Construction method of recombined bacteria for efficiently converting glucose to produce tetrahydropyrimidine and application thereof

Abstract

The application discloses a construction method and application of recombinant bacteria for efficiently converting glucose to produce tetrahydropyrimidine, and the recombinant bacteria are constructed according to a biosynthesis pathway of tetrahydropyrimidine and a carbon metabolic flow distribution of balanced phosphoenolpyruvic acid to oxaloacetic acid and pyruvic acid, and the recombinant bacteria strain directly produces tetrahydropyrimidine by fermentation with glucose as a substrate; 36-53 g / L of tetrahydropyrimidine can be accumulated in a 56-hour fermentation liquor, the yield per cell reaches 1.21-1.91 g / g DCW, and the glucose molar conversion rate reaches 0.31-0.38 mol / mol, and the yield, the yield and the conversion rate are all higher than those of an existing process; compared with an existing fermentation method and a whole-cell catalysis method for producing tetrahydropyrimidine salt, the recombinant bacteria provided by the application have the advantages of low raw material cost, simple culture condition, small equipment loss, short fermentation period, simple operation, no need to collect bacterial bodies to extract enzyme liquor and high tetrahydropyrimidine production efficiency.

Description

TECHNICAL FIELD

[0001] The application relates to a method for constructing a recombinant bacterium for efficiently converting glucose to produce tetrahydropyrimidine and application thereof, and belongs to the technical field of genetic engineering. BACKGROUND

[0002] Tetrahydropyrimidine is a heterocyclic amino acid, which is a polar, easily soluble and neutral solute in physiological pH range, can stabilize the cell swelling pressure but does not affect the normal physiological function of the cell. Since tetrahydropyrimidine can easily form a hydration layer on the surface of protein, can alleviate the toxic effects of high osmotic pressure, high temperature, freeze-thaw, drying, radiation and chemical reagents on the DNA double helix structure and protein, biological membrane and the whole cell, can stabilize the cell swelling pressure but does not affect the normal physiological function of the cell, is the energy substance of microbial cells, the osmotic pressure regulating substance and the biological protective agent of cells and macromolecular substances, and therefore is widely applied in the fields of cosmetics, biotechnology and pharmaceutical industry.

[0003] The production methods of tetrahydropyrimidine are microbial fermentation and cell conversion. At present, the fermentation method mainly uses glucose as the substrate, utilizes halophilic microorganisms and adopts the "bacterial milking" process to produce, realizes intracellular accumulation and secretion of tetrahydropyrimidine through high-salt induction synthesis and low-salt stimulation to promote release and multiple circulation impact of osmotic pressure. Although the "bacterial milking method" can obtain high yield, the complex process flow has high requirements for the production equipment, the high-salt medium not only corrodes the equipment but also increases the difficulty of downstream purification, resulting in high production cost. The cell conversion method utilizes recombinant microorganisms or resting cells to catalyze synthesis by taking L-aspartate and glycerol as the substrates. However, although the method taking L-aspartate as the substrate avoids some disadvantages of the "bacterial milking method", the cell conversion method has low yield and high production cost due to the need of a large amount of glutamic acid and acetyl coenzyme A as cofactors in the biosynthesis process of tetrahydropyrimidine. The utilization of Escherichia coli or Corynebacterium glutamicum to ferment glucose to synthesize tetrahydropyrimidine under low-salt conditions has long metabolic pathways, uneven carbon metabolic flow distribution, poor carbon atom economy and low yield, which seriously restricts the industrialized production and large-scale application of recombinant bacteria for fermenting glucose to produce tetrahydropyrimidine. Therefore, constructing a new type of tetrahydropyrimidine high-yield strain, balancing the carbon flow distribution of glucose, improving the carbon atom economy and reducing the production cost have important practical significance for the application of tetrahydropyrimidine, and are also an important research direction for producing tetrahydropyrimidine.

[0004] A Chinese patent with the patent number ZL201510410080.2 discloses a genetically engineered bacterium for producing tetrahydropyrimidine and a construction method and application thereof, and specifically discloses that lysA, thrA and iclR three gene defects of Escherichia coli are used to express ectABC gene cluster derived from Halomonas elongate, and lac promoter is used to strengthen the expression of lysC gene of Corynebacterium glutamicum, and trc promoter is used to enhance the expression of ppc gene, but the yield of tetrahydropyrimidine of the recombinant bacterium is 12-18 g / L after fermentation for 20-28 h; a Chinese patent with the publication number CN109182236A discloses a recombinant Escherichia coli and application of the recombinant Escherichia coli in synthesizing tetrahydropyrimidine, and specifically discloses that the recombinant Escherichia coli is obtained by knocking out diaminopimelic acid decarboxylase lysA gene of Escherichia coli E. coli MG1655 and introducing tetrahydropyrimidine synthesis gene cluster ectABC with the nucleotide sequence shown in SEQ ID NO. 1, and the recombinant Escherichia coli is applied in converting and synthesizing tetrahydropyrimidine, and tetrahydropyrimidine is prepared by biological conversion with L-aspartic acid sodium as a substrate, but the highest conversion rate of the recombinant Escherichia coli constructed by gene recombination using the patent in synthesizing tetrahydropyrimidine is only 35%. SUMMARY

[0005] The present application aims to provide a construction method of a recombinant bacterium for efficiently converting glucose to produce tetrahydropyrimidine, and apply the method in the production of tetrahydropyrimidine, so as to realize high yield, high conversion rate, low cost and simple production process of tetrahydropyrimidine, and lay a foundation for subsequent industrial production of tetrahydropyrimidine.

[0006] The technical solution of the present application is as follows:

[0007] One of the purposes of the present application is to provide a construction method of a recombinant bacterium for efficiently converting glucose to produce tetrahydropyrimidine, and introduce the coding genes of diaminobutyric acid aminotransferase, diaminobutyric acid acetyltransferase and tetrahydropyrimidine synthase into a recipient bacterium by a recombinant vector to obtain a recombinant bacterium with high yield of tetrahydropyrimidine; the recipient bacterium is a mutant Escherichia coli or a wild-type Escherichia coli;

[0008] The diaminobutyric acid aminotransferase (EctB) gene coding amino acid sequence is a protein of SEQ ID No. 1 or a derived protein with diaminobutyric acid aminotransferase activity obtained by substituting, deleting and / or adding one or several amino acid residues in the amino acid sequence shown in SEQ ID No. 1;

[0009] The diaminobutyric acid acetyltransferase (EctA) gene coding amino acid sequence is a protein of SEQ ID No. 2 or a derived protein with diaminobutyric acid acetyltransferase activity obtained by substituting, deleting and / or adding one or several amino acid residues in the amino acid sequence shown in SEQ ID No. 2;

[0010] the tetrahydropyrimidine synthetase (EctC) gene encodes a protein of the amino acid sequence of SEQ ID No. 3 or a derived protein having tetrahydropyrimidine synthetase activity obtained by substitution and / or deletion and / or addition of one or several amino acid residues in the amino acid sequence shown in SEQ ID No. 3;

[0011] Further, the mutant Escherichia coli is a mutant of the wild-type Escherichia coli obtained by genetic modification of either of the following d1 and d2 on the wild-type Escherichia coli:

[0012] d1, knocking out the pyruvate kinase I gene pykF, which modification is denoted as "ΔpykF";

[0013] d2, knocking out the pyruvate kinase II gene pykA, which modification is denoted as "ΔpykA".

[0014] Further, the pyruvate kinase I gene encodes a protein of the amino acid sequence shown in SEQ ID No. 4; and the pyruvate kinase II gene encodes a protein of the amino acid sequence shown in SEQ ID No. 5;

[0015] wherein the pyruvate kinase I gene is any one of the DNA molecules of d11-d13:

[0016] d11, the coding sequence of which is a cDNA molecule or a genomic DNA of SEQ ID No. 10;

[0017] d12, a cDNA molecule or a genomic DNA hybridizing to the DNA molecule defined in d11 under stringent conditions and encoding the pyruvate kinase I;

[0018] d13, a cDNA molecule or a genomic DNA having 90% or more identity to the DNA molecule defined in d11 or d12 and encoding the pyruvate kinase I;

[0019] the pyruvate kinase II gene is any one of the DNA molecules of d21-d23:

[0020] d21, the coding sequence of which is a cDNA molecule or a genomic DNA of SEQ ID No. 14;

[0021] d22, a cDNA molecule or a genomic DNA hybridizing to the DNA molecule defined in d21 under stringent conditions and encoding the pyruvate kinase II;

[0022] d23, a cDNA molecule or genomic DNA having 90% or more identity with the DNA molecule defined in d21 or d22 and encoding said pyruvate kinase II;

[0023] Further, the mutant E. coli is also a mutant of the wild-type E. coli obtained by modifying any one of d3, d4 and d5 or any two of d3, d4 and d5 collectively to the wild-type E. coli:

[0024] d3, truncating the L-aspartate kinase / homoserine dehydrogenase bifunctional enzyme I gene thrA to obtain a mutant I gene (thrA*) retaining L-aspartate kinase activity, which modification is denoted as "ΔthrA*";

[0025] d4, replacing the diaminopimelate decarboxylase gene lysA with the glutamate dehydrogenase gene gdhA, which modification is denoted as "ΔlysA::gdhA";

[0026] d5, truncating the L-aspartate kinase / homoserine dehydrogenase bifunctional enzyme II gene metL to obtain a mutant II gene (metL * ) retaining L-aspartate kinase activity, which modification is denoted as "ΔmetL * ".

[0027] Further, the mutant I gene retaining L-aspartate kinase activity encodes a protein represented by the amino acid sequence of SEQ ID No. 6;

[0028] The mutant II gene retaining L-aspartate kinase activity encodes a protein represented by the amino acid sequence of SEQ ID No. 7;

[0029] The diaminopimelate decarboxylase gene encodes a protein represented by the amino acid sequence of SEQ ID No. 8;

[0030] The glutamate dehydrogenase gene encodes a protein represented by the amino acid sequence of SEQ ID No. 9;

[0031] The L-aspartate kinase mutant I gene is any one of d31-d33:

[0032] d31, a cDNA molecule or genomic DNA whose coding sequence is SEQ ID No. 11;

[0033] d32, a cDNA molecule or genomic DNA hybridizing to the DNA molecule defined in d31 under stringent conditions and encoding said aspartate kinase mutant I;

[0034] d33, a cDNA molecule or genomic DNA having 90% or more identity to the DNA molecule defined in d31 or d32 and encoding the aspartate kinase mutant I;

[0035] the diaminopimelate decarboxylase gene is any one of d41-d43:

[0036] d41, a cDNA molecule or genomic DNA whose coding sequence is SEQ ID No. 12;

[0037] d42, a cDNA molecule or genomic DNA hybridizing under stringent conditions to the DNA molecule defined in d41 and encoding the diaminopimelate decarboxylase;

[0038] d44, a cDNA molecule or genomic DNA having 90% or more identity to the DNA molecule defined in d41 or d42 and encoding the diaminopimelate decarboxylase;

[0039] the glutamate dehydrogenase gene is any one of d51-d53:

[0040] d51, a cDNA molecule or genomic DNA whose coding sequence is SEQ ID No. 13;

[0041] d52, a cDNA molecule or genomic DNA hybridizing under stringent conditions to the DNA molecule defined in d51 and encoding the glutamate dehydrogenase;

[0042] d53, a cDNA molecule or genomic DNA having 90% or more identity to the DNA molecule defined in d51 or d52 and encoding the glutamate dehydrogenase;

[0043] the aspartate kinase mutant II gene is any one of d61-d63:

[0044] d61, a cDNA molecule or genomic DNA whose coding sequence is SEQ ID No. 15;

[0045] d62, a cDNA molecule or genomic DNA hybridizing under stringent conditions to the DNA molecule defined in d61 and encoding the aspartate kinase mutant II;

[0046] d63, a cDNA molecule or genomic DNA having 90% or more identity to the DNA molecule defined in d61 or d62 and encoding the aspartate kinase mutant II;

[0047] The stringent conditions are hybridization in a solution of 2xSSC, 0.1% SDS at 68°C and washing the membrane twice for 5 min each time, and then hybridization in a solution of 0.5xSSC, 0.1% SDS at 68°C and washing the membrane twice for 15 min each time; the more than 90% identity can be at least 91%, 92%, 95%, 96%, 98%, 99% or 100% identity;

[0048] The mutant E. coli obtained after the above modification is as follows:

[0049] The mutant E. coli D1 is a wild-type E. coli mutant obtained by d1, d3 and d4 modification of the wild-type E. coli, in which the pyruvate kinase I gene (pykF gene) of E. coli is knocked out, the L-aspartate kinase / high homoserine dehydrogenase bifunctional enzyme I gene (thrA gene) is truncated to obtain a mutant I gene (thrA * gene) retaining L-aspartate kinase activity, and the diaminopimelate decarboxylase gene (lysA gene) is replaced by the glutamate dehydrogenase gene (gdhA gene), which is denoted as “ΔpykFΔthrA * ΔlysA::gdhA”;

[0050] The mutant E. coli D2 is a wild-type E. coli mutant obtained by d2, d5 and d4 modification of the wild-type E. coli, in which the pyruvate kinase II gene (pykA gene) of E. coli is knocked out, the L-aspartate kinase / high homoserine dehydrogenase bifunctional enzyme II gene (metL gene) is truncated to obtain a mutant II gene (metL * gene) retaining L-aspartate kinase activity, and the diaminopimelate decarboxylase gene (lysA gene) is replaced by the glutamate dehydrogenase gene (gdhA gene), which is denoted as “ΔpykAΔmetL * ΔlysA::gdhA”;

[0051] The mutant E. coli D3 is a wild-type E. coli mutant obtained by d2, d3 and d4 modification of the wild-type E. coli, in which the pyruvate kinase II gene (pykA gene) of E. coli is knocked out, the L-aspartate kinase / high homoserine dehydrogenase bifunctional enzyme I gene (thrA gene) is truncated to obtain a mutant I gene (thrA * gene) retaining L-aspartate kinase activity, and the diaminopimelate decarboxylase gene (lysA gene) is replaced by the glutamate dehydrogenase gene (gdhA gene), which is denoted as “ΔpykAΔthrA * ΔlysA::gdhA”;

[0052] The mutant *E. coli* D4 is a wild-type *E. coli* mutant obtained by modifying the wild-type *E. coli* at d1, d5, and d4. The pyruvate kinase I gene (pykF gene) of *E. coli* is knocked out, and the L-aspartate kinase / homoserine dehydrogenase bifunctional enzyme II gene (metL gene) is truncated to obtain a mutant II gene (metL gene) that retains L-aspartate kinase activity. * The gene was modified by replacing the diaminopimelic acid decarboxylase gene (lysA gene) with the glutamate dehydrogenase gene (gdhA gene). This modification is described as "ΔpykFΔmetL". * ΔlysA::gdhA” means;

[0053] The mutant *E. coli* D5 is a wild-type *E. coli* mutant obtained by modifying the wild-type *E. coli* using methods d1 and d3. The pyruvate kinase I gene (pykF gene) of *E. coli* is knocked out, and the L-aspartate kinase / homoserine dehydrogenase bifunctional enzyme I gene (thrA gene) is truncated to obtain a mutant I gene (thrA) that retains L-aspartate kinase activity. * (Gene), the modification is named "ΔpykFΔthrA" * This means that, specifically, the L-aspartate kinase / homoserine dehydrogenase bifunctional enzyme I gene (thrA gene) in mutant E. coli D11 can be truncated to obtain mutant I gene (thrA* gene) that retains L-aspartate kinase activity, thus obtaining mutant E. coli D5.

[0054] The mutant *E. coli* D6 is a wild-type *E. coli* mutant obtained by modifying the wild-type *E. coli* using methods d2 and d3. The pyruvate kinase II gene (pykA gene) of *E. coli* is knocked out, and the L-aspartate kinase / homoserine dehydrogenase bifunctional enzyme I gene (thrA gene) is truncated to obtain a mutant I gene (thrA) that retains L-aspartate kinase activity. * The gene was modified to be "ΔpykAΔthrA". * "This means that, specifically, the L-aspartate kinase / homoserine dehydrogenase bifunctional enzyme I gene (thrA gene) in mutant Escherichia coli D12 can be truncated to obtain mutant I gene (thrA* gene) that retains L-aspartate kinase activity, thus obtaining mutant Escherichia coli D6.

[0055] The mutant E. coli D7 is a wild-type E. coli mutant obtained by d1 and d5 modification of the wild-type E. coli, in which the pykF gene of E. coli is knocked out, the metL gene of E. coli is truncated to obtain a mutant II gene (metL * gene) retaining L-aspartate kinase activity, and the modification is denoted as "ΔpykFΔmetL * ". Specifically, the mutant E. coli D7 can be obtained by truncating the metL gene of the mutant E. coli D11 to obtain a mutant II gene (metL * gene) retaining L-aspartate kinase activity.

[0056] The mutant E. coli D8 is a wild-type E. coli mutant obtained by d2 and d5 modification of the wild-type E. coli, in which the pykA gene of E. coli is knocked out, and the metL gene of E. coli is truncated to obtain a mutant II gene (metL * gene) retaining L-aspartate kinase activity, and the modification is denoted as "ΔpykAΔmetL * ". Specifically, the mutant E. coli D8 can be obtained by truncating the metL gene of the mutant E. coli D12 to obtain a mutant II gene (metL * gene) retaining L-aspartate kinase activity.

[0057] The mutant E. coli D9 is a wild-type E. coli mutant obtained by d1 and d4 modification of the wild-type E. coli, in which the pykF gene of E. coli is knocked out, and the lysA gene is replaced by the gdhA gene, and the modification is denoted as "ΔpykFΔlysA::gdhA * ". Specifically, the mutant E. coli D9 can be obtained by replacing the lysA gene of the mutant E. coli D11 with the gdhA gene.

[0058] The mutant E. coli D10 is a wild-type E. coli mutant obtained by d2 and d4 modification of the wild-type E. coli, in which the pykA gene of E. coli is knocked out and the lysA gene is replaced by the gdhA gene, and the modification is denoted as "ΔpykA ΔlysA::gdhA". * Specifically, the mutant E. coli D10 is obtained by replacing the lysA gene in the mutant E. coli D12 with the gdhA gene.

[0059] The mutant E. coli D11 is a wild-type E. coli mutant obtained by d1 modification of the wild-type E. coli, in which the pykF gene of E. coli is knocked out, and the modification is denoted as "ΔpykF".

[0060] The mutant E. coli D12 is a wild-type E. coli mutant obtained by d1 modification of the wild-type E. coli, in which the pykA gene of E. coli is knocked out, and the modification is denoted as "ΔpykA".

[0061] The gene knockout, gene replacement and gene truncation can be achieved by homologous recombination.

[0062] Further, the recombinant vector contains the coding genes of diaminobutyric acid aminotransferase, diaminobutyric acid acetyltransferase and tetrahydropyrimidine synthetase; the promoter for the transcription of the coding genes of diaminobutyric acid aminotransferase, diaminobutyric acid acetyltransferase and tetrahydropyrimidine synthetase in the recombinant vector is the ara promoter, and the terminator for the transcription of the genes of diaminobutyric acid aminotransferase, diaminobutyric acid acetyltransferase and tetrahydropyrimidine synthetase is the rrnB terminator.

[0063] Further, the recombinant vector is obtained by recombination of the DNA molecule with the nucleotide sequence of SEQ ID No. 16 replacing the fragment between the XhoI and BglII recognition sites of the vector pBADhisB, the DNA molecule with the nucleotide sequence of SEQ ID No. 17 replacing the fragment between the PstI and KpnI recognition sites of the vector pBADhisB, and the DNA molecule with the nucleotide sequence of SEQ ID No. 18 replacing the fragment between the EcoRI and Hind III recognition sites of the vector pBADhisB.

[0064] One of the purposes of the present application is also to provide a construction method of a recombinant bacterium for efficiently converting glucose to produce tetrahydropyrimidine.

[0065] One of the purposes of the present application is also to provide the application of the recombinant bacteria constructed by the construction method above in the direct fermentation production of tetrahydropyrimidine with glucose as substrate.

[0066] Compared with the prior art, the present application has the following beneficial effects:

[0067] 1. The present application constructs a new type of recombinant bacteria capable of directly fermenting glucose as substrate to produce tetrahydropyrimidine according to the biosynthetic pathway of tetrahydropyrimidine, which balances the carbon metabolic flow. Under conventional fermentation conditions, 36-53 g / L of tetrahydropyrimidine can be accumulated in the fermentation broth in 56 hours, the yield per cell reaches 1.21-1.91 g / gDCW, and the glucose molar conversion rate reaches 0.31-0.38 mol / mol, which are higher than the existing process in terms of yield, yield and conversion rate.

[0068] 2. In the present application, the recombinant bacteria constructed are used for direct fermentation to produce tetrahydropyrimidine with glucose as substrate. Compared with the existing fermentation method and whole-cell catalysis method for producing tetrahydropyrimidine salt, the raw material cost is lower, the culture conditions are simple, the equipment wear is small, the fermentation period is short, the operation is simple, the enzyme solution does not need to be collected from the bacteria, and the production efficiency is higher. BRIEF DESCRIPTION OF DRAWINGS

[0069] Figure 1 The figure shows the yield of tetrahydropyrimidine produced by the recombinant bacteria EPK01, EPK02, EPK03, EPK04, EPK05, EPK06, EPK07, EPK08, EPK09, EPK10, EPK11, EPK12, EPK13 and E. coli K12 in the examples of the present application when glucose is transformed;

[0070] Figure 2 The figure shows the synthesis of tetrahydropyrimidine by the recombinant bacteria EPK09 in the 10L fermentation in the examples of the present application. DETAILED DESCRIPTION

[0071] The present application will be further described below in combination with the drawings and preferred embodiments, and the examples given are only for illustrating the present application, but not for limiting the scope of the present application.

[0072] The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified;

[0073] The experimental methods in the following examples are conventional methods unless otherwise specified;

[0074] The wild-type E. coli in the present application is E. coli K12; the E. coli K12 in the following examples (Tomoya Baba, Takeshi Ara, Miki Hasegawa, Yuki Takai, Yoshiko Okumura, Miki Baba, Kirill A Datsenko, Masaru Tomita, Barry L Wanner and Hirotada Mori1. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Molecular Systems Biology. (2006): 1-11) is available to the public from Fujian Normal University, and the biological material is only used for repeating the related experiments of the present application and cannot be used for other purposes;

[0075] The vector pBAD / hisB in the following examples is a product of invitrogen company, and the product catalog number is V430-01;

[0076] The T4 ligase in the following examples is a product of Thermo company, and the product catalog number is EL0011;

[0077] The restriction endonuclease XhoI, BglII, PstI, KpnI, EcoRI, HindIII and DpnI in the following examples are all products of NEB company, and the product catalog numbers are R0146, R0144, R0140, R3142, R3101, R3104 and R0176, respectively;

[0078] The DH5α competent cells in the following examples are products of Takara company, and the product catalog number is D9057A;

[0079] The pCas plasmid in the following examples is purchased from Addgene, and the product number is Plasmid #62225 (Jiang Y, Chen B, Duan C, Sun B, Yang J, Yang S: Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol 2015, 81: 2506-2514);

[0080] The pTargetF plasmid in the following examples was purchased from Addgene, product number Plasmid #62226 (Jiang Y, Chen B, Duan C, Sun B, Yang J, Yang S: Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol 2015, 81: 2506-2514);

[0081] The CRISPR technology applied in the following examples refers to the prior art (Jiang Y, Chen B, Duan C, Sun B, Yang J, Yang S: Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol 2015, 81: 2506-2514);

[0082] Example 1 Construction of recombinant bacteria for efficient conversion of glucose to produce tetrahydropyrimidine

[0083] I. Construction of a recombinant vector expressing the genes encoding diaminobutyric acid aminotransferase (EctB), diaminobutyric acid acetyltransferase (EctA) and tetrahydropyrimidine synthetase (EctC)

[0084] The DNA sequence between the Xho I and Bgl II recognition sites of the pBADhisB vector was replaced with the DNA sequence for encoding diaminobutyric acid aminotransferase shown in SEQ ID No. 16; the DNA sequence between the Pst I and Kpn I recognition sites was replaced with the DNA sequence for encoding diaminobutyric acid acetyltransferase shown in SEQ ID No. 17; the DNA sequence between the Eco R I and Hind III recognition sites was replaced with the DNA sequence for encoding tetrahydropyrimidine synthetase shown in SEQ ID No. 18, and the other DNA sequences remained unchanged, to obtain the recombinant vector PSSE; enzyme digestion identification proved that the EctB, EctA and EctC genes were successfully inserted between the Xho I and Hind III recognition sites of the pBADhisB vector; the recombinant vector PSSE can express the diaminobutyric acid aminotransferase shown in SEQ ID No. 1, the diaminobutyric acid acetyltransferase shown in SEQ ID No. 2, and the tetrahydropyrimidine synthetase shown in SEQ ID No. 3.

[0085] II. Construction of mutant Escherichia coli D11 strain K12ΔpykF and mutant Escherichia coli D12 strain K12ΔpykA weakening acetyl-CoA (AcCOA) synthesis

[0086] (1) Preparation of electrotransformation competent cells: the pCas plasmid was transformed into Escherichia coli K12 using chemical transformation method, and positive clones were screened on LB plates containing kanamycin (kanamycin concentration was 50 μg / mL) at 30°C. Positive clones were inoculated in LB liquid medium containing 2 g / L arabinose and cultured at 30°C until the OD 600 was about 0.6, electrotransformation competent cells were prepared;

[0087] (2) Construction of pTarget plasmid: N20 for knocking out pykF and pykA genes was selected using the website https: / / crispy.secondarymetabolites.org, primers were designed to construct pTarget plasmid, pTargetF was used as a template, and primer pairs pTarget-pykF-F and pTarget-pykA-R, pTarget-pykF-F’ and pTarget-pykA-R’ were used for PCR amplification to obtain a fragment with a size of about 2100 bp. After about 3 h of DpnI methylation enzyme digestion, Escherichia coli DH5 competent cells were directly transformed using chemical transformation method, positive clones were screened on LB plates containing streptomycin (streptomycin concentration was 50 μg / mL), and sequencing verification was performed using primer pTarget-cexu-F. After sequencing was correct, it was named pTarget-pykF and pTarget-pykA;

[0088] The primer sequences used are as follows (the sequence of N20 is indicated by underlining):

[0089] pTarget-pykF-F: 5'-GACGGCATCATGGTTGCGCGgttttagagctagaaatagc-3';

[0090] pTarget-pykF-R: 5'-CGCGCAACCATGATGCCGTCactagtattatacctaggac-3';

[0091] pTarget-pykF-F': 5'-TGCGCGTCAGCTAAACCGAGgttttagagctagaaatagc-3'; pTarget-pykA-R': 5'-CTCGGTTTAGCTGACGCGCAactagtattatacctaggac-3';

[0092] (3) Amplification of the targeting fragment: PCR amplification was performed using primer pairs pykF-up-F and pykF-up-R, pykF-down-F and pykF-down-R, or pykA-up-F and pykA-up-R, pykA-down-F and pykA-down-R, respectively, to obtain fragments of about 500 bp in size; PCR amplification was performed using the mixture of the above two fragments as a template, and primer pairs pykF-up-F and pykF-down-R, or pykA-up-F and pykA-down-R, respectively, to obtain pykF or pykA targeting fragments of about 1000 bp in size. The targeting fragments were recovered, and the targeting fragments contained, from upstream to downstream, a 500 bp upstream homology arm, only a 21 bp pykF or pykA mutant gene, and a 500 bp downstream homology arm:

[0093] The primer sequences used are as follows:

[0094] pykF-up-F: 5'-agcacaactttaccgacaactct-3';

[0095] pykF-up-R: 5'-gacgtgaacagatgccatgacagtcttagtctttaagttgagaagga-3';

[0096] pykF-down-F: 5'-taagactgtcatggcatctgttcacgtcctgtaatattg-3';

[0097] pykF-down-R: 5'-catctttagcagcctgaacgt-3';

[0098] pykA-up-F: 5'-tccggtggtgtactccgatg-3';

[0099] pykA-up-R: 5'-tactctaccgttaaaatacgcatgtaatactccgttgactgaaacaac-3';

[0100] pykF-down-F: 5'-gagtattacatgcgtattttaacggtagagtaagtacgttgc-3';

[0101] pykF-down-R: 5'-acggtattaaaccattcatccagtcg-3';

[0102] (4) Electroporation: 200 ng of pTarget-pykF or pTarget-pykA plasmid, 400 ng of pykF or pykA targeting fragment and 100 μL of the electrocompetent cells prepared in step (1) were mixed and placed in a 2 mm electroporation cuvette, and then subjected to 2.5 kV electroporation. After recovery in 1 mL of LB liquid medium at 30°C, the cells were spread on LB plates containing kanamycin and streptomycin (kanamycin concentration: 50 μg / mL, streptomycin concentration: 50 μg / mL), and incubated at 30°C to select positive clones. The positive clones were subjected to PCR amplification using primer pairs pykF-up-F and pykF-down-R, or pykA-up-F and pykF-down-R, and the amplified fragments were sequenced to confirm the presence of the pCas plasmid.

[0103] (5) Elimination of the pTarget plasmid: The mutant E. coli strains K12ΔpykF and K12ΔpykA containing the pCas plasmid, which were confirmed to be correct by sequencing, were inoculated in LB liquid medium and incubated at 37°C overnight to eliminate the pCas plasmid. The overnight culture was streaked on LB solid plates and incubated at 37°C overnight to obtain the mutant E. coli D11 strain K12ΔpykF and the mutant E. coli D12 strain K12ΔpykA.

[0104] III. Construction of the mutant E. coli D9 strain K12ΔpykFΔlysA::gdhA and the mutant E. coli D10 strain K12ΔpykFΔlysA::gdhA having a weakened lysine biosynthetic pathway

[0105] (1) The mutant E. coli D11 strain K12ΔpykF and the mutant E. coli D12 strain K12ΔpykA containing the pCas plasmid, which were obtained in step (5) above, were inoculated in LB liquid medium containing 2 g / L of arabinose and incubated at 30°C until the OD 600 of the culture reached about 0.6, and electrocompetent cells were prepared.

[0106] (2) Construction of pTarget plasmid: The N20 lysA gene knockout was selected using the website https: / / crispy.secondarymetabolites.org, and primers were designed to construct the pTarget plasmid; pTargetF was used as a template, and primer pairs pTarget-lysA-F and pTarget-lysA-R were used for PCR amplification to obtain a fragment of about 2100 bp, which was digested with DpnI methylase for about 3 h, and then directly transformed into E. coli DH5 competent cells using the chemical transformation method, and positive clones were selected on LB plates containing streptomycin (streptomycin concentration was 50 μg / mL), and verified by sequencing with primer pTarget-cexu-F. After sequencing, it was named pTarget-lysA:

[0107] The primer sequences used are as follows (the underlined sequence is that of N20):

[0108] pTarget-lysA-F: 5'- gttttagagctagaaatagc-3'; GTGTGGTGCTATGGTGCGTC pTarget-lysA-R: 5'- actagtattatacctaggac-3';

[0109] GACGCACCATAGCACCACAC pTarget-cexu-F: 5'- ctttcctgcgttatcccctg-3';

[0110] (3) Amplification of the targeting fragment: Primer pairs lysA-up-F and lysA-up-R, gdhA-F and gdhA-R, and lysA-down-F and lysA-down-R were used for PCR amplification to obtain fragments of about 500 bp, 1300 bp, and 500 bp, respectively. The mixture of the three fragments was used as a template, and primer pairs lysA-up-F and lysA-down-R were used for PCR amplification to obtain a lysA::gdhA targeting fragment of about 2300 bp. The targeting fragment was recovered, and the targeting fragment contained a 500 bp upstream homologous arm, a gdhA gene, and a 500 bp downstream homologous arm from upstream to downstream:

[0111] The primer sequences used are as follows:

[0112] lysA-up-F: 5'- tcttcaagtagcggtgattcctgg-3';

[0113] lysA-down-F: 5'- gttttagagctagaaatagc-3';

[0114] ​lysA-up-R: 5'-gaatatgtctgatccataacaaactccagataagtgcttttttatgattacg-3';

[0115] gdhA-F: 5'-gcacttatctggagtttgttatggatcagacatattctctggagtca-3';

[0116] gdhA-R: 5'-ccagcgactaaccgcagttaaatcacaccctgcgccag-3';

[0117] lysA-down-F: 5'-ctggcgcagggtgtgatttaactgcggttagtcgctgg-3';

[0118] lysA-down-R: 5'-ccgcattggttatctgtgctctaac-3';

[0119] (4) Electroporation: 200 ng of pTarget-lysA plasmid, 400 ng of lysA::gdhA targeting fragment and 100 μL of the electrocompetent cells prepared in step (1) were mixed and placed in a 2 mm electroporation cup, and then 2.5 kV was applied for electroporation. After recovery in 1 mL of LB liquid medium at 30°C, the cells were spread on an LB plate containing kanamycin and streptomycin (kanamycin concentration: 50 μg / mL, streptomycin concentration: 50 μg / mL) and cultured at 30°C. Positive clones were selected and subjected to PCR amplification using primers lysA-up-F and lysA-down-R. The amplified fragments were sequenced to verify the correctness of the positive clones;

[0120] (5) Elimination of pTarget plasmid: The positive clones verified by sequencing were inoculated in LB liquid medium containing 0.1 mM IPTG and kanamycin and cultured at 30°C overnight to eliminate the pTarget-lysA plasmid. The overnight culture was streaked on an LB solid plate containing kanamycin and cultured at 30°C overnight to obtain a mutant Escherichia coli D9 strain K12ΔpykFΔlysA::gdhA or a mutant Escherichia coli D10 strain K12ΔpykAΔlysA::gdhA containing the pCas plasmid.

[0121] (6) Elimination of pCas plasmid: the E. coli mutant K12ApykFAlvsA::gdhA or K12ApykAAlvsA::gdhA containing pCas plasmid which was verified correct by sequencing was inoculated in LB liquid medium, and cultured at 37°C overnight to eliminate pCas plasmid. The strain after overnight culture was streaked on LB solid plate, and cultured at 37°C overnight to obtain mutant E. coli D9 strain K12ApykFAlvsA::gdhA or mutant E. coli D10 strain K12ApykAAlvsA::gdhA.

[0122] IV. Construction of mutant E. coli D5 strain K12ApykFAlvsA * , mutant E. coli D6 strain K12ApykAAlvsA * , mutant E. coli D7 strain K12ApykFAmetL * and mutant E. coli D8 strain K12ApykAmetL *

[0123] (1) Construction of pTarget plasmid: the N20 of truncated thrA and metL genes was selected by using the website https: / / crispy.secondarymetabolites.org, and primers were designed to construct pTarget plasmid; pTargetF was used as a template, and primer pairs pTarget-thrA-F and pTarget-thrA-R, pTarget-metL-F and pTarget-metL-R were used for PCR amplification, respectively, to obtain a fragment with a size of about 2100 bp; after about 3 h of DpnI methylation enzyme digestion, the positive clones were directly screened on LB plates containing streptomycin (streptomycin concentration was 50 pg / mL) by using chemical transformation method, and verified by sequencing with primer pTarget-cexu-F. After sequencing correct, it was named as pTarget-thrA and pTarget-metL;

[0124] The primer sequences used are as follows (the sequence of N20 is indicated by underlined):

[0125] pTarget-thrA-F: 5’- gttttagagctagaaatagc-3’; CGAAGGCATGAGTTTCTCCG pTarget-thrA-R: 5’- actagtattatacctaggac-3’;

[0126] CGGAGAAACTCATGCCTTCG

[0127] ​​pTarget-metL-F: 5'-ggttttagagctagaaatagc-3'; TGGCTGTTCCTGCAATTCGA pTarget-metL-R: 5'-actagtattatacctaggac-3'; TCGAATTGCAGGAACAGCCA pTarget-metL-R: 5'-actagtattatacctaggac-3';

[0128] (2) Amplification of the targeting fragment: the primers of thrA-up-F and thrA-up-R, thrA-down-F and thrA-down-R, or metL-up-F and metL-up-R, metL-down-F and metL-down-R were used for PCR amplification, respectively, to obtain a fragment of about 500 bp in size; the mixture of the above two fragments was used as a template, and the primers of thrA-up-F and thrA-down-R, or metL-up-F and metL-down-R were used for PCR amplification, respectively, to obtain a thrA or metL targeting fragment of about 1000 bp in size, and the targeting fragment was recovered; the targeting fragment contained 500 bp upstream homologous arms, only 1413 bp of the thrA mutant gene or 1392 bp of the metL mutant gene, and 500 bp downstream homologous arms from upstream to downstream;

[0129] The primer sequences used are as follows:

[0130] thrA-up-F: 5'-tcctacttcggcgctaaagttct-3';

[0131] thrA-up-R: 5'-cggggcataaactttaaccatgtcacacaaacacttcgataacctgatcgg-3';

[0132] thrA-down-F: 5'-ccgatcaggttatcgaagtgtttgtgtgacatggttaaagtttatgccccg-3';

[0133] thrA-down-R: 5'-aatagcaggcgtgaatgaagcc-3';

[0134] metL-up-F: 5'-aggttccacgcgcattgaac-3';

[0135] metL-up-R: 5'-taaatttctgaaattacaataccaggccgatgcgt-3';

[0136] metL-down-F: 5'-gtattgtaatttcagaaatttaataatgcccggtactcatgt-3';

[0137] metL-down-R: 5'-gcaagtaagatgcggtgccg-3';

[0138] (3) Electroporation: 200 ng of pTarget-thrA or pTarget-metL plasmid, 400 ng of thrA or metL targeting fragment were mixed with 100 μL of the electrocompetent cells prepared in step (1) in a 2 mm electroporation cuvette, 2.5 kV electroporation, 1 mL of LB liquid medium was added after recovery at 30°C, and then spread on LB plates containing kanamycin and streptomycin (kanamycin concentration of 50 μg / mL, streptomycin concentration of 50 μg / mL), and cultured at 30°C to screen positive clones; PCR amplification was performed using primer pairs thrA-up-F and thrA-down-R, or metL-up-F and metL-down-R, and the amplified fragments were sequenced for verification;

[0139] (4) Elimination of pTarget plasmid: the positive clones verified by sequencing were inoculated in LB liquid medium containing 0.1 mM IPTG and kanamycin and cultured at 30°C overnight to eliminate pTarget-thrA or pTarget-metL plasmid; the overnight cultured strains were streaked on LB solid plates containing kanamycin and cultured at 30°C overnight to obtain mutant E. coli D5 strain, mutant E. coli D6 strain, mutant E. coli D7 strain and mutant E. coli D8 strain containing pCas plasmid;

[0140] (6) Elimination of pCas plasmid: the mutant E. coli D5 strain, D6 strain, D7 strain and D8 strain containing pCas plasmid verified by sequencing were inoculated in LB liquid medium and cultured at 37°C overnight to eliminate pCas plasmid; the overnight cultured strains were streaked on LB solid plates and cultured at 37°C overnight to obtain mutant E. coli D5 strain K12ΔpykFΔthrA * , mutant E. coli D6 strain K12ΔpykAΔthrA * , mutant E. coli D7 strain K12ΔpykFΔmetL * and mutant E. coli D8 strain K12ΔpykAΔmetL * .

[0141] Five, mutant E. coli D1 strain K12ΔpykFΔthrA *ΔlysA::gdhA, mutant E. coli D2 strain K12ΔpykAΔmetL * ΔlysA::gdhA, mutant E. coli D3 strain K12ΔpykAΔthrA * ΔlysA::gdhA, mutant E. coli D4 strain

[0142] K12ΔpykAΔthrA * ΔlysA::gdhA

[0143] (1) Elimination of pTarget plasmid: single colony of mutant K12ΔpykFΔthrA was picked from the plate in step (4) in the procedure of constructing mutant E. coli strains with weakened homoserine synthesis metabolic pathway * , K12ΔpykAΔmetL * , K12ΔpykAΔthrA * and K12ΔpykAΔthrA*, electrotransformation competent cells were prepared, the pTarget-lysA plasmid and lysA::gdhA targeting fragment obtained in steps (2) and (3) in the procedure of constructing mutant E. coli strains with weakened lysine synthesis metabolic pathway were mixed, and steps (4) and (5) in the procedure of constructing mutant E. coli strains with weakened lysine synthesis metabolic pathway were repeated to obtain mutant E. coli D1 strain, D2 strain, D3 strain and D4 strain containing pCas plasmid;

[0144] (2) Elimination of pCas plasmid: mutant E. coli D1 strain, D2 strain, D3 strain and D4 strain containing pCas plasmid which were verified correct by sequencing were inoculated in LB liquid medium, and cultured at 37°C overnight to eliminate pCas plasmid. The strains after overnight culture were streaked on LB solid plate, and cultured at 37°C overnight to obtain finally D1 strain K12ΔpykFΔthrA * ΔlysA::gdhA, mutant E. coli D2 strain K12ΔpykAΔmetL * ΔlysA::gdhA, mutant E. coli D3 strain

[0145] K12ΔpykAΔthrA * ΔlysA::gdhA, mutant E. coli D4 strain

[0146] K12ΔpykAΔthrA * ΔlysA::gdhA.

[0147] Six, construction of recombinant bacteria for producing tetrahydropyrimidine by converting glucose

[0148] The obtained recombinant vector PSSE was introduced into the constructed mutant E. coli D11 strain, mutant E. coli D12 strain, mutant E. coli D9 strain, mutant E. coli D10 strain, mutant E. coli D5 strain, mutant E. coli D7 strain, mutant E. coli D6 strain, mutant E. coli D8 strain, mutant E. coli D1 strain, mutant E. coli D4 strain, mutant E. coli D3 strain, mutant E. coli D2 strain and wild-type E. coli K12 by calcium chloride method, and positive clones were screened on plates containing ampicillin, and the obtained positive clones were named as PSSE / K12ΔpykF (strain number EPK01), PSSE / K12ΔpykA (strain number EPK02), PSSE / K12ΔpykFΔlysA::gdhA (strain number EPK03), PSSE / K12ΔpykAΔlysA::gdhA (strain number EPK04), PSSE / K12ΔpykFΔthrA * (strain number EPK05), PSSE / K12ΔpykFΔmetL * (strain number EPK06), PSSE / K12ΔpykAΔthrA * (strain number EPK07), PSSE / K12ΔpykAΔmetL * (strain number EPK08), PSSE / K12ΔpykFΔthrA * ΔlysA::gdhA (strain number EPK09), PSSE / K12ΔpykFΔmetL * ΔlysA::gdhA (strain number EPK10), PSSE / K12ΔpykAΔthrA * ΔlysA::gdhA (strain number EPK11), PSSE / K12ΔpykAΔmetL * ΔlysA::gdhA (strain number EPK12) and PSSE / K12 (strain number EPK13).

[0149] Example 2

[0150] I. Induced culture of recombinant bacteria for producing tetrahydropyrimidine from glucose The high-yield tetrahydropyrimidine-producing recombinant bacteria EPK01, EPK02, EPK03, EPK04, EPK05, EPK06, EPK07, EPK08, EPK09, EPK10, EPK11, EPK12, EPK13 and E. coli K12 obtained in Example 1 were streaked onto LB plates containing 1.5% agar and 100 μg / mL ampicillin, and incubated at 37°C for 12 h. Single colonies on the plates were picked and inoculated into liquid LB medium containing 100 μg / mL ampicillin, and incubated at 37°C overnight with shaking at 220 rpm. The overnight culture was inoculated into auto-induction medium ZYM at a 1% (v / v) inoculation ratio, and incubated at 30°C for 16 h with shaking at 200 rpm to obtain the induced EPK01 strain, EPK02 strain, EPK03 strain, EPK04 strain, EPK05 strain, EPK06 strain, EPK07 strain, EPK08 strain, EPK09 strain, EPK10 strain, EPK11 strain, EPK12 strain, EPK13 strain and K12 strain, respectively. The K12 strain was cultured without adding antibiotics

[0151] II. Production of tetrahydropyrimidine from glucose by recombinant bacteria

[0152] The high-yield tetrahydropyrimidine-producing recombinant bacteria EPK01, EPK02, EPK03, EPK04, EPK05, EPK06, EPK07, EPK08, EPK09, EPK10, EPK11, EPK12, EPK13 and E. coli K12 obtained in Example 1 were centrifuged at 8000 g for 10 min at 4°C to collect the bacterial cells. The bacterial cells were washed once with 10 mM NaCl solution and then centrifuged again under the same conditions to obtain washed EPK01, EPK02, EPK03, EPK04, EPK05, EPK06, EPK07, EPK08, EPK09, EPK10, EPK11, EPK12, EPK13 and E. coli. The washed bacterial strains were resuspended in PBS buffer containing 100 mM glucose (pH 7.0) to obtain the transformation solution, which contained 15 g / L bacterial cells in wet weight. The transformation solution was used to convert glucose to tetrahydropyrimidine at 30°C and 100 rpm for 9 h.

[0153] The tetrahydropyrimidine yields of different strains are shown in Table 1 Figure 1As can be seen from the figure, the positive control strain EPK13 was transformed for 9h, and the production of tetrahydropterin was only 3.69mM; the Escherichia coli K12 was transformed for 9h, and the production of tetrahydropterin was still not detected; the strains EPK01 and EPK02 were transformed for 9h, and the production of tetrahydropterin was 4.79mM and 4.14mM respectively, which was increased by 29.81% and 12.20% respectively compared with EPK13; the strains EPK03 and EPK04 were transformed for 9h, and the production of tetrahydropterin was 9.87mM and 8.29mM respectively, which was increased by 106.05% and 100.24% respectively compared with the strains EPK01 and EPK02; the strains EPK05 and EPK06 were transformed for 9h, and the production of tetrahydropterin was 11.46mM and 8.13mM respectively, which was increased by 139.25% and 69.73% respectively compared with the strain EPK01; the strains EPK07 and EPK08 were transformed for 9h, and the production of tetrahydropterin was 10.26mM and 7.62mM respectively, which was increased by 147.83% and 84.06% respectively compared with the strain EPK02; the strains EPK09, EPK10, EPK11 and EPK12 were transformed for 9h, and the production of tetrahydropterin was 19.74mM, 13.73mM, 17.94mM and 12.82mM respectively, which was increased by 72.25%, 68.88%, 74.85% and 68.24% respectively compared with the strains EPK05, EPK06, EPK07 and EPK08; among them, the strain EPK09 had the highest production, and the molar conversion rate of glucose was increased.

[0154] Example 3 Production of tetrahydropterin by high-density culture of the recombinant strain EPK09

[0155] 1.2mL of the EPK09 bacterial liquid was taken from the preservation tube in the-80℃ refrigerator and inoculated into 120mL of liquid LB medium containing 100μg / mL of ampicillin, and then the medium was cultured at 37℃ for 8h with a rotation speed of 220rpm; 2%(volume percentage) of the culture was inoculated into a 10L fermenter containing 6L of basic medium, the culture temperature was 37℃, the pH was maintained at about 7.0 by adding ammonia water, the aeration ratio was 0.8-1vvm, the rotation speed was associated with the dissolved oxygen, and the dissolved oxygen was maintained at not less than 20%; after 12h of fermentation, the feeding medium was started to be added to maintain the glucose concentration in the fermentation broth at 0.5-1g / L; the OD 600 When the OD reached 50, the temperature was reduced to 30℃, 20% of arabinose was added for induction, and the biomass and the yield of tetrahydropterin in the tank were measured by interval sampling, and the fermentation period was 56h;

[0156] The fermentation process curve of the 10L fermenter is shown in Figure 2 , and the OD of the bacteria was 50 after 12h of fermentation 600The value reached 18.6, and the residual sugar concentration was reduced to below 0.1 g / L. The sugar was added, and with the addition of glucose, the cell concentration of the fermentation broth steadily increased. At 18 h, the OD 600 The value reached 51.7, and the arabinose was added to start the induction. The cells began to synthesize a large amount of tetrahydropyrimidine. The glucose was consumed by 201.67 g / L in total in 56 h, the yield of tetrahydropyrimidine reached 53.22 g / L, and the molar conversion rate of glucose was 0.36 mol / mol. The cell density OD 600 reached 99.8, the cell dry weight was about 29.74 g / L, and the yield of tetrahydropyrimidine per unit of cell reached 1.79 g / g DCW. The yield of tetrahydropyrimidine of the control strain EPK13 was only 7.24 g / L in 56 h under the same culture conditions.

[0157] Example 4 High-density culture of recombinant strains EPK10, EPK11 and EPK12 for producing tetrahydropyrimidine

[0158] The recombinant strains EPK10, EPK11 and EPK12 were cultured in a 10 L fermenter according to the culture method described in Example 3. The recombinant strain EPK10 consumed glucose by 168.32 g / L in total in 56 h, the yield of tetrahydropyrimidine reached 41.27 g / L, the molar conversion rate of glucose was 0.31 mol / mol, and the cell density OD 600 reached 113.2, the cell dry weight was about 33.64 g / L, and the yield of tetrahydropyrimidine per unit of cell reached 1.23 g / g DCW. The yield of tetrahydropyrimidine of the control strain EPK13 was only 6.93 g / L in 56 h under the same culture conditions. The recombinant strain EPK11 consumed glucose by 156.18 g / L in total in 56 h, the yield of tetrahydropyrimidine reached 46.83 g / L, the molar conversion rate of glucose was 0.38 mol / mol, and the cell density OD 600 reached 85.6, the cell dry weight was about 24.48 g / L, and the yield of tetrahydropyrimidine per unit of cell reached 1.91 g / g DCW. The yield of tetrahydropyrimidine of the control strain EPK13 was only 7.07 g / L in 56 h under the same culture conditions. The recombinant strain EPK12 consumed glucose by 145.34 g / L in total in 56 h, the yield of tetrahydropyrimidine reached 36.45 g / L, the molar conversion rate of glucose was 0.32 mol / mol, and the cell density OD 600 reached 100.7, the cell dry weight was about 30.21 g / L, and the yield of tetrahydropyrimidine per unit of cell reached 1.21 g / g DCW. The yield of tetrahydropyrimidine of the control strain EPK13 was only 7.16 g / L in 56 h under the same culture conditions.

[0159] The above merely describes the embodiments of the present application, and does not limit the patent scope of the present application, and any equivalent structure or equivalent process transformation, or direct or indirect application in other related technical fields, are also included in the patent protection scope of the present application. SEQUENCE LISTING <110> FUJIAN NORMAL UNIVERSITY <120> Method for constructing recombinant bacteria for efficiently converting glucose to produce tetrahydropyrimidine and application thereof <160> 18 <170> SIPOSequenceListing 1.0 <210> 1 <211> 423 <212> PRT <213> Streptomyces reticuli <400> 1 Met Thr Ile Thr Gln Pro Asp Leu Ser Val Phe Glu Thr Leu Glu Ser 1 5 10 15 Glu Val Arg Ser Tyr Cys Arg Gly Trp Pro Val Val Phe Asp Arg Ala 20 25 30 Gln Gly Ser Arg Met Tyr Asp Glu Asp Gly His Arg Tyr Leu Asp Phe 35 40 45 Phe Ala Gly Ala Gly Ser Leu Asn Tyr Gly His Asn Asn Pro Val Leu 50 55 60 Lys Arg Ala Leu Leu Asp Tyr Leu Glu Arg Asp Gly Val Thr His Gly 65 70 75 80 Leu Asp Met Ser Thr Thr Ala Lys Arg Ser Phe Leu Arg Ala Phe Gln 85 90 95 Glu Leu Val Leu Arg Pro Arg Asp Leu Pro Tyr Lys Val Met Phe Pro 100 105 110 Gly Pro Thr Gly Thr Asn Ala Val Glu Ser Ala Leu Lys Leu Ala Arg 115 120 125 Lys Val Lys Gly Arg Glu Ala Ile Val Ser Phe Thr Asn Ala Phe His 130 135 140 Gly Met Ser Leu Gly Ser Leu Ala Val Thr Gly Asn Ala Phe Lys Arg 145 150 155 160 Ala Ser Ala Gly Val Pro Leu Val His Gly Thr Pro Met Pro Phe Asp 165 170 175 Asn Tyr Phe Asp Gly Thr Val Pro Asp Phe Leu Trp Phe Glu Arg Leu 180 185 190 Leu Glu Asp Gln Gly Ser Gly Leu Asn Arg Pro Ala Ala Val Ile Val 195 200 205 Glu Thr Val Gln Gly Glu Gly Gly Ile Asn Val Ala Arg Pro Glu Trp 210 215 220 Leu Arg Ala Leu Lys Asp Leu Cys Glu Arg Gln Asp Met Leu Leu Ile 225 230 235 240 Val Asp Asp Ile Gln Met Gly Cys Gly Arg Thr Gly Ala Phe Phe Ser 245 250 255 Phe Glu Glu Ala Gly lie Thr Pro Asp lie Val Thr Val Ser Lys Ser 260 265 270 Ile Ser Gly Tyr Gly Leu Pro Met Ser Leu Cys Leu Phe Arg Pro Glu 275 280 285 Leu Asp lie Trp Glu Pro Gly Glu His Asn Gly Thr Phe Arg Gly Asn 290 295 300 Asn Pro Ala Phe Val Thr Ala Thr Ala Ala Leu Glu Thr Tyr Trp Thr 305 310 315 320 Asp Ser Pro Ala Met Glu Lys Gin Thr Arg Ala Arg Gly Glu Gin lie 325 330 335 Glu Arg Glu Leu Ala Ala lie Arg Ala Glu Asn Leu Ala Glu Val Lys 340 345 350 Asp Tyr Arg Gly Arg Gly Leu Val Trp Gly Leu Glu Phe His Asp Arg 355 360 365 Thr Arg Ala Ser Arg Val Ala Arg Arg Ala Phe Asp Leu Gly Leu Leu 370 375 380 Val Glu Thr Ser Gly Pro Glu Gly Glu Val Val Lys Leu Leu Pro Ala 385 390 395 400 Leu Thr lie Thr Ala Glu Glu Leu Asp Glu Gly Leu Lys Val Leu Ala 405 410 415 Arg Ala Val Arg Glu Thr Ala 420 <210> 2 <211> 170 <212> PRT <213> Sphingopyxis macrogoltabida <400> 2 Met Ala Asp Ile Glu Phe Arg Ala Pro Val Ala Thr Asp Gly Pro Ala 1 5 10 15 Val Thr Ala Leu Ile Ala Ala Cys Pro Pro Leu Asp Arg Asn Ser Arg 20 25 30 Tyr Cys Asn Leu Leu Gln Cys Glu His Phe Ala Asp His Cys Ile Ile 35 40 45 Ala Glu Lys Ala Gly Arg Ile Val Gly Trp Val Ser Gly Tyr Arg Pro 50 55 60 Pro Ser Asp Pro His Ala Phe Phe Val Trp Gln Val Ala Val Ser Ser 65 70 75 80 Glu Gly Arg Gly Arg Gln Leu Ala Ser Arg Met Ile Ala Asp Leu Leu 85 90 95 Lys Arg Pro Ala Gln Asp Gly Val Thr Tyr Met Ile Thr Thr Ile Thr 100 105 110 Ala Asp Asn Gln Ala Ser Trp Gly Leu Phe Arg Ser Leu Ala Arg Lys 115 120 125 Trp Asp Thr Glu Leu Glu Arg Ser Ala Leu Phe Glu Arg Glu Ala His 130 135 140 Phe Ala Gly Ala His Ala Thr Glu Tyr Leu Ala Arg Ile Gly Pro Ile 145 150 155 160 Asp Arg Asp Lys Ile His Glu Lys Gln Gly 165 170 <210> 3 <211> 138 <212> PRT <213> Kytococcus sedentarius <400> 3 Met Lys Val Met His Leu Asp Glu Leu Asn Gly Thr Glu Asn Asp Val 1 5 10 15 Glu His Gly Asn Trp Arg Ser Arg Arg Phe Phe Leu Ala Asp Glu Gly 20 25 30 Val Gly Phe Ser Phe His Val Thr Val Leu Lys Ala Gly Thr Ser Thr 35 40 45 Asp Met Trp Tyr Ala Asn His Val Glu Cys Val Tyr Val Tyr Gln Gly 50 55 60 Ser Gly Thr Leu Val Asn Arg Asp Thr Gly Glu Glu His Glu Leu Arg 65 70 75 80 Pro Gly Thr Met Tyr Leu Leu Asn Asp Ser Asp Lys His Thr Leu Ile 85 90 95 Ala Asp Glu Asp Val His Cys Thr Cys Val Phe Asn Pro Pro Val Thr 100 105 110 Gly Arg Glu Val His Asp Glu Asn Gly Val Tyr Pro Leu Leu Asp Ala 115 120 125 Glu Gly Asn Arg Leu Asp Thr Pro Lys Ala 130 135 <210> 4 <211> 470 <212> PRT <213> Escherichia coli <400> 4 Met Lys Lys Thr Lys Ile Val Cys Thr Ile Gly Pro Lys Thr Glu Ser 1 5 10 15 Glu Glu Met Leu Ala Lys Met Leu Asp Ala Gly Met Asn Val Met Arg 20 25 30 Leu Asn Phe Ser His Gly Asp Tyr Ala Glu His Gly Gln Arg Ile Gln 35 40 45 Asn Leu Arg Asn Val Met Ser Lys Thr Gly Lys Thr Ala Ala Ile Leu 50 55 60 Leu Asp Thr Lys Gly Pro Glu Ile Arg Thr Met Lys Leu Glu Gly Gly 65 70 75 80 Asn Asp Val Ser Leu Lys Ala Gly Gln Thr Phe Thr Phe Thr Thr Asp 85 90 95 Lys Ser Val lie Gly Asn Ser Glu Met Val Ala Val Thr Tyr Glu Gly 100 105 110 Phe Thr Thr Asp Leu Ser Val Gly Asn Thr Val Leu Val Asp Asp Gly 115 120 125 Leu lie Gly Met Glu Val Thr Ala lie Glu Gly Asn Lys Val lie Cys 130 135 140 Lys Val Leu Asn Asn Gly Asp Leu Gly Glu Asn Lys Gly Val Asn Leu 145 150 155 160 Pro Gly Val Ser lie Ala Leu Pro Ala Leu Ala Glu Lys Asp Lys Gin 165 170 175 Asp Leu lie Phe Gly Cys Glu Gin Gly Val Asp Phe Val Ala Ala Ser 180 185 190 Phe lie Arg Lys Arg Ser Asp Val lie Glu lie Arg Glu His Leu Lys 195 200 205 Ala His Gly Gly Glu Asn lie His lie lie Ser Lys lie Glu Asn Gin 210 215 220 Glu Gly Leu Asn Asn Phe Asp Glu lie Leu Glu Ala Ser Asp Gly lie 225 230 235 240 Met Val Ala Arg Gly Asp Leu Gly Val Glu lie Pro Val Glu Glu Val 245 250 255 Ile Phe Ala Gin Lys Met Met lie Glu Lys Cys lie Arg Ala Arg Lys 260 265 270 Val Val lie Thr Ala Thr Gin Met Leu Asp Ser Met lie Lys Asn Pro 275 280 285 Arg Pro Thr Arg Ala Glu Ala Gly Asp Val Ala Asn Ala lie Leu Asp 290 295 300 Gly Thr Asp Ala Val Met Leu Ser Gly Glu Ser Ala Lys Gly Lys Tyr 305 310 315 320 Pro Leu Glu Ala Val Ser lie Met Ala Thr lie Cys Glu Arg Thr Asp 325 330 335 Arg Val Met Asn Ser Arg Leu Glu Phe Asn Asn Asp Asn Arg Lys Leu 340 345 350 Arg lie Thr Glu Ala Val Cys Arg Gly Ala Val Glu Thr Ala Glu Lys 355 360 365 Leu Asp Ala Pro Leu lie Val Val Ala Thr Gin Gly Gly Lys Ser Ala 370 375 380 Arg Ala Val Arg Lys Tyr Phe Pro Asp Ala Thr lie Leu Ala Leu Thr 385 390 395 400 Thr Asn Glu Lys Thr Ala His Gin Leu Val Leu Ser Lys Gly Val Val 405 410 415 Pro Gin Leu Val Lys Glu Ile Thr Ser Thr Asp Asp Phe Tyr Arg Leu 420 425 430 Gly Lys Glu Leu Ala Leu Gin Ser Gly Leu Ala His Lys Gly Asp Val 435 440 445 Val Val Met Val Ser Gly Ala Leu Val Pro Ser Gly Thr Thr Asn Thr 450 455 460 Ala Ser Val His Val Leu 465 470 <210> 5 <211> 480 <212> PRT <213> Escherichia coli <400> 5 Met Ser Arg Arg Leu Arg Arg Thr Lys Ile Val Thr Thr Leu Gly Pro 1 5 10 15 Ala Thr Asp Arg Asp Asn Asn Leu Glu Lys Val Ile Ala Ala Gly Ala 20 25 30 Asn Val Val Arg Met Asn Phe Ser His Gly Ser Pro Glu Asp His Lys 35 40 45 Met Arg Ala Asp Lys Val Arg Glu Ile Ala Ala Lys Leu Gly Arg His 50 55 60 Val Ala Ile Leu Gly Asp Leu Gin Gly Pro Lys Ile Arg Val Ser Thr 65 70 75 80 Phe Lys Glu Gly Lys Val Phe Leu Asn Ile Gly Asp Lys Phe Leu Leu 85 90 95 Asp Ala Asn Leu Gly Lys Gly Glu Gly Asp Lys Glu Lys Val Gly Ile 100 105 110 Asp Tyr Lys Gly Leu Pro Ala Asp Val Val Pro Gly Asp Ile Leu Leu 115 120 125 Leu Asp Asp Gly Arg Val Gin Leu Lys Val Leu Glu Val Gin Gly Met 130 135 140 Lys Val Phe Thr Glu Val Thr Val Gly Gly Pro Leu Ser Asn Asn Lys 145 150 155 160 Gly Ile Asn Lys Leu Gly Gly Gly Leu Ser Ala Glu Ala Leu Thr Glu 165 170 175 Lys Asp Lys Ala Asp Ile Lys Thr Ala Ala Leu Ile Gly Val Asp Tyr 180 185 190 Leu Ala Val Ser Phe Pro Arg Cys Gly Glu Asp Leu Asn Tyr Ala Arg 195 200 205 Arg Leu Ala Arg Asp Ala Gly Cys Asp Ala Lys Ile Val Ala Lys Val 210 215 220 Glu Arg Ala Glu Ala Val Cys Ser Gin Asp Ala Met Asp Asp Ile Ile 225 230 235 240 Leu Ala Ser Asp Val Val Met Val Ala Arg Gly Asp Leu Gly Val Glu 245 250 255 Ile Gly Asp Pro Glu Leu Val Gly Ile Gln Lys Ala Leu Ile Arg Arg 260 265 270 Ala Arg Gln Leu Asn Arg Ala Val Ile Thr Ala Thr Gln Met Met Glu 275 280 285 Ser Met Ile Thr Asn Pro Met Pro Thr Arg Ala Glu Val Met Asp Val 290 295 300 Ala Asn Ala Val Leu Asp Gly Thr Asp Ala Val Met Leu Ser Ala Glu 305 310 315 320 Thr Ala Ala Gly Gln Tyr Pro Ser Glu Thr Val Ala Ala Met Ala Arg 325 330 335 Val Cys Leu Gly Ala Glu Lys Ile Pro Ser Ile Asn Val Ser Lys His 340 345 350 Arg Leu Asp Val Gln Phe Asp Asn Val Glu Glu Ala Ile Ala Met Ser 355 360 365 Ala Met Tyr Ala Ala Asn His Leu Lys Gly Val Thr Ala Ile Ile Thr 370 375 380 Met Thr Glu Ser Gly Arg Thr Ala Leu Met Thr Ser Arg Ile Ser Ser 385 390 395 400 Gly Leu Pro Ile Phe Ala Met Ser Arg His Glu Arg Thr Leu Asn Leu 405 410 415 Thr Ala Leu Tyr Arg Gly Val Thr Pro Val His Phe Asp Ser Ala Asn 420 425 430 Asp Gly Val Ala Ala Ala Ser Glu Ala Val Asn Leu Leu Arg Asp Lys 435 440 445 Gly Tyr Leu Met Ser Gly Asp Leu Val Ile Val Thr Gln Gly Asp Val 450 455 460 Met Ser Thr Val Gly Ser Thr Asn Thr Thr Arg Ile Leu Thr Val Glu 465 470 475 480 <210> 6 <211> 470 <212> PRT <213> Escherichia coli <400> 6 Met Arg Val Leu Lys Phe Gly Gly Thr Ser Val Ala Asn Ala Glu Arg 1 5 10 15 Phe Leu Arg Val Ala Asp Ile Leu Glu Ser Asn Ala Arg Gln Gly Gln 20 25 30 Val Ala Thr Val Leu Ser Ala Pro Ala Lys Ile Thr Asn His Leu Val 35 40 45 Ala Met Ile Glu Lys Thr Ile Ser Gly Gin Asp Ala Leu Pro Asn Ile 50 55 60 Ser Asp Ala Glu Arg Ile Phe Ala Glu Leu Leu Thr Gly Leu Ala Ala 65 70 75 80 Ala Gin Pro Gly Phe Pro Leu Ala Gin Leu Lys Thr Phe Val Asp Gin 85 90 95 Glu Phe Ala Gin Ile Lys His Val Leu His Gly Ile Ser Leu Leu Gly 100 105 110 Gln Cys Pro Asp Ser Ile Asn Ala Ala Leu Ile Cys Arg Gly Glu Lys 115 120 125 Met Ser Ile Ala Ile Met Ala Gly Val Leu Glu Ala Arg Gly His Asn 130 135 140 Val Thr Val Ile Asp Pro Val Glu Lys Leu Leu Ala Val Gly His Tyr 145 150 155 160 Leu Glu Ser Thr Val Asp Ile Ala Glu Ser Thr Arg Arg Ile Ala Ala 165 170 175 Ser Arg Ile Pro Ala Asp His Met Val Leu Met Ala Gly Phe Thr Ala 180 185 190 Gly Asn Glu Lys Gly Glu Leu Val Val Leu Gly Arg Asn Gly Ser Asp 195 200 205 Tyr Ser Ala Ala Val Leu Ala Ala Cys Leu Arg Ala Asp Cys Cys Glu 210 215 220 Ile Trp Thr Asp Val Asp Gly Val Tyr Thr Cys Asp Pro Arg Gln Val 225 230 235 240 Pro Asp Ala Arg Leu Leu Lys Ser Met Ser Tyr Gin Gin Ala Met Gin 245 250 255 Leu Ser Tyr Phe Gly Ala Lys Val Leu His Pro Arg Thr Ile Thr Pro 260 265 270 Ile Ala Gin Phe Gin Ile Pro Cys Leu Ile Lys Asn Thr Gin Asn Pro 275 280 285 Gln Ala Pro Gin Thr Leu Ile Gin Ala Ser Gin Asp Gin Leu Gin Leu 290 295 300 Pro Val Lys Gin Ile Ser Asn Leu Asn Asn Met Gin Met Phe Ser Val 305 310 315 320 Ser Gin Pro Gin Met Lys Gin Met Val Gin Gin Met Gin Gin Gin Gin 325 330 335 Ala Gin Met Ser Gin Ala Gin Ile Ser Val Val Leu Ile Thr Gin Ser 340 345 350 Ser Ser Gin Tyr Ser Ile Ser Phe Cys Val Pro Gin Ser Asp Cys Val 355 360 365 Arg Ala Glu Arg Ala Met Gin Glu Glu Phe Tyr Leu Glu Leu Lys Glu 370 375 380 Gly Leu Leu Glu Pro Leu Ala Val Thr Glu Arg Leu Ala Ile Ile Ser 385 390 395 400 Val Val Gly Asp Gly Met Arg Thr Leu Arg Gly Ile Ser Ala Lys Phe 405 410 415 Phe Ala Ala Leu Ala Arg Ala Asn Ile Asn Ile Val Ala Ile Ala Gln 420 425 430 Gly Ser Ser Glu Arg Ser Ile Ser Val Val Val Asn Asn Asp Asp Ala 435 440 445 Thr Thr Gly Val Arg Val Thr His Gin Met Leu Phe Asn Thr Asp Gin 450 455 460 Val Ile Glu Val Phe Val 465 470 <210> 7 <211> 463 <212> PRT <213> Escherichia coli <400> 7 Met Ser Val Ile Ala Gin Ala Gly Ala Lys Gly Arg Gin Leu His Lys 1 5 10 15 Phe Gly Gly Ser Ser Leu Ala Asp Val Lys Cys Tyr Leu Arg Val Ala 20 25 30 Gly lie Met Ala Glu Tyr Ser Gin Pro Asp Asp Met Met Val Val Ser 35 40 45 Ala Ala Gly Ser Thr Thr Asn Gin Leu lie Asn Trp Leu Lys Leu Ser 50 55 60 Gln Thr Asp Arg Leu Ser Ala His Gin Val Gin Gin Thr Leu Arg Arg 65 70 75 80 Tyr Gin Cys Asp Leu lie Ser Gly Leu Leu Pro Ala Glu Glu Ala Asp 85 90 95 Ser Leu lie Ser Ala Phe Val Ser Asp Leu Glu Arg Leu Ala Ala Leu 100 105 110 Leu Asp Ser Gly lie Asn Asp Ala Val Tyr Ala Glu Val Val Gly His 115 120 125 Gly Glu Val Trp Ser Ala Arg Leu Met Ser Ala Val Leu Asn Gin Gin 130 135 140 Gly Leu Pro Ala Ala Trp Leu Asp Ala Arg Glu Phe Leu Arg Ala Glu 145 150 155 160 Arg Ala Ala Gin Pro Gin Val Asp Glu Gly Leu Ser Tyr Pro Leu Leu 165 170 175 Gln Gin Leu Leu Val Gin His Pro Gly Lys Arg Leu Val Val Thr Gly 180 185 190 Phe lie Ser Arg Asn Asn Ala Gly Glu Thr Val Leu Leu Gly Arg Asn 195 200 205 Gly Ser Asp Tyr Ser Ala Thr Gin lie Gly Ala Leu Ala Gly Val Ser 210 215 220 Arg Val Thr lie Trp Ser Asp Val Ala Gly Val Tyr Ser Ala Asp Pro 225 230 235 240 Arg Lys Val Lys Asp Ala Cys Leu Leu Pro Leu Leu Arg Leu Asp Glu 245 250 255 Ala Ser Glu Leu Ala Arg Leu Ala Ala Pro Val Leu His Ala Arg Thr 260 265 270 Leu Gin Pro Val Ser Gly Ser Glu lie Asp Leu Gin Leu Arg Cys Ser 275 280 285 Tyr Thr Pro Asp Gin Gly Ser Thr Arg lie Glu Arg Val Leu Ala Ser 290 295 300 Gly Thr Gly Ala Arg lie Val Thr Ser His Asp Asp Val Cys Leu lie 305 310 315 320 Glu Phe Gin Val Pro Ala Ser Gin Asp Phe Lys Leu Ala His Lys Glu 325 330 335 lie Asp Gin lie Leu Lys Arg Ala Gin Val Arg Pro Leu Ala Val Gly 340 345 350 Val His Asn Asp Arg Gin Leu Leu Gin Phe Cys Tyr Thr Ser Glu Val 355 360 365 Ala Asp Ser Ala Leu Lys lie Leu Asp Glu Ala Gly Leu Pro Gly Glu 370 375 380 Leu Arg Leu Arg Gin Gly Leu Ala Leu Val Ala Met Val Gly Ala Gly 385 390 395 400 Val Thr Arg Asn Pro Leu His Cys His Arg Phe Trp Gin Gin Leu Lys 405 410 415 Gly Gin Pro Val Glu Phe Thr Trp Gin Ser Asp Asp Gly lie Ser Leu 420 425 430 Val Ala Val Leu Arg Thr Gly Pro Thr Glu Ser Leu lie Gin Gly Leu 435 440 445 His Gin Ser Val Phe Arg Ala Glu Lys Arg lie Gly Leu Val Leu 450 455 460 <210> 8 <211> 420 <212> PRT <213> Escherichia coli <400> 8 Met Pro His Ser Leu Phe Ser Thr Asp Thr Asp Leu Thr Ala Glu Asn 1 5 10 15 Leu Leu Arg Leu Pro Ala Glu Phe Gly Cys Pro Val Trp Val Tyr Asp 20 25 30 Ala Gln Ile Ile Arg Arg Gln Ile Ala Ala Leu Lys Gln Phe Asp Val 35 40 45 Val Arg Phe Ala Gln Lys Ala Cys Ser Asn Ile His Ile Leu Arg Leu 50 55 60 Met Arg Glu Gln Gly Val Lys Val Asp Ser Val Ser Leu Gly Glu Ile 65 70 75 80 Glu Arg Ala Leu Ala Ala Gly Tyr Asn Pro Gln Thr His Pro Asp Asp 85 90 95 Ile Val Phe Thr Ala Asp Val Ile Asp Gln Ala Thr Leu Glu Arg Val 100 105 110 Ser Glu Leu Gln Ile Pro Val Asn Ala Gly Ser Val Asp Met Leu Asp 115 120 125 Gln Leu Gly Gln Val Ser Pro Gly His Arg Val Trp Leu Arg Val Asn 130 135 140 Pro Gly Phe Gly His Gly His Ser Gln Lys Thr Asn Thr Gly Gly Glu 145 150 155 160 Asn Ser Lys His Gly Ile Trp Tyr Thr Asp Leu Pro Ala Ala Leu Asp 165 170 175 Val Ile Gln Arg His His Leu Gln Leu Val Gly Ile His Met His Ile 180 185 190 Gly Ser Gly Val Asp Tyr Ala His Leu Glu Gin Val Cys Gly Ala Met 195 200 205 Val Arg Gin Val He Glu Phe Gly Gin Asp Leu Gin Ala He Ser Ala 210 215 220 Gly Gly Gly Leu Ser Val Pro Tyr Gin Gin Gly Glu Glu Ala Val Asp 225 230 235 240 Thr Glu His Tyr Tyr Gly Leu Trp Asn Ala Ala Arg Glu Gin He Ala 245 250 255 Arg His Leu Gly His Pro Val Lys Leu Glu He Glu Pro Gly Arg Phe 260 265 270 Leu Val Ala Gin Ser Gly Val Leu He Thr Gin Val Arg Ser Val Lys 275 280 285 Gln Met Gly Ser Arg His Phe Val Leu Val Asp Ala Gly Phe Asn Asp 290 295 300 Leu Met Arg Pro Ala Met Tyr Gly Ser Tyr His His He Ser Ala Leu 305 310 315 320 Ala Ala Asp Gly Arg Ser Leu Glu His Ala Pro Thr Val Glu Thr Val 325 330 335 Val Ala Gly Pro Leu Cys Glu Ser Gly Asp Val Phe Thr Gin Gin Glu 340 345 350 Gly Gly Asn Val Glu Thr Arg Ala Leu Pro Glu Val Lys Ala Gly Asp 355 360 365 Tyr Leu Val Leu His Asp Thr Gly Ala Tyr Gly Ala Ser Met Ser Ser 370 375 380 Asn Tyr Asn Ser Arg Pro Leu Leu Pro Glu Val Leu Phe Asp Asn Gly 385 390 395 400 Gln Ala Arg Leu Ile Arg Arg Arg Gln Thr Ile Glu Glu Leu Leu Ala 405 410 415 Leu Glu Leu Leu 420 <210> 9 <211> 447 <212> PRT <213> Escherichia coli <400> 9 Met Asp Gln Thr Tyr Ser Leu Glu Ser Phe Leu Asn His Val Gln Lys 1 5 10 15 Arg Asp Pro Asn Gln Thr Glu Phe Ala Gln Ala Val Arg Glu Val Met 20 25 30 Thr Thr Leu Trp Pro Phe Leu Glu Gln Asn Pro Lys Tyr Arg Gln Met 35 40 45 Ser Leu Leu Glu Arg Leu Val Glu Pro Glu Arg Val Ile Gln Phe Arg 50 55 60 Val Val Trp Val Asp Asp Arg Asn Gin He Gin Val Asn Arg Ala Trp 65 70 75 80 Arg Val Gin Phe Ser Ser Ala He Gly Pro Tyr Lys Gly Gly Met Arg 85 90 95 Phe His Pro Ser Val Asn Leu Ser He Leu Lys Phe Leu Gly Phe Glu 100 105 110 Gln Thr Phe Lys Asn Ala Leu Thr Thr Leu Pro Met Gly Gly Gly Lys 115 120 125 Gly Gly Ser Asp Phe Asp Pro Lys Gly Lys Ser Glu Gly Glu Val Met 130 135 140 Arg Phe Cys Gin Ala Leu Met Thr Glu Leu Tyr Arg His Leu Gly Ala 145 150 155 160 Asp Thr Asp Val Pro Ala Gly Asp He Gly Val Gly Gly Arg Glu Val 165 170 175 Gly Phe Met Ala Gly Met Met Lys Lys Leu Ser Asn Asn Thr Ala Cys 180 185 190 Val Phe Thr Gly Lys Gly Leu Ser Phe Gly Gly Ser Leu He Arg Pro 195 200 205 Glu Ala Thr Gly Tyr Gly Leu Val Tyr Phe Thr Glu Ala Met Leu Lys 210 215 220 Arg His Gly Met Gly Phe Glu Gly Met Arg Val Ser Val Ser Gly Ser 225 230 235 240 Gly Asn Val Ala Gln Tyr Ala Ile Glu Lys Ala Met Glu Phe Gly Ala 245 250 255 Arg Val Ile Thr Ala Ser Asp Ser Ser Gly Thr Val Val Asp Glu Ser 260 265 270 Gly Phe Thr Lys Glu Lys Leu Ala Arg Leu Ile Glu Ile Lys Ala Ser 275 280 285 Arg Asp Gly Arg Val Ala Asp Tyr Ala Lys Glu Phe Gly Leu Val Tyr 290 295 300 Leu Glu Gly Gln Gln Pro Trp Ser Leu Pro Val Asp Ile Ala Leu Pro 305 310 315 320 Cys Ala Thr Gln Asn Glu Leu Asp Val Asp Ala Ala His Gln Leu Ile 325 330 335 Ala Asn Gly Val Lys Ala Val Ala Glu Gly Ala Asn Met Pro Thr Thr 340 345 350 Ile Glu Ala Thr Glu Leu Phe Gln Gln Ala Gly Val Leu Phe Ala Pro 355 360 365 Gly Lys Ala Ala Asn Ala Gly Gly Val Ala Thr Ser Gly Leu Glu Met 370 375 380 Ala Gin Asn Ala Ala Arg Leu Gly Trp Lys Ala Glu Lys Val Asp Ala 385 390 395 400 Arg Leu His His Ile Met Leu Asp Ile His His Ala Cys Val Glu His 405 410 415 Gly Gly Glu Gly Glu Gin Thr Asn Tyr Val Gin Gly Ala Asn Ile Ala 420 425 430 Gly Phe Val Lys Val Ala Asp Ala Met Leu Ala Gin Gly Val Ile 435 440 445 <210> 10 <211> 1413 <212> DNA <213> Escherichia coli <400> 10 atgaaaaaga ccaaaattgt ttgcaccatc ggaccgaaaa ccgaatctga agagatgtta 60 gctaaaatgc tggacgctgg catgaacgtt atgcgtctga acttctctca tggtgactat 120 gcagaacacg gtcagcgcat tcagaatctg cgcaacgtga tgagcaaaac tggtaaaacc 180 gccgctatcc tgcttgatac caaaggtccg gaaatccgca ccatgaaact ggaaggcggt 240 aacgacgttt ctctgaaagc tggtcagacc tttactttca ccactgataa atctgttatc 300 GGCAACAGCG AAATGGTTGC GGTACGTATG AAGGTTTCA CTACTGACCT GTCTGTTGGC 360 AACACCCTAC TGCTTGACGA TGCTCTGATC GGTATGGAAG TTACCACCAT TGAAGGTAAC 420 AAAGTTATCT GCTAAGTGCT GAACAACGGT GACCTGGGCG AAAACAAAGG TGTAACCTG 480 CCTGGCGTTT CCATTGCTCT GCCAGCCTTG GCTGAAAAAG CAACAGGACC TGATCTTT 540 GCTTGCCTTA TTTCTAAGCG TTCTGACGTT 600 ATCGAAATCC GTGAGCACCT GAAAGCGCAC GGCAGCGAAA ACATCCACAT CATCTCCAAA 660 ATCGAAAACCA GGAAGGCCT CAACAACCTC GACGAAATCC TCCTGAGCCT CTGACGGCAT C 720 ATGGTTGCCT GTGGCGACCT GGTTGCTGAA ATCCCGGTAG AAGAAGTTAT CTTTGCCCAG 780 AAGATGATGA TCCTAAATGT ATCCCTGCA CGTAAAGTCG TTATCCTTGC GACCCAGATG 840 CTGGATTCCA TGATCAAAAA CCCACGCCCG ACTCGCGCAG AAGCCGGTGA CGTTGCAAAC 900 GCCATCCTCG ACGGTACTGA CGCAGTGATG CTGTCTGGTG AATCCGCAAA AGGTAATAC 960 CCGCTGGAA GCCTTTCTAT CATGGCGACC ATCTGCGAAC GTACCCTCCG CGTGATGAAC 1020 agccgtctcg agttcaacaa tgacaaccgt aaactgcgca ttaccgaagc ggtatgccgt 1080 ggtgccgttg aaactgctga aaaactggat gctccgctga tcgtggttgc tactcagggc 1140 ggtaaatctg ctcgcgcagt acgtaaatac ttcccggatg ccaccatcct ggcactgacc 1200 accaacgaaa aaacggctca tcagttggta ctgagcaaag gcgttgtgcc gcagcttgtt 1260 aaagagatca cttctactga tgatttctac cgtctgggta aagaactggc tctgcagagc 1320 ggtctggcac acaaaggtga cgttgtagtt atggtttctg gtgcactggt accgagcggc 1380 actactaaca ccgcatctgt tcacgtcctg taa 1413 <210> 11 <211> 1413 <212> DNA <213> Escherichia coli <400> 11 atgcgagtgt tgaagttcgg cggtacatca gtggcaaatg cagaacgttt tctgcgtgtt 60 gccgatattc tggaaagcaa tgccaggcag gggcaggtgg ccaccgtcct ctctgccccc 120 gccaaaatca ccaaccacct ggtggcgatg attgaaaaaa ccattagcgg ccaggatgct 180 ttacccaata tcagcgatgc cgaacgtatt tttgccgaac ttttgacggg actcgccgcc 240 gcccagccgg ggttcccgct ggcgcaattg aaaactttcg tcgatcagga atttgcccaa 300 ataaaacatg tcctgcatgg cattagtttg ttggggcagt gcccggatag catcaacgct 360 gcgctgattt gccgtggcga gaaaatgtcg atcgccatta tggccggcgt attagaagcg 420 cgcggtcaca acgttactgt tatcgatccg gtcgaaaaac tgctggcagt ggggcattac 480 ctcgaatcta ccgtcgatat tgctgagtcc acccgccgta ttgcggcaag ccgcattccg 540 gctgatcaca tggtgctgat ggcaggtttc accgccggta atgaaaaagg cgaactggtg 600 gtgcttggac gcaacggttc cgactactct gctgcggtgc tggctgcctg tttacgcgcc 660 gattgttgcg agatttggac ggacgttgac ggggtctata cctgcgaccc gcgtcaggtg 720 cccgatgcga ggttgttgaa gtcgatgtcc taccaggaag cgatggagct ttcctacttc 780 ggcgctaaag ttcttcaccc ccgcaccatt acccccatcg cccagttcca gatcccttgc 840 ctgattaaaa ataccggaaa tcctcaagca ccaggtacgc tcattggtgc cagccgtgat 900 gaagacgaat taccggtcaa gggcatttcc aatctgaata acatggcaat gttcagcgtt 960 tctggtccgg ggatgaaagg gatggtcggc atggcggcgc gcgtctttgc agcgatgtca 1020 cgcgcccgta tttccgtggt gctgattacg caatcatctt ccgaatacag catcagtttc 1080 tgcgttccac aaagcgactg tgtgcgagct gaacgggcaa tgcaggaaga gttctacctg 1140 gaactgaaag aaggcttact ggagccgctg gcagtgacgg aacggctggc cattatctcg 1200 gtggtaggtg atggtatgcg caccttgcgt gggatctcgg cgaaattctt tgccgcactg 1260 gcccgcgcca atatcaacat tgtcgccatt gctcagggat cttctgaacg ctcaatctct 1320 gtcgtggtaa ataacgatga tgcgaccact ggcgtgcgcg ttactcatca gatgctgttc 1380 aataccgatc aggttatcga agtgtttgtg taa 1413 <210> 12 <211> 1263 <212> DNA <213> Escherichia coli <400> 12 atgccacatt cactgttcag caccgatacc gatctcaccg ccgaaaatct gctgcgtttg 60 cccgctgaat ttggctgccc ggtgtgggtc tacgatgcgc aaattattcg tcggcagatt 120 gcagcgctga aacagtttga tgtggtgcgc tttgcacaga aagcctgttc caatattcat 180 attttgcgct taatgcgtga gcagggcgtg aaagtggatt ccgtctcgtt aggcgaaata 240 gagcgtgcgt tggcggcggg ttacaatccg caaacgcacc ccgatgatat tgtttttacg 300 gcagatgtta tcgatcaggc gacgcttgaa cgcgtcagtg aattgcaaat tccggtgaat 360 gcgggttctg ttgatatgct cgaccaactg ggccaggttt cgccagggca tcgggtatgg 420 ctgcgcgtta atccggggtt tggtcacgga catagccaaa aaaccaatac cggtggcgaa 480 aacagcaagc acggtatctg gtacaccgat ctgcccgccg cactggacgt gatacaacgt 540 catcatctgc agctggtcgg cattcacatg cacattggtt ctggcgttga ttatgcccat 600 ctggaacagg tgtgtggtgc tatggtgcgt caggtcatcg aattcggtca ggatttacag 660 gctatttctg cgggcggtgg gctttctgtt ccttatcaac agggtgaaga ggcggttgat 720 accgaacatt attatggtct gtggaatgcc gcgcgtgagc aaatcgcccg ccatttgggc 780 caccctgtga aactggaaat tgaaccgggt cgcttcctgg tagcgcagtc tggcgtatta 840 attactcagg tgcggagcgt caaacaaatg gggagccgcc actttgtgct ggttgatgcc 900 gggttcaacg atctgatgcg cccggcaatg tacggtagtt accaccatat cagtgccctg 960 gcagctgatg gtcgttctct ggaacacgcg ccaacggtgg aaaccgtcgt cgccggaccg 1020 ttatgtgaat cgggcgatgt ctttacccag caggaagggg gaaatgttga aacccgcgcc 1080 ttgccggaag tgaaggcagg tgattatctg gtactgcatg atacaggggc atatggcgca 1140 tcaatgtcat ccaactacaa tagccgtccg ctgttaccag aagttctgtt tgataatggt 1200 caggcgcggt tgattcgccg tcgccagacc atcgaagaat tactggcgct ggaattgctt 1260 taa 1263 <210> 13 <211> 1344 <212> DNA <213> Escherichia coli <400> 13 atggatcaga catattctct ggagtcattc ctcaaccatg tccaaaagcg cgacccgaat 60 caaaccgagt tcgcgcaagc cgttcgtgaa gtaatgacca cactctggcc ttttcttgaa 120 caaaatccaa aatatcgcca gatgtcatta ctggagcgtc tggttgaacc ggagcgcgtg 180 atccagtttc gcgtggtatg ggttgatgat cgcaaccaga tacaggtcaa ccgtgcatgg 240 atccagtttc gcgtggtatg ggttgatgat cgcaaccaga tacaggtcaa ccgtgcatgg 240cgtgtgcagt tcagctctgc catcggcccg tacaaaggcg gtatgcgctt ccatccgtca 300 gttaaccttt ccattctcaa attcctcggc tttgaacaaa ccttcaaaaa tgccctgact 360 actctgccga tgggcggtgg taaaggcggc agcgatttcg atccgaaagg aaaaagcgaa 420 ggtgaagtga tgcgtttttg ccaggcgctg atgactgaac tgtatcgcca cctgggcgcg 480 gataccgacg ttccggcagg tgatatcggg gttggtggtc gtgaagtcgg ctttatggcg 540 gggatgatga aaaagctctc caacaatacc gcctgcgtct tcaccggtaa gggcctttca 600 tttggcggca gtcttattcg cccggaagct accggctacg gtctggttta tttcacagaa 660 gcaatgctaa aacgccacgg tatgggtttt gaagggatgc gcgtttccgt ttctggctcc 720 ggcaacgtcg cccagtacgc tatcgaaaaa gcgatggaat ttggtgctcg tgtgatcact 780 gcgtcagact ccagcggcac tgtagttgat gaaagcggat tcacgaaaga gaaactggca 840 cgtcttatcg aaatcaaagc cagccgcgat ggtcgagtgg cagattacgc caaagaattt 900 ggtctggtct atctcgaagg ccaacagccg tggtctctac cggttgatat cgccctgcct 960 tgcgccaccc agaatgaact ggatgttgac gccgcgcatc agcttatcgc taatggcgtt 1020 aaagccgtcg ccgaaggggc aaatatgccg accaccatcg aagcgactga actgttccag 1080 caggcaggcg tactatttgc accgggtaaa gcggctaatg ctggtggcgt cgctacatcg 1140 ggcctggaaa tggcacaaaa cgctgcgcgc ctgggctgga aagccgagaa agttgacgca 1200 cgtttgcatc acatcatgct ggatatccac catgcctgtg ttgagcatgg tggtgaaggt 1260 gagcaaacca actacgtgca gggcgcgaac attgccggtt ttgtgaaggt tgccgatgcg 1320 atgctggcgc agggtgtgat ttaa 1344 <210> 13 <211> 1443 <212> DNA <213> Escherichia coli <400> 13 atgtccagaa ggcttcgcag aacaaaaatc gttaccacgt taggcccagc aacagatcgc 60 gataataatc ttgaaaaagt tatcgcggcg ggtgccaacg ttgtacgtat gaacttttct 120 cacggctcgc ctgaagatca caaaatgcgc gcggataaag ttcgtgagat tgccgcaaaa 180 ctggggcgtc atgtggctat tctgggtgac ctccaggggc ccaaaatccg tgtatccacc 240 tttaaagaag gcaaagtttt cctcaatatt ggggataaat tcctgctcga cgccaacctg 300 ggtaaaggtg aaggcgacaa agaaaaagtc ggtatcgact acaaaggcct gcctgctgac 360 gtcgtgcctg gtgacatcct gctgctggac gatggtcgcg tccagttaaa agtactggaa 420 gttcagggca tgaaagtgtt caccgaagtc accgtcggtg gtcccctctc caacaataaa 480 ggtatcaaca aacttggcgg cggtttgtcg gctgaagcgc tgaccgaaaa agacaaagca 540 gacattaaga ctgcggcgtt gattggcgta gattacctgg ctgtctcctt cccacgctgt 600 ggcgaagatc tgaactatgc ccgtcgcctg gcacgcgatg caggatgtga tgcgaaaatt 660 gttgccaagg ttgaacgtgc ggaagccgtt tgcagccagg atgcaatgga tgacatcatc 720 ctcgcctctg acgtggtaat ggttgcacgt ggcgacctcg gtgtggaaat tggcgacccg 780 gaactggtcg gcattcagaa agcgttgatc cgtcgtgcgc gtcagctaaa ccgagcggta 840 atcacggcga cccagatgat ggagtcaatg attactaacc cgatgccgac gcgtgcagaa 900 gtcatggacg tagcaaacgc cgttctggat ggtactgacg ctgtgatgct gtctgcagaa 960 actgccgctg ggcagtatcc gtcagaaacc gttgcagcca tggcgcgcgt ttgcctgggt 1020 gcggaaaaaa tcccgagcat caacgtttct aaacaccgtc tggacgttca gttcgacaat 1080 gtggaagaag ctattgccat gtcagcaatg tacgcagcta accacctgaa aggcgttacg 1140 gcgatcatca ccatgaccga atcgggtcgt accgcgctga tgacctcccg tatcagctct 1200 ggtctgccaa ttttcgccat gtcgcgccat gaacgtacgc tgaacctgac tgctctctat 1260 cgtggcgtta cgccggtgca ctttgatagc gctaatgacg gcgtagcagc tgccagcgaa 1320 gcggttaatc tgctgcgcga taaaggttac ttgatgtctg gtgacctggt gattgtcacc 1380 cagggcgacg tgatgagtac cgtgggttct actaatacca cgcgtatttt aacggtagag 1440 taa 1443 <210> 15 <211> 1392 <212> DNA <213> Escherichia coli <400> 15 atgagtgtga ttgcgcaggc aggggcgaaa ggtcgtcagc tgcataaatt tggtggcagt 60 agtctggctg atgtgaagtg ttatttgcgt gtcgcgggca ttatggcgga gtactctcag 120 cctgacgata tgatggtggt ttccgccgcc ggtagcacca ctaaccagtt gattaactgg 180 ttgaaactaa gccagaccga tcgtctctct gcgcatcagg ttcaacaaac gctgcgtcgc 240 tatcagtgcg atctgattag cggtctgcta cccgctgaag aagccgatag cctcattagc 300 gcttttgtca gcgaccttga gcgcctggcg gcgctgctcg acagcggtat taacgacgca 360 gtgtatgcgg aagtggtggg ccacggggaa gtatggtcgg cacgtctgat gtctgcggta 420 cttaatcaac aagggctgcc agcggcctgg cttgatgccc gcgagttttt acgcgctgaa 480 cgcgccgcac aaccgcaggt tgatgaaggg ctttcttacc cgttgctgca acagctgctg 540 gtgcaacatc cgggcaaacg tctggtggtg accggattta tcagccgcaa caacgccggt 600 gaaacggtgc tgctggggcg taacggttcc gactattccg cgacacaaat cggtgcgctg 660 gcgggtgttt ctcgcgtaac catctggagc gacgtcgccg gggtatacag tgccgacccg 720 cgtaaagtga aagatgcctg cctgctgccg ttgctgcgtc tggatgaggc cagcgaactg 780 gcgcgcctgg cggctcccgt tcttcacgcc cgtactttac agccggtttc tggcagcgaa 840 atcgacctgc aactgcgctg tagctacacg ccggatcaag gttccacgcg cattgaacgc 900 gtgctggcct ccggtactgg tgcgcgtatt gtcaccagcc acgatgatgt ctgtttgatt 960 gagtttcagg tgcccgccag tcaggatttc aaactggcgc ataaagagat cgaccaaatc 1020 ctgaaacgcg cgcaggtacg cccgctggcg gttggcgtac ataacgatcg ccagttgctg 1080 caattttgct acacctcaga agtggccgac agtgcgctga aaatcctcga cgaagcggga 1140 ttacctggcg aactgcgcct gcgtcagggg ctggcgctgg tggcgatggt cggtgcaggc 1200 gtcacccgta acccgctgca ttgccaccgc ttctggcagc aactgaaagg ccagccggtc 1260 gaatttacct ggcagtccga tgacggcatc agcctggtgg cagtactgcg caccggcccg 1320 accgaaagcc tgattcaggg gctgcatcag tccgtcttcc gcgcagaaaa acgcatcggc 1380 ctggtattgt aa 1392 <210> 16 <211> 1272 <212> DNA <213> Artificial Sequence <400> 16 atgaccatca ctcagccgga cctgtccgtt tttgaaaccc tggaaagcga agtgcgttcc 60 TACTGCCGTG GCTGGCCGGT TGTCTTCGAT C GTGCTCAGG GTTCTC GTAT GTATGACGAA 120 GACGGCCATC GTTATCTGGA TTTCTTCGCG GGTGCTGGCT CCCTGAACTA CGGTCACAAC 180 AACCCGGTTC TGAAACGCGC GCTGCTGGAT TATCTGGAGC GTGATGGTGT TACGCACGGT 240 CTGGATATGT CTACTACTGC TAAACGTTCT TTCCTGCGTG CATTTCAGGA ACTG GTACTG 300 C GTCCGC GTG ATCTGCC GTA AAA GTAATG TTCCC GG GTC CGACC GGTAC TAACGC GGT A 360 GAAAGCGCTC TGAAACTGGC TCGTAAAGTC AAGGGTCGTG AAGCGATTTG TTCCTTCACC 420 AATGCTTTCC ATGGTATGAG CCTGGGTTCC CTGGCGGTAA CTGGCAACGC ATT TAAACGT 480 GCCAGCGCTG GTGTTCCGCT GGTGCATGGT ACCCCGATGC CATT CGAC AACTACTTCGAC 540 GGC ACTGTCC CTGATTT CCTGTGGTTC GAA CGCCTGCTGG AGGACCAGGG TTCTG GTCTG 600 AACCGTCCGG CTGCGGTAAT GTTGA GACGGTTCAGGGCGAAGGC GGCATTAACGTGGCA 660 C GTCCAGAAT GGCTGC GTGC TCTGAAAGAT CTGTGCGAAC GCCAGGACAT GCTGCTGATT 720 GTA GACGACAT CCAGATGGGT TGC GGCCGC ACTG GTGCCTTCTTCTCTTTTGAAGAAGCG 780 ggcattactc cggacatcgt gactgtgtct aagagcatct ctggttacgg cctgccgatg 840 tccctgtgcc tgttccgtcc ggaactggat atctgggaac cgggcgaaca taacggcacc 900 ttccgtggca acaacccggc attcgttacc gctaccgctg cactggaaac ctactggact 960 gactctccag caatggaaaa acagactcgt gcccgcggcg aacagattga acgtgaactg 1020 gctgctatcc gtgctgagaa cctggcggaa gtgaaagatt accgtggtcg tggtctggtc 1080 tggggtctgg aattccatga tcgtactcgt gctagccgcg ttgcgcgtcg tgctttcgac 1140 ctgggtctgc tggttgaaac ctctggccct gaaggtgaag ttgtgaagct gctgccggca 1200 ctgactatta ccgcggaaga gctggacgaa ggcctgaaag tgctggcacg cgcagtacgt 1260 gaaaccgcgt aa 1272 <210> 17 <211> 513 <212> DNA <213> Artificial Sequence <400> 17 atggcagaca ttgaattccg tgctcctgtc gcaactgatg gtccggcagt taccgctctg 60 attgcagcgt gtccaccgct ggatcgtaac tcccgttact gtaacctgct gcagtgcgaa 120 catttcgccg atcattgcat cattgcggaa aaagctggtc gcatcgttgg ttgggtatcc 180 ggttatcgtc cgccgagcga cccgcatgca ttcttcgttt ggcaggttgc agttagctct 240 gaaggtcgtg gccgtcagct ggcatcccgt atgatcgctg acctgctgaa acgcccggct 300 caggatggtg tgacctacat gatcaccacc attactgcgg acaaccaagc ttcttggggt 360 ctgttccgtt ccctggctcg taaatgggac accgagctgg aacgtagcgc cctgttcgaa 420 cgcgaagctc atttcgcagg cgcacacgca accgaatatc tggcgcgcat tggcccgatc 480 gatcgtgata agattcacga aaaacagggt taa 513 <210> 18 <211> 417 <212> DNA <213> Artificial Sequence <400> 18 atgaaagtca tgcacctgga tgagctgaac ggtactgaaa acgatgtgga acacggcaac 60 tggcgctctc gtcgtttctt cctggcggat gaaggtgtgg gtttcagctt ccacgtcacc 120 gtactgaagg caggcacctc caccgacatg tggtacgcga atcacgttga atgcgtttac 180 gtgtatcagg gctccggcac cctggtaaac cgtgataccg gtgaagagca tgaactgcgt 240 ccgggtacca tgtatctgct gaacgactcc gacaaacaca ccctgattgc ggacgaagat 300 gttcactgta cctgcgtatt caacccgcct gttaccggcc gtgaagtgca cgatgagaac 360 ggcgtttacc cgctgctgga cgcggaaggt aatcgcctgg ataccccaaa agcataa 417

Claims

1. A method for constructing a recombinant bacterium for efficient conversion of glucose to produce tetrahydropyrimidine, characterized in that: The genes encoding diaminobutyric acid aminotransferase, diaminobutyric acid acetyltransferase and tetrahydropyrimidine synthetase are introduced into a recipient bacterium by a recombinant vector to obtain a recombinant bacterium for producing tetrahydropyrimidine; the recipient bacterium is a mutant Escherichia coli; The diaminobutyric acid aminotransferase gene encodes a protein with the amino acid sequence of SEQ ID No. 1; The diaminobutyric acid acetyltransferase gene encodes a protein with the amino acid sequence of SEQ ID No. 2; The tetrahydropyrimidine synthetase gene encodes a protein with the amino acid sequence of SEQ ID No. 3; The mutant Escherichia coli is a mutant of a wild-type Escherichia coli obtained by the following genetic modification of the wild-type Escherichia coli: knocking out or knocking down the pyruvate kinase II gene pykF knocking out or knocking down the pyruvate kinase I gene pykA knocking out or knocking down the pyruvate kinase I gene pykF encoding the protein as shown in amino acid sequence SEQ ID No. 4 pykA encoding the protein as shown in amino acid sequence SEQ ID No. 5 In addition, the following genetic modification is also performed on the mutant Escherichia coli: The diaminopimelic acid decarboxylase gene encoding a protein with the amino acid sequence of SEQ ID No. 8 is replaced by the glutamate dehydrogenase gene encoding a protein with the amino acid sequence of SEQ ID No. 9; and / or, the L-aspartate kinase / succinyl-CoA synthetase bifunctional enzyme I gene is truncated to obtain a mutant I gene encoding a protein with the amino acid sequence of SEQ ID No. 6 or the L-aspartate kinase / succinyl-CoA synthetase bifunctional enzyme II gene is truncated to obtain a mutant II gene encoding a protein with the amino acid sequence of SEQ ID No.

7. The recombinant vector contains the genes encoding diaminobutyric acid aminotransferase, diaminobutyric acid acetyltransferase and tetrahydropyrimidine synthetase; the promoter for initiating the transcription of the genes encoding diaminobutyric acid aminotransferase, diaminobutyric acid acetyltransferase and tetrahydropyrimidine synthetase in the recombinant vector is the ara promoter, and the terminator for terminating the transcription of the genes encoding diaminobutyric acid aminotransferase, diaminobutyric acid acetyltransferase and tetrahydropyrimidine synthetase is the rrnB terminator.

2. The method for constructing recombinant bacteria for efficient conversion of glucose to produce tetrahydropyrimidine according to claim 1, characterized in that: Xho 3. The method for constructing recombinant bacteria for efficient conversion of glucose to produce tetrahydropyrimidine according to claim 2, characterized in that: The recombinant vector is a DNA molecule with a nucleotide sequence of SEQ ID No. 16 replacing the vector pBADhisB Bgl I and Pst II between the recognition sites, a DNA molecule with a nucleotide sequence of SEQ ID No. 17 replacing the vector pBADhisB Kpn I and EcoR I between the recognition sites, and a DNA molecule with a nucleotide sequence of SEQ ID No. 18 replacing the vector pBADhisB Hind I and 4. A recombinant bacterium obtained by the construction method according to any one of claims 1 to 3. III between the recognition sites, and a DNA molecule with a nucleotide sequence of SEQ ID No. 19 replacing the vector pBADhisB 5. Use of the recombinant bacterium according to claim 4 in the direct fermentation production of tetrahydropyrimidine from glucose as a substrate. ​

Images