTPs, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5× Super-Fidelity DNA Polymerase buffer, 33 μL of ddH2O; PCR conditions: 95°C, 1 min; 95°C, 10 s; 60°C, 15 s; 72°C, 15 s; 25 cycles; 72°C, 10 min; 4°C, ∞; to obtain first-round PCR amplification product four;
[0037] UF: 5'-CTCCGTTTTACCTGTGGAATCG-3';
[0038] gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3'.
[0039] The preferred technical solution is: pre-mix the position-specific primer pairs into a 10× working solution, 1.5 μM each: PT1=1.5 μL B1'+1.5 μL B2+7 μL ddH2O, PT2L=1.5 μL B2'+1.5 μL BL+7 μL ddH2O; the target one reaction system is: 1 μL each of the two target one PCR reaction products of one round of PCR amplification, 3 μL of primer combination working solution PT1, 0.6 μL of dNTPs, 0.6 μL of Super-Fidelity DNA Polymerase, 6 μL of 5× Super-Fidelity DNA Polymerase buffer, and 17.8 μL of ddH2O; the target two reaction system is: 1 μL each of the two target two PCR reaction products of one round of PCR amplification, 3 μL of primer combination working solution PT2L, 0.6 μL of dNTPs, 0.6 μL of Super-Fidelity DNA Polymerase, 6 μL of 5× Super-Fidelity DNA Polymerase buffer and 17.8 μL of ddH2O were mixed and placed in a PCR instrument; the PCR reaction conditions were: 95°C, 1 min; 95°C, 10 s, 60°C, 15 s, 72°C, 15 s, 18 cycles; 72°C, 10 min; 4°C, ∞.
[0040] B1': 5'-TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG-3';
[0041] B2: AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC;
[0042] B2':TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG;
[0043] BL: AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC.
[0044] A preferred technical solution is as follows: In step 6, take 20-70 ng of the second-round purified product, add 80-100 ng of uncut pYLCRISPR / Cas9-DN plasmid, 1.5 μL of 10× cutsmart buffer, and 0.5 μL of BsaI endonuclease. Bring the volume to 15 μL with ddH2O. Mix thoroughly and incubate in a PCR instrument at 37°C for 10 minutes to digest the pYLCRISPR / Cas9-DN plasmid. Add 0.4 μL of 10× T4 DNA ligase buffer and 0.1 μL of T4 DNA ligase to the digested reaction. Mix again and incubate in a PCR instrument for 13 cycles: 37°C for 2 minutes, 10°C for 3 minutes, and 20°C for 5 minutes, followed by 37°C for 2 minutes and 4°C for ∞.
[0045] The preferred technical solution is as follows: in step 7, 1 μL of the ligation product obtained in step 7 is added to 100 μL of Escherichia coli DH5α competent cells, placed on ice for 30 min, heat-shocked at 42°C for 45 s, and then placed on ice for 2-3 min; 700 μL of LB liquid medium is added to a centrifuge tube, and the tube is shaken and cultured at 37°C and 200 rpm for 60 min; the cultured bacterial solution is centrifuged at 5000 rpm for 2 min, 600 μL of the supernatant is discarded, and the remaining bacterial solution is evenly spread on LB solid medium containing kanamycin (500 uL of 10 mg / mL kanamycin is added to every 100 mL of LB solid medium), and cultured inverted at 37°C for 16 h; a single clone is picked and mixed by pipetting in 10 μL of sterile water, and 2 μL of the bacterial solution is taken for colony identification. The colony PCR system is 25 μL: 2 μL of bacterial solution, 1 μL each of the primer pair SP-DL / SP-R on the 10 μM binary vector, and 2× Rapid Mix 12.5 μL of Taq Master Mix and 8.5 μL of ddH₂O, then place in a PCR instrument. PCR conditions were as follows: initial denaturation at 95°C for 3 minutes; 32 cycles of denaturation at 95°C for 15 seconds, annealing at 55°C for 1 minute, and extension at 72°C for 45 seconds; complete extension at 72°C for 5 minutes; and 4°C ∞. After the reaction, check the PCR product band size on an agarose gel to ensure it conforms to the theoretical value. Transfer the remaining bacterial suspension containing the correct band size to 4 mL of LB liquid medium containing kanamycin and incubate on a shaker at 37°C / 200 rpm for 16 hours. Extract the plasmid using a plasmid miniprep kit and verify the success of the extraction by running it on an agarose gel. The extracted plasmid was then sent to Sangon for further sequencing and verification.
[0046] The preferred technical solution is: in step 8, take 100 μL of Agrobacterium competent cells EHA105, melt them in an ice bath, add 1 μL of correctly sequenced Cas9 plasmid, gently stir the bottom of the centrifuge tube by hand, mix, and let it stand on ice for 5 minutes, liquid nitrogen for 5 minutes, 37°C water bath for 5 minutes, and ice bath for 5 minutes; add 700 μL of antibiotic-free LB liquid medium, shake and culture at 28°C for 2-3 hours; centrifuge at 6000 rpm for 1 minute to collect the bacteria, retain about 100 μL of supernatant, mix and resuspend the bacteria by pipetting, spread on LB-Kana / Rif solid medium, and invert and culture in a 28°C incubator for 2-3 days.
[0047] The preferred technical solution is: in step 9, pick a single colony of Agrobacterium containing the Cas9 vector constructed in step 9 and place it in 3 mL of LB liquid medium containing Kana and Rif, culture it at 200 rpm and 28°C for 12-16 h, then take 300 μL and place it in 20 mL of LB liquid medium containing Kana and Rif, culture it at 200 rpm and 28°C for 6-7 h, and detect the OD value of the bacterial solution using a spectrophotometer. 600 to 0.5-0.6. Centrifuge at 5000 rpm for 10 min at room temperature to collect the bacteria, and dilute the bacteria with sterile water to OD 600 =0.1-0.2, ready for use. Pre-culture the tomato cotyledons and stem segments in the dark for 2 days, then soak them in the diluted Agrobacterium infection solution, shake them, and pour out the infection solution after 5 minutes of infection. Use a pipette to suck off the excess infection solution. The cotyledons and stem segments are then germinated, elongated, and rooted on a culture medium containing different plant hormones. The rooted explants are transferred to nutrient soil for subsequent sequencing and identification, thereby obtaining transformed tomato plants. Subsequently, by designing upstream and downstream primers for the target site, the transgenic tomato plant DNA is extracted, PCR amplified, and sequenced for identification and analysis. SlCAS Whether gene editing occurs.
[0048] The preferred technical solution is: in step 10, the PCR amplification system is 50 μL: 2 μL tomato cDNA, 2 μL each of upstream primer-F and downstream primer-R, 10 μL 5× high-fidelity DNA polymerase buffer, 1 μL high-fidelity DNA polymerase, 1 μL deoxyribonucleoside triphosphate dNTP mixture, and double-distilled water to 50 μL.
[0049] A preferred technical solution is as follows: In step 10, the total reaction volume for the first round of PCR is 50 μL, containing 4 μL of template (cDNA reverse-transcribed from tomato RNA extraction), 1 μL of forward primer F1, 1 μL of reverse primer R1, 4 μL of dNTPs, 5 μL of PCRsit, 1 μL of pfu enzyme, 10 μL of 5× pfu buffer, and 24 μL of sterile ddH2O. The second round of PCR is identical to the first round, except that the first-round PCR product is used as the template and the primer pairs are swapped with F2 and R2. PCR amplification parameters are: 95°C pre-denaturation for 5 min, 95°C denaturation for 20 s, 55°C annealing for 20 s, 72°C extension for 1 min 25 s, 38 cycles, 72°C extension for 5 min, and storage at 4°C. The second-round product is purified and recovered using a standard DNA purification kit.
[0050] A preferred technical solution is as follows: In step 11, the total enzyme digestion system is 50 μL, containing 20 μL PBI121 vector plasmid / second-round purification product, 2 μL Xho I, 2 μL BamH I, 5 μL Cut smart buffer, and 21 μL sterile ddH2O. The PBI121 vector is digested at 37°C for 4 hours, and the purified product is digested at 37°C overnight. The resulting digestion products are gel-cleaved and purified using a DNA gel recovery kit.
[0051] The preferred technical solution is as follows: in step 12, the target gene fragment and the linearized pBI121 vector are recombined using the ClonExpressⅡ One Step Cloning Kit, and the recombination conditions are as follows: ligation at 37°C for 30 minutes, followed by storage on ice; the PCR amplification product obtained in step 1 is added to 100 μL of Escherichia coli DH5α competent cells, incubated on ice for 30 minutes, heat-shocked at 42°C for 45 seconds, and then ice-bathed for 2-3 minutes; 700 μL of LB liquid medium is added to a centrifuge tube, and the tube is shaken and cultured at 37°C and 150 rpm for 45 minutes; the cultured bacterial solution is centrifuged at 4000 rpm for 2 minutes, 200 μL of the supernatant is discarded, and the remaining bacterial solution is evenly spread on solid culture medium containing kanamycin (500 ul of 10 mg / ml kanamycin is added to every 100 ml of solid LB), and cultured inverted at 37°C for 16 hours; a single clone is picked, pipetted and mixed in 10 μL of sterile water, and 2 μL of the bacterial solution is taken for colony identification. Six positive clones were picked for sequencing.
[0052] The preferred technical solution is: in step 12, when performing colony identification, the colony PCR system is 25µL: 2µL bacterial solution, 1µL forward primer F2, 1µL reverse primer R2, 12.5µL 2×Taq polymerase mixture, 8.5µL double distilled water, and mixed on ice; the PCR parameters are: pre-denaturation at 95°C for 3min; denaturation at 95°C for 15s; annealing at 55°C for 15s, extension at 72°C for 2min15s, 35 cycles; extension at 72°C for 5min; storage at 4°C. After the reaction is completed, the product is subjected to agarose gel electrophoresis to detect whether the band size is consistent with the result. The single clone with the correct band position is expanded and cultured, that is, 5 ml of LB liquid medium is added to the bacterial solution, and 25µL of 10 mg / mL kanamycin is added and mixed, and cultured in a shaker at 37°C and 200 rpm for 12-16h, and then the plasmid in the bacterial solution is extracted and stored at -20°C. Primers were designed at both ends of the CAS1 gene fragment on the PBI121 vector for sequencing.
[0053] The preferred technical solution is as follows: in step 13, the test tube containing the EHA105 Agrobacterium competent cells in the ice-water mixture is inserted into ice, and then 1 μL of CAS1-pBI121 plasmid is added, the bottom of the tube is stirred to mix, and the mixture is allowed to stand on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes; then, the mixture is inoculated into 700 ml of liquid LB medium and cultured in a shaker at 37°C and 150 rpm for 2-3 hours; the mixture is centrifuged at 5000 rpm for 1 minute, and about 100 μL of the supernatant is retained and the resuspended bacterial solution is gently pipetted and coated on an LB plate containing kanamycin and rifampicin (500 μL of 10 mg / ml kanamycin and 500 μL of 10 mg / ml rifampicin are added to every 100 ml of solid LB). Rifampicin was added to the plate and inverted in a 28°C incubator for 2–3 days. Once colonies grew, several single colonies were randomly picked with a pipette tip and dissolved in 10 μL of sterile water to prepare a bacterial suspension. 2 μL of the suspension was used for colony identification. To the bacterial suspension with the correct band position, 5 mL of LB liquid medium, 10 μL of 10 mg / mL rifampicin, and 25 μL of 10 mg / mL kanamycin were added. The suspension was shaken at 37°C, 200 rpm, and cultured overnight to obtain EHA105 Agrobacterium containing the CAS1-pBI121 plasmid.
[0054] The preferred technical solution is: in step 14, after the tomato seeds are cleaned and disinfected with sodium hypochlorite and alcohol, they are sown on the rooting medium T0, cultured in the dark for 5-7 days, and then cultured under light after germination. When the buds grow into two cotyledons, you can prepare to cut the leaves. Cut the tomato cotyledons into small squares, one cotyledon can be cut into two halves, and the stems can be cut into small sections. Place the leaves and stems on the pre-culture medium T1. Soak the explants after 2 days of pre-culture in the EHA105 Agrobacterium infection solution containing the CAS1-pBI121 plasmid, shake, and pour out the infection solution after 5 minutes of infection. Use a gun tip to suck off the excess infection solution, put the explants back on the pre-culture medium T1, culture in the dark for 2 days, and transfer to the bud induction medium T 21 After culturing with the back side facing down at 25°C and 16h light intensity for 7 days, the cells were transferred to a new bud induction medium T. 21 Subculture; replace new bud induction medium T every 2 weeks thereafter 21 Subculture, when the explants sprout 2-3cm, transfer to bud elongation medium T 22 Culture for 3-4 weeks, and replace the new bud elongation medium every two weeks. 22 When the buds elongate to 4-5 cm, cut off the callus tissue at the root and transfer them to rooting medium T3 for 3-4 weeks to obtain rooted seedlings. The rooted seedlings are transferred to soil pots and allowed to grow for 3-7 days. After the growth, the tomato seedlings are transferred to a soil culture room and grown normally under 16 hours of light to obtain transgenic positive seedlings.
[0055] The preferred technical solution is as follows: in step 14, the infection solution is prepared as follows: a single colony of EHA105 Agrobacterium containing the CAS1-pBI121 plasmid is picked up and placed in 3 mL of LB liquid medium (containing 15 ul 10 mg / ml kanamycin and 15 ul 10 mg / ml rifampicin), 200 rpm, 28 ° C overnight; the next day, 300 μL of the bacterial solution is placed in 20 mL of LB liquid medium (containing 100 ul 10 mg / ml kanamycin and 100 ul 10 mg / ml rifampicin), 200 rpm, 28 ° C shaking culture for 6-7 hours; OD is detected by spectrophotometer. 600 to 0.5-0.6; centrifuge at 5000 rpm for 10 min at room temperature to collect the bacteria, and dilute the bacteria with sterile water to OD 600 =0.1-0.2, and the EHA105 Agrobacterium infection solution containing the CAS1-pBI121 plasmid was obtained.
[0056] Due to the application of the above technical solution, the present invention has the following advantages compared with the prior art:
[0057] 1. The present invention obtains the complete coding sequence of the SlCAS1 gene from tomatoes, designs a target site, connects the target site to the vector CRIPSR-Cas9, and transforms the plant using Agrobacterium infection to obtain gene-edited plants, which are then analyzed.
[0058] 2. The present invention obtains the complete coding sequence of the SlCAS1 gene from tomatoes, amplifies the mRNA sequence, connects the fragment to the vector pBI121, and transforms the plant using Agrobacterium infection to obtain transgenic plants, which are then analyzed.
[0059] Combining the results of the above two plants shows that this gene can promote the ripening of tomato fruits. BRIEF DESCRIPTION OF THE DRAWINGS
[0060] Figure 1 The ripening time of WT and virus-induced SlCAS1-silenced tomato fruits and the expression level of SlCAS1.
[0061] Figure 2 Chlorophyll, carotenoids, and lycopene contents in WT and virus-induced SlCAS1-silenced tomato fruits.
[0062] Figure 3 This is the sequencing identification diagram of the CRIPSR-Cas9-SlCAS1 plasmid. The yellow part is the target sequence and the green part is the gRNA expression box sequence, indicating that the gene editing vector was successfully constructed.
[0063] Figure 4This is the target identification diagram of the SlCAS1 gene-edited plant, indicating that the SlCAS1 gene was successfully mutated.
[0064] Figure 5 for CAS1 First-round PCR, second-round PCR and purification of target gene fragment.
[0065] Figure 6 For tomatoes CAS1 High expression identification diagram, that is, PCR amplification using kanamycin resistance gene shows correct bands.
[0066] Figure 7 For tomatoes CAS1 High expression identification chart, i.e. identification using RT-qPCR technology CAS1 Highly expressing plants CAS1 Gene expression level.
[0067] Figure 8 Tomato fruit ripening time of WT, SlCAS1 gene-edited plants and SlCAS1 overexpression plants.
[0068] Figure 9 Chlorophyll, carotenoids, and lycopene contents in tomato fruits of WT, SlCAS1 gene-edited plants, and SlCAS1 overexpressing plants.
[0069] Figure 10 The expression levels of genes related to chlorophyll degradation and carotenoid synthesis in tomato fruits of WT, SlCAS1 gene-edited plants and SlCAS1 high-expression plants. DETAILED DESCRIPTION
[0070] The following describes the embodiments of the present invention by means of specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.
[0071] See also Figure 1-10 It should be noted that the structures, proportions, sizes, etc. illustrated in the drawings of this specification are only used to match the contents disclosed in the specification for people familiar with this technology to understand and read, and are not used to limit the conditions under which the present invention can be implemented. Therefore, they have no technical substantive significance. Any structural modification, change in proportional relationship or adjustment of size is provided in the following examples for a better understanding of the present invention, but is not intended to limit the present invention. The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all purchased from conventional biochemical reagent stores unless otherwise specified.
[0072] Example 1: A gene S1CAS1 that promotes tomato fruit ripening and its regulation method
[0073] A gene S1CAS1 that promotes tomato fruit ripening, the nucleotide sequence of the gene is shown in Seq No. 1.
[0074] A method for promoting tomato fruit ripening, comprising the following steps:
[0075] Step 1: Dilute target 1 forward primer-F1, target 1 reverse primer-R1, target 2 forward primer-F2, and target 2 reverse primer-R2 with sterile ddH2O to a concentration of 1 μM. Place the mixture in a PCR instrument and incubate at 88-92°C for 25-35 seconds. Then cool to room temperature to complete target primer annealing and obtain a target adapter primer mixture.
[0076] Target one forward primer-F1: 5′- GTCACATCAATGGCGTCGTTGGTG -3′;
[0077] Target one reverse primer-R1: 5′- AAACCACCAACGACGCCATTGATG -3′;
[0078] Target two forward primer-F2: 5′- GTCAGACTACTGGCCCTGAAATC -3′;
[0079] Target two reverse primer-R2: 5′- AAACGATTTCAGGGCCAGTAGTC -3′;
[0080] Step 2: Prepare an enzyme digestion and ligation reaction solution containing the target adapter primer mixture in step 1, and use the cleavage and ligation method to connect the target adapter to the gRNA expression cassette to amplify the gRNA expression cassette;
[0081] Step 3: Using the product obtained in step 2 as a template, perform the first round of PCR amplification;
[0082] Step 4: Using the first-round PCR amplification product obtained in step 3 as a template, perform a second round of PCR amplification and estimate the product concentration after amplification is completed;
[0083] Step 5: Mix equal amounts of the two second-round PCR products obtained in step 4, purify them using a DNA product purification kit, and then take 2 μL of the purified product for agarose gel electrophoresis to check the purification effect of the product. If the concentration is not less than 5 ng / μL, proceed to the next step;
[0084] Step 6: Use the cut-and-ligate method to connect the gRNA expression cassette and the Cas9 plasmid;
[0085] Step 7: After the ligation is completed, the ligation product of step 6 is transformed into Escherichia coli DH5α by chemical heat shock method, and the plasmid is extracted and sequenced;
[0086] Step 8: Crispr / Cas9- SlCAS1 The plasmid was transformed into EHA105 Agrobacterium competent cells;
[0087] Step 9: Place the Crispr / Cas9- SlCAS1 Agrobacterium EHA105 carrying the plasmid infected tomato cotyledons and obtained transgenic positive seedlings CAS1 .
[0088] Step 10: Using tomato cDNA as a template, design two rounds of primers based on the mRNA sequence. The first round of primers lacks a restriction enzyme cleavage site. The second round of upstream primers must begin at or a few bases before the start codon, and the downstream primer must begin at the stop codon. Both rounds of primers must incorporate restriction enzyme cleavage sites. PCR amplification is performed using upstream primer-F and downstream primer-R. After purification of the PCR amplification product, the target gene fragment is obtained.
[0089] First-round forward primer-F1: 5′-AGAGATAGACATTTACAGGCTTCA-3′;
[0090] First-round reverse primer-R1: 5′-TTGAACACTAATCAACTGATACAGG-3′;
[0091] Second-round forward primer-F2: 5′-CGCGGATCCATAAATTTCATCAATGGCGTCGTTG-3′;
[0092] Second-round reverse primer-R2: 5′-CCGCTCGAGATCAACTGATACAGGTTGCATGTTT-3′;
[0093] Step 11: Double-digest the vector pBI121 with restriction endonucleases BamHI and XhoI. Purify the digestion product to obtain the linearized pBI121 vector.
[0094] Step 12: The target gene fragment and the linearized pBI121 vector are recombined to obtain the CAS1-pBI121 plasmid.
[0095] Step 13: Transform the CAS1-pBI121 plasmid into EHA105 Agrobacterium competent cells;
[0096] Step 14: Agrobacterium EHA105 containing the CAS1-pBI121 plasmid was used to infect tomato cotyledons and obtain transgenic positive seedlings SlCAS1-OE.
[0097] In step 2, the enzyme digestion and ligation reaction solution is: 1 μL of 10× cutsmart buffer, 20 ng of pYLgRNA-AtU# plasmid, 0.5 μL of target adapter primer, 0.4 μL of BsaI, 0.1 μL of T4 DNA ligase, 0.4 μL of T4 DNA ligase buffer, and ddH2O to 10 μL; PCR amplification parameters are: 37°C, 5 min; 20°C, 5 min; 5 cycles.
[0098] Step 3 includes two PCR amplification reactions. The first round of PCR amplification is a 50 μL reaction system: 1 μL of the cut and ligated product, 4 μL of the primer pair UF / Rn (reaction 1), 1 μL of dNTPs, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5× Super-Fidelity DNA Polymerase buffer, and 33 μL of ddH2O. The PCR conditions are: 95°C, 1 min; 95°C, 10 s; 60°C, 15 s; 72°C, 15 s; 25 cycles; 72°C, 10 min; 4°C, ∞. The second round of PCR amplification is a 50 μL reaction system: 1 μL of the cut and ligated product, 4 μL of the primer pair F n / gRNA-R (reaction 2), 1 μL dNTPs, 1 μL Super-Fidelity DNA Polymerase, 10 μL 5× Super-Fidelity DNA Polymerase buffer, 33 μL ddH2O; PCR conditions: 95°C, 1 min; 95°C, 10 s; 60°C, 15 s; 72°C, 15 s; 25 cycles; 72°C, 10 min; 4°C, ∞
[0099] UF: 5'-CTCCGTTTTACCTGTGGAATCG-3';
[0100] gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3'.
[0101] 5. In step 4, pre-mix the position-specific primer pairs into a 10× working solution, 1.5 μM each: PT1 = 1.5 μL B1' + 1.5 μL B2 + 7 μL ddH2O, PT2L = 1.5 μL B2' + 1.5 μL BL + 7 μL ddH2O. The target site one reaction system consisted of 1 μL of each of the two target site one PCR reaction products from one round of PCR amplification, 3 μL of primer combination working solution PT1, 0.6 μL of dNTPs, 0.6 μL of Super-Fidelity DNA Polymerase, 6 μL of 5× Super-Fidelity DNA Polymerase buffer, and 17.8 μL of ddH2O. The target site two reaction system consisted of 1 μL of each of the two target site two PCR reaction products from one round of PCR amplification, 3 μL of primer combination working solution PT2L, 0.6 μL of dNTPs, 0.6 μL of Super-Fidelity DNA Polymerase, 6 μL of 5× Super-Fidelity DNA Polymerase buffer, and 17.8 μL of ddH2O. The mixture was mixed and placed in a PCR instrument. The PCR reaction conditions were as follows: 95°C for 1 min; 18 cycles of 95°C for 10 s, 60°C for 15 s, and 72°C for 15 s; and 72°C for 10 min; 4℃,∞.
[0102] B1': 5'-TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG-3';
[0103] B2: AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC
[0104] B2':TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG
[0105] BL: AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC
[0106] In step 6, take 20-70 ng of the second-round purified product and add 80-100 ng of uncut pYLCRISPR / Cas9-DN plasmid, 1.5 μL of 10× cutsmart buffer, and 0.5 μL of BsaI endonuclease. Bring the volume to 15 μL with ddH2O. Mix thoroughly and incubate in a PCR instrument at 37°C for 10 min to digest the pYLCRISPR / Cas9-DN plasmid. Add 0.4 μL of 10× T4 DNA ligase buffer and 0.1 μL of T4 DNA ligase to the digested reaction. Mix again and incubate in a PCR instrument for 13 cycles: 37°C for 2 min, 10°C for 3 min, and 20°C for 5 min; then incubate at 37°C for 2 min and 4°C for ∞.
[0107] In step 7, 1 μL of the ligation product obtained in step 7 was added to 100 μL of Escherichia coli DH5α competent cells, incubated on ice for 30 min, heat-shocked at 42°C for 45 s, and then ice-bathed for 2-3 min. 700 μL of LB liquid medium was added to the centrifuge tube and cultured in a shaker at 37°C and 200 rpm for 60 min. The cultured bacterial solution was centrifuged at 5000 rpm for 2 min, 600 μL of the supernatant was discarded, and the remaining bacterial solution was evenly spread on LB solid medium containing kanamycin (500 μL of 10 mg / mL kanamycin was added to every 100 mL of LB solid medium) and incubated inverted at 37°C for 16 h. Monoclonal colonies were picked and mixed by pipetting in 10 μL of sterile water. 2 μL of the bacterial solution was taken for colony identification. The colony PCR system was 25 μL: 2 μL of bacterial solution, 1 μL each of the primer pair SP-DL / SP-R on the 10 μM binary vector, and 2× Rapid Taq Master Mix. 12.5 μL of the solution and 8.5 μL of ddH₂O were mixed and placed in a PCR instrument. PCR conditions were as follows: initial denaturation at 95°C for 3 minutes; 32 cycles of denaturation at 95°C for 15 seconds, annealing at 55°C for 1 minute, and extension at 72°C for 45 seconds; a complete extension at 72°C for 5 minutes; and 4°C ∞. After the reaction, the PCR product band size was checked on an agarose gel to ensure that it met the theoretical value. The remaining bacterial suspension with the correct band size was transferred to 4 mL of LB liquid medium containing kanamycin and incubated in a shaker at 37°C / 200 rpm for 16 hours. The plasmid was extracted using a plasmid miniprep kit and verified by running on an agarose gel. The extracted plasmid was then sent to Sangon for further sequencing and verification.
[0108] In step 8, take 100 μL of Agrobacterium competent cells EHA105, melt them in an ice bath, add 1 μL of correctly sequenced Cas9 plasmid, gently stir the bottom of the centrifuge tube by hand, mix well, and let it stand on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min; add 700 μL of antibiotic-free LB liquid medium and culture at 28°C with shaking for 2-3 h; centrifuge at 6000 rpm for 1 min to harvest the bacteria, retain about 100 μL of supernatant, mix well by pipetting, resuspend the bacteria, spread on LB-Kana / Rif solid medium, and invert and culture in a 28°C incubator for 2-3 days.
[0109] In step 9, pick a single colony of Agrobacterium containing the Cas9 vector constructed in step 9 and place it in 3 mL of LB liquid medium containing Kana and Rif, culture it at 200 rpm and 28°C for 12-16 h, then take 300 μL and place it in 20 mL of LB liquid medium containing Kana and Rif, shake culture it at 200 rpm and 28°C for 6-7 h, and measure the OD value of the bacterial solution using a spectrophotometer. 600 to 0.5-0.6. Centrifuge at 5000 rpm for 10 min at room temperature to collect the bacteria, and dilute the bacteria with sterile water to OD 600 =0.1-0.2, ready for use. Pre-culture the tomato cotyledons and stem segments in the dark for 2 days, then soak them in the diluted Agrobacterium infection solution, shake them, and pour out the infection solution after 5 minutes of infection. Use a pipette to suck off the excess infection solution. The cotyledons and stem segments are then germinated, elongated, and rooted on a culture medium containing different plant hormones. The rooted explants are transferred to nutrient soil for subsequent sequencing and identification, thereby obtaining transformed tomato plants. Subsequently, by designing upstream and downstream primers for the target site, the transgenic tomato plant DNA is extracted, PCR amplified, and sequenced for identification and analysis. SlCAS Whether gene editing occurs.
[0110] In step 10, the PCR amplification system is 50 μL: 2 μL tomato cDNA, 2 μL each of upstream primer-F and downstream primer-R, 10 μL 5× high-fidelity DNA polymerase buffer, 1 μL high-fidelity DNA polymerase, 1 μL deoxyribonucleoside triphosphate dNTP mixture, and double-distilled water to 50 μL.
[0111] In step 10, the total reaction volume for the first round of PCR was 50 μL, containing 4 μL of template (cDNA reverse-transcribed from tomato RNA extraction), 1 μL of forward primer F1, 1 μL of reverse primer R1, 4 μL of dNTPs, 5 μL of PCRsit, 1 μL of pfu enzyme, 10 μL of 5× pfu buffer, and 24 μL of sterile ddH2O. The second round of PCR was identical to the first round, except that the first-round PCR product was used as the template and the primer pairs were swapped with F2 and R2. PCR amplification parameters were: 95°C initial denaturation for 5 min, 95°C denaturation for 20 s, 55°C annealing for 20 s, 72°C extension for 1 min 25 s, 38 cycles, 72°C extension for 5 min, and storage at 4°C. The second-round product was purified using a standard DNA purification kit.
[0112] In step 11, the total digestion volume is 50 μL, containing 20 μL of PBI121 vector plasmid / second-round purified product, 2 μL of Xho I, 2 μL of BamHI, 5 μL of Cut Smart buffer, and 21 μL of sterile ddH2O. Digest the PBI121 vector at 37°C for 4 hours, and digest the purified product at 37°C overnight. Purify the digested products using a DNA gel extraction kit.
[0113] In step 12, the target gene fragment and the linearized pBI121 vector were recombined using the ClonExpress II One-Step Cloning Kit. The recombination conditions were as follows: ligation at 37°C for 30 min, followed by storage on ice. The PCR amplification product obtained in step 1 was added to 100 µL of Escherichia coli DH5α competent cells, incubated on ice for 30 min, heat-shocked at 42°C for 45 s, and then ice-bathed for 2-3 min. 700 µL of LB liquid medium was added to a centrifuge tube and incubated on a shaker at 37°C at 150 rpm for 45 min. The resulting bacterial solution was centrifuged at 4000 rpm for 2 min, 200 µL of the supernatant was discarded, and the remaining bacterial solution was evenly spread on solid medium containing kanamycin (500 μL of 10 mg / ml kanamycin per 100 ml of solid LB) and incubated inverted at 37°C for 16 h. Single colonies were picked, pipetted and mixed in 10 µL of sterile water, and 2 µL of the bacterial solution was collected for colony identification. Six positive clones were picked for sequencing.
[0114] In step 12, when performing colony identification, the colony PCR system is 25 µL: 2 µL bacterial solution, 1 µL forward primer F2, 1 µL reverse primer R2, 12.5 µL 2× Taq polymerase mixture, 8.5 µL double-distilled water, and mixed on ice; PCR parameters are: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s; annealing at 55°C for 15 s, extension at 72°C for 2 min 15 s, 35 cycles; extension at 72°C for 5 min; storage at 4°C. After the reaction is completed, the product is subjected to agarose gel electrophoresis to check whether the band size is consistent with the result. The single clone with the correct band position is expanded and cultured, that is, 5 ml of LB liquid medium is added to the bacterial solution, and 25 µL of 10 mg / mL kanamycin is added and mixed. The culture is shaken at 37°C at 200 rpm for 12-16 h, and then the plasmid is extracted from the bacterial solution and stored at -20°C. Primers were designed at both ends of the CAS1 gene fragment on the PBI121 vector for sequencing.
[0115] In step 13, insert the test tube containing the ice-water mixed EHA105 Agrobacterium competent cells into ice, then add 1 μL of CAS1-pBI121 plasmid, stir the bottom of the tube to mix, and let it stand on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes; then inoculate it into 700 ml of liquid LB medium and culture it in a shaker at 37°C and 150 rpm for 2-3 hours; centrifuge it at 5000 rpm for 1 minute, and take about 100 μL of the supernatant, gently pipette the resuspended bacteria, and spread it on an LB plate containing kanamycin and rifampicin (add 500 μL of 10 mg / ml kanamycin and 500 μL of 10 mg / ml rifampicin per 100 ml of solid LB). Rifampicin was added to the plate and inverted in a 28°C incubator for 2–3 days. Once colonies grew, several single colonies were randomly picked with a pipette tip and dissolved in 10 μL of sterile water to prepare a bacterial suspension. 2 μL of the suspension was used for colony identification. To the bacterial suspension with the correct band position, 5 mL of LB liquid medium, 10 μL of 10 mg / mL rifampicin, and 25 μL of 10 mg / mL kanamycin were added. The suspension was shaken at 37°C, 200 rpm, and cultured overnight to obtain EHA105 Agrobacterium containing the CAS1-pBI121 plasmid.
[0116] In step 14, the tomato seeds are cleaned and disinfected with sodium hypochlorite and alcohol, and then sown on the rooting medium T0. After 5-7 days of dark culture, they are waited for germination and then cultured under light. When the buds grow into two cotyledons, the leaves can be cut. The tomato cotyledons can be cut into small squares, one cotyledon can be cut into two halves, and the stems can be cut into small sections. The leaves and stems are placed on the pre-culture medium T1. The explants after 2 days of pre-culture are immersed in the EHA105 Agrobacterium infection solution containing the CAS1-pBI121 plasmid, shaken, and after 5 minutes of infection, the infection solution is poured out and the excess infection solution is sucked off with a gun tip. The explants are placed back on the pre-culture medium T1 and cultured in the dark for 2 days, and then transferred to the bud induction medium T 21 After culturing with the back side facing down at 25°C and 16h light intensity for 7 days, the cells were transferred to a new bud induction medium T. 21 Subculture; replace new bud induction medium T every 2 weeks thereafter 21 Subculture, when the explants sprout 2-3cm, transfer to bud elongation medium T 22 Culture for 3-4 weeks, and replace the new bud elongation medium every two weeks. 22 When the buds elongate to 4-5 cm, cut off the callus tissue at the root and transfer them to rooting medium T3 for 3-4 weeks to obtain rooted seedlings. The rooted seedlings are transferred to soil pots and allowed to grow for 3-7 days. After the growth, the tomato seedlings are transferred to a soil culture room and grown normally under 16 hours of light to obtain transgenic positive seedlings.
[0117] In step 14, prepare the infection solution: pick a single colony of EHA105 Agrobacterium containing the CAS1-pBI121 plasmid and place it in 3 mL of LB liquid medium (containing 15 μl of 10 mg / ml kanamycin and 15 μl of 10 mg / ml rifampicin), incubate at 200 rpm at 28°C overnight; the next day, take 300 μL of the bacterial solution and place it in 20 mL of LB liquid medium (containing 100 μl of 10 mg / ml kanamycin and 100 μl of 10 mg / ml rifampicin), shake and culture at 200 rpm at 28°C for 6-7 hours; measure the OD value using a spectrophotometer. 600 to 0.5-0.6; centrifuge at 5000 rpm for 10 min at room temperature to collect the bacteria, and dilute the bacteria with sterile water to OD 600 =0.1-0.2, and the EHA105 Agrobacterium infection solution containing the CAS1-pBI121 plasmid was obtained.
[0118] Example 2: A gene S1CAS1 that promotes tomato fruit ripening and its regulation method
[0119] 1. Virus-induced gene silencing technology silences the expression of SlCAS1 to inhibit tomato fruit ripening.
[0120] The constructed TRV-CAS1 recombinant vector was transformed into wild-type (WT) tomato fruit via Agrobacterium. CAS1 expression in the fruit was significantly suppressed compared to the control, indicating that TRV technology successfully silenced SlCAS1 expression in the fruit. Simultaneously, recording of fruit ripening time showed that when SlCAS1 was silenced, the ripening process of tomato fruit was significantly inhibited, with ripening delayed by approximately 10 days ( Figure 1 In addition, the changes in pigment content in the two groups of fruits also showed that silencing SlCAS1 would lead to a slower fruit ripening phenotype ( Figure 2 The total chlorophyll content in the SlCAS1-silenced fruits was significantly lower than that in the control fruits on the 10th and 20th days after infection (P<0.01). The β-carotene and lycopene contents in the tomato fruits were also significantly lower than those in the control fruits on the 10th and 20th days after TRV-CAS1 infection ( P <0.01). The above results indicate that silencing SlCAS1 expression leads to a slowdown in the synthesis / degradation rate of key pigment substances involved in color transformation during fruit ripening, providing direct evidence that silencing SlCAS1 expression leads to a slowdown in fruit ripening.
[0121] 2. Construction of Crispr-Cas9 gene-edited plants of SlCAS1.
[0122] Sequencing results showed that the dual-target and gRNA expression cassette of SlCAS1 was successfully constructed through experimental steps such as target linker preparation, two-round PCR amplification, vector ligation, and plasmid transformation ( Figure 3 The sequencing results of the positive tomato plants obtained through sterile tissue culture experiments showed that there was an insertion of the base "T" in the sequence "TTTCATCAATGGCGTCGTTGTGTGAGGAGAAGATTT" ( Figure 3 ), which shows that the SlCAS1 gene-edited plants ( cas1 ) Build successful.
[0123] 3. Construction of SlCAS1 high-expression plants.
[0124] The high-expression vector SlCAS1-pBI121 was successfully constructed through two rounds of PCR amplification, in vitro recombination of the linearized vector and the target fragment, and plasmid transformation. A highly SlCAS1-expressing tomato strain (SlCAS1-OE) was successfully screened through Agrobacterium-mediated transformation and sterile tissue culture. Total RNA was extracted and converted to cDNA. Fluorescence quantitative PCR revealed that the expression levels of SlCAS1 in positive strains 1 and 2 were significantly higher than those in wild-type tomato plants ( Figure 7The results showed that the SlCAS1 high-expression plant was successfully constructed.
[0125] 4. Overexpression of SlCAS1 promotes the ripening of tomato fruits, while the absence of SlCAS1 delays the ripening process of tomato fruits.
[0126] By Record Slcas1 The ripening time of fruits of gene-edited plants, overexpressed SlCAS1-OE plants, and wild-type tomato fruits. The results showed that overexpression of SlCAS1 advanced the ripening period of tomato fruits by 10 days, while the ripening time of tomato fruits lacking SlCAS1 was extended by more than 10 days ( Figure 8 By measuring the content of key pigments that change color during fruit ripening, it was shown that the chlorophyll content in SlCAS1-OE tomato fruits was always lower than that in the wild type ( P <0.05), and cas1 The chlorophyll content in the P <0.05). The β-carotene content of SlCAS1-OE was higher than that of wild-type tomato fruits at 30-40 days after anthesis, but lower than that of wild-type fruits at 50 days after anthesis. This may be due to the color change process during tomato ripening. cas1 The β-carotene content in the fruit was consistently lower than that in wild-type tomato fruit ( P <0.05). The lycopene content in SlCAS1-OE tomato fruits was consistently higher than that in wild-type tomato fruits at 40-50 days after anthesis ( P <0.05). However, the lycopene content in cas1 fruits was always lower than that in wild-type tomato fruits ( P <0.05). The above results indicate that SlCAS1 is a gene that positively regulates fruit ripening.
[0127] To reveal the molecular mechanism by which SlCAS1 affects fruit ripening, we investigated SlCAS1-OE, cas1 The expression levels of key ripening genes in the fruits of WT and WT were analyzed ( Figure 10 ). The results showed that during the ripening process of tomato fruits, the expression levels of genes PSY, PDS, and ZDS related to carotenoid synthesis in fruits with high SlCAS1 expression were always higher than those in the wild type. On the contrary, the expression levels of genes PSY, PDS, and ZDS related to carotenoid synthesis in fruits with SlCAS1 deletion were always lower than those in the wild type. The expression levels of genes NYC1, PAO, PPH, and SGR1 related to chlorophyll degradation in SlCAS1-OE fruits were always higher than those in the wild type, while cas1 The expression levels of NYC1, PAO, PPH, and SGR1 genes related to chlorophyll degradation in the fruit were always lower than those in the wild type. SlCAS1 It is a key gene that promotes the ripening of tomato fruits.
[0128] The above description is only used to explain the preferred embodiments of the present invention and is not intended to limit the present invention in any form. Therefore, any modifications or changes made to the present invention under the same inventive spirit should still be included in the scope of protection intended by the present invention.
Claims
1. A method for promoting tomato fruit ripening, characterized by: The following steps are involved: Step 1: Using tomato cDNA as a template, a first-round PCR amplification was performed using the first-round forward primer-F1 and the first-round reverse primer-R1 as the primer pair to obtain a first-round PCR amplification product. A second-round PCR amplification was then performed using the first-round PCR amplification product as a template and the second-round forward primer-F2 and the second-round reverse primer-R2 as the primer pair. The second-round PCR amplification product was purified and recovered using a conventional DNA purification kit to obtain the target gene fragment. The primer sequences are as follows: First-round forward primer-F1: 5′-AGAGATAGACATTTACAGGCTTCA-3′; First-round reverse primer-R1: 5′-TTGAACACTAATCAACTGATACAGG-3′; Second-round forward primer-F2: 5′-CGCGGATCCATAAATTTCATCAATGGCGTCGTTG-3′; Second-round reverse primer-R2: 5′-CCGCTCGAGATCAACTGATACAGGTTGCATGTTT-3′; Step 2: Double-digest the vector pBI121 and the target gene fragment with restriction endonucleases BamHI and XhoI, respectively. Purify the digestion products to obtain the linearized pBI121 vector and the digested target gene fragment. Step 3: After enzyme digestion, the target gene fragment and the linearized pBI121 vector are recombined to obtain the CAS1-pBI121 plasmid; Step 4: Transform the CAS1-pBI121 plasmid into EHA105 Agrobacterium competent cells; Step 5: Agrobacterium EHA105 containing the CAS1-pBI121 plasmid was used to infect tomato cotyledons and obtain transgenic positive seedlings SlCAS1-OE.