Multispecific single-domain antibody chimeric antigen receptors and t cell engagers and uses thereof

By developing a multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor, the limited efficacy of existing tumor immunotherapy in solid tumor treatment has been addressed, achieving specific targeting and effective killing of tumor cells, and significantly enhancing the therapeutic effect on solid tumors.

CN115677862BActive Publication Date: 2026-02-27EVER SUPREME BIO TECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210605526.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2021-07-21
Filing Date
2022-05-30
Publication Date
2026-02-27
Estimated Expiration
2042-05-30

AI Technical Summary

Technical Problem

Existing tumor immunotherapies such as CAR immune cells and BiTE have limited effectiveness in treating solid tumors. The selection of tumor-associated target proteins is crucial to the treatment effect, and how to improve their therapeutic effect in solid tumors is a question worthy of research.

Method used

A multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor were developed, comprising an HLA-G single-domain antibody chimeric antigen receptor and a bispecific T-cell adaptor, which can specifically recognize HLA-G and PD-L1 on the surface of tumor cells and activate T cells to enhance their killing ability against tumor cells by blocking immune checkpoint activation.

Benefits of technology

This multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor can effectively target tumor cells, avoid off-target effects, activate T cells and block immune checkpoints, significantly enhance the cytotoxic ability against tumor cells, and has excellent tumor cell-specific lysis ability and tumor growth inhibition effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115677862B_ABST
    Figure CN115677862B_ABST
Patent Text Reader

Abstract

The present application relates to a multispecific single-domain antibody chimeric antigen receptor and T cell engager, nucleic acid, expression cell thereof, use thereof, and pharmaceutical composition for treating cancer. The multispecific single-domain antibody chimeric antigen receptor and T cell engager comprises an HLA-G single-domain antibody chimeric antigen receptor and a bispecific T cell engager, wherein the HLA-G single-domain antibody chimeric antigen receptor comprises an HLA-G single-domain antibody unit, a transmembrane domain, and a CD3z signaling domain, and the bispecific T cell engager comprises a PD-L1 single-domain antibody unit and a CD3e single-domain antibody. The multispecific single-domain antibody chimeric antigen receptor and T cell engager can induce tumor cell death and has an excellent effect of inhibiting tumor growth, thereby being useful for preparing a medicament for inducing tumor cell death in a mammal and as a pharmaceutical composition for treating cancer.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a pharmaceutical product containing an antigen or an antibody, in particular a multispecific single-domain antibody chimeric antigen receptor and T cell engager, nucleic acid, expression cell thereof, pharmaceutical composition for treating cancer, and use of the multispecific single-domain antibody chimeric antigen receptor and T cell engager expression cell. BACKGROUND

[0002] Conventional tumor treatment methods include surgical treatment, radiation therapy, chemotherapy, and targeted therapy. Tumor immunotherapy is another method for treating tumors other than the above-mentioned treatment methods, which activates the patient's own immune system, induces specific cellular immunity and humoral immunity of the body using tumor cells or tumor antigen substances, enhances the body's anti-cancer ability, and prevents tumor growth, spread, and recurrence to achieve the purpose of eliminating or controlling tumors.

[0003] In recent years, the role of the immune system in treating cancer has been increasingly valued. Currently, the main tumor immunotherapy includes two categories. One is immune checkpoint blockade therapy, which restores the attack of T cells on tumor cells by blocking the activation of immune checkpoints. The other is chimeric antigen receptor (CAR), which improves the antigen recognition and killing ability of T cells by genetic modification. In addition, another new immunotherapy-bispecific T cell engager (BiTE) is also worth attention. BiTE is an antibody molecule composed of two single-chain variable domains (scFvs) of monoclonal antibodies, which has two molecular hooks that can specifically recognize the antigens on the surface of target cells and the CD3 molecules on the surface of T cells, thus activating T cells and recognizing cancer cells at the same time.

[0004] According to the presence of tumors, they can be divided into solid tumors and non-solid tumors. Solid tumors often have clear lumps in clinical practice, and mainly use comprehensive treatment dominated by surgery. Non-solid tumors are mostly hematological malignancies, which usually show no clear lumps and are mainly treated with chemotherapy. Currently, CAR immune cells and BiTE tumor immunotherapy used in clinical practice are more effective in treating hematological malignancies, but have limited effect on solid tumors. The selection of tumor-related target proteins is very critical to the treatment effect, and how to improve the treatment effect of CAR immune cells or BiTE in solid tumors is a problem worth studying. SUMMARY

[0005] The present application aims to provide a multispecific single-domain antibody chimeric antigen receptor and T cell engager, nucleic acid, multispecific single-domain antibody chimeric antigen receptor and T cell engager expression cell, use thereof, and a pharmaceutical composition for treating cancer. The multispecific single-domain antibody chimeric antigen receptor and T cell engager comprises an HLA-G single-domain antibody chimeric antigen receptor having excellent specific binding ability to tumor cells, and a bispecific T cell engager capable of specifically recognizing CD3 molecules on the surface of T cells and PD-L1 on the surface of tumor cells. The nucleic acid encodes the multispecific single-domain antibody chimeric antigen receptor and T cell engager. The multispecific single-domain antibody chimeric antigen receptor and T cell engager expression cell comprises the nucleic acid, which expresses the multispecific single-domain antibody chimeric antigen receptor and T cell engager, can specifically target tumor cells, avoid off-target effects, and simultaneously activate T cells and block immune checkpoint activation, thereby effectively killing tumor cells, and can be used for preparing a drug for inducing tumor cell death in mammals. The pharmaceutical composition for treating cancer comprises the multispecific single-domain antibody chimeric antigen receptor and T cell engager expression cell, which can effectively kill tumor cells and thereby treat cancer.

[0006] One embodiment of the present invention provides a multispecific single-domain antibody chimeric antigen receptor and a T-cell adaptor, which sequentially comprises an HLA-G single-domain antibody chimeric antigen receptor and a bispecific T-cell adaptor from the N-terminus to the C-terminus. The HLA-G single-domain antibody chimeric antigen receptor comprises an HLA-G single-domain antibody unit, a transmembrane domain, and a CD3z signaling domain. The HLA-G single-domain antibody unit specifically binds to human leukocyte antigen G (HLA-G), and the HLA-G single-domain antibody unit comprises at least one HLA-G single-domain antibody, and the amino acid sequence of the at least one HLA-G single-domain antibody is shown in SEQ ID NO:1 and / or SEQ ID NO:2. The amino acid sequence of the transmembrane domain is shown in SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, or SEQ ID NO:29, and the amino acid sequence of the CD3z signaling domain is shown in SEQ ID NO:25. A bispecific T-cell adaptor is attached to the C-terminus of an HLA-G single-domain antibody chimeric antigen receptor and comprises a PD-L1 single-domain antibody unit and a CD3e single-domain antibody. The PD-L1 single-domain antibody unit specifically binds to programmed death-ligand 1 (PD-L1), and the PD-L1 single-domain antibody unit comprises at least one PD-L1 single-domain antibody, the amino acid sequence of which is shown in SEQ ID NO:5 and / or SEQ ID NO:6. The CD3e single-domain antibody specifically binds to the CD3e molecule, and the amino acid sequence of which is shown in SEQ ID NO:9.

[0007] Based on the aforementioned multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor, it may further include a first signal peptide, which is linked to the N-terminus of the HLA-G single-domain antibody chimeric antigen receptor, and the amino acid sequence of the first signal peptide is shown in SEQ ID NO:11.

[0008] Based on the aforementioned multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor, it may further include a CD8 hinge region, which connects the HLA-G single-domain antibody unit and the transmembrane domain.

[0009] Based on the aforementioned multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor, it may further include a P2A peptide, which is tandemly linked to the HLA-G single-domain antibody chimeric antigen receptor and the bispecific T-cell adaptor.

[0010] Based on the aforementioned multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor, it may further include a second signal peptide, which is linked to the N-terminus of the bispecific T-cell adaptor, and the amino acid sequence of the second signal peptide is shown in SEQ ID NO:15.

[0011] According to the foregoing multispecific single-domain antibody chimeric antigen receptors and T cell engagers, the HLA-G single-domain antibody unit can block the interaction of and / or binding to HLA-G with a HLA-G receptor.

[0012] According to the foregoing multispecific single-domain antibody chimeric antigen receptors and T cell engagers, the HLA-G receptor can be KIR2DL4 and / or LILRB1.

[0013] According to the foregoing multispecific single-domain antibody chimeric antigen receptors and T cell engagers, the PD-L1 single-domain antibody unit can block the interaction of and / or binding to PD-L1 with a PD-L1 receptor.

[0014] According to the foregoing multispecific single-domain antibody chimeric antigen receptors and T cell engagers, the PD-L1 receptor can be programmed cell death protein-1 (PD-1).

[0015] According to the foregoing multispecific single-domain antibody chimeric antigen receptors and T cell engagers, the CD3e single-domain antibody can activate and / or recruit T cells.

[0016] Another embodiment of one aspect of the present application provides a nucleic acid encoding the multispecific single-domain antibody chimeric antigen receptor and T cell engager as recited in the preceding paragraph, wherein the nucleic acid comprises, in order from 5' to 3', a HLA-G single-domain antibody chimeric antigen receptor-encoding segment and a bispecific T cell engager-encoding segment. The HLA-G single-domain antibody chimeric antigen receptor-encoding segment comprises a HLA-G single-domain antibody unit-encoding segment, a transmembrane domain-encoding segment, and a CD3z signaling domain-encoding segment. The HLA-G single-domain antibody unit-encoding segment comprises at least one HLA-G single-domain antibody-encoding segment, and the nucleotide sequence of the at least one HLA-G single-domain antibody-encoding segment is set forth in SEQ ID NO: 3 and / or SEQ ID NO: 4. The nucleotide sequence of the transmembrane domain-encoding segment is set forth in SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, or SEQ ID NO: 30, and the nucleotide sequence of the CD3z signaling domain-encoding segment is set forth in SEQ ID NO: 26. The bispecific T cell engager-encoding segment is linked to the 3' end of the HLA-G single-domain antibody chimeric antigen receptor-encoding segment, and comprises a PD-L1 single-domain antibody unit-encoding segment and a CD3e single-domain antibody-encoding segment. The PD-L1 single-domain antibody unit-encoding segment comprises at least one PD-L1 single-domain antibody-encoding segment, and the nucleotide sequence of the at least one PD-L1 single-domain antibody-encoding segment is set forth in SEQ ID NO: 7 and / or SEQ ID NO: 8. The nucleotide sequence of the CD3e single-domain antibody-encoding segment is set forth in SEQ ID NO: 10.

[0017] Another embodiment of one aspect of the present application provides a multispecific single-domain antibody chimeric antigen receptor and T cell engager-expressing cell, comprising an immune cell and the nucleic acid as recited in the preceding paragraph, wherein the multispecific single-domain antibody chimeric antigen receptor and T cell engager-expressing cell is obtained by transfecting the nucleic acid into the immune cell.

[0018] The multispecific single-domain antibody chimeric antigen receptor and T cell engager-expressing cell according to the preceding paragraph, wherein the immune cell can be a natural killer cell or a γδ T cell.

[0019] Another embodiment of one aspect of the present application provides a pharmaceutical composition for treating cancer, comprising the multispecific single-domain antibody chimeric antigen receptor and T cell engager-expressing cell as recited in the preceding paragraph and a pharmaceutically acceptable carrier.

[0020] An embodiment of another aspect of the present application provides use of the multispecific single-domain antibody chimeric antigen receptor and T cell engager-expressing cell as recited in the preceding paragraph for the manufacture of a medicament for inducing tumor cell death in a mammal.

[0021] The above summary of the application is intended to provide a simplified summary of the disclosure to give the reader a basic understanding of the disclosure. This summary of the application is not an extensive overview of the disclosure, and is not intended to identify key / critical elements of the application or to delineate the scope of the application. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to make the above and other purposes, features, advantages and embodiments of the application more apparent, the drawings are described as follows:

[0023] Figure 1 is a schematic diagram illustrating the structure and mechanism of the multispecific single-domain antibody chimeric antigen receptor and T cell linker of the application;

[0024] Figure 2A and Figure 2B is a schematic diagram illustrating the construction of the nucleic acid of the application;

[0025] Figure 3A and Figure 3B is a graph of the analysis results of the binding affinity of the HLA-G single-domain antibody of the application;

[0026] Figure 4 is a graph of the analysis results of the LILRB1 blocking activity of the HLA-G single-domain antibody of the application;

[0027] Figure 5 is a graph of the analysis results of the KIR2DL4 blocking activity of the HLA-G single-domain antibody of the application;

[0028] Figure 6A and Figure 6B is a graph of the analysis results of the effect of the HLA-G single-domain antibody of the application on enhancing natural killer (NK) cell-mediated cytotoxicity against MDA-MB-231 cells;

[0029] Figure 7 is a graph of the analysis results of the PD-L1 / PD-1 biological blocking activity of the PD-L1 single-domain antibody of the application;

[0030] Figure 8A and Figure 8B is a graph of the analysis results of the binding affinity of the PD-L1 single-domain antibody of the application;

[0031] Figure 9 is a graph of the analysis results of the effect of the PD-L1 single-domain antibody of the application on enhancing γδT cell-mediated cytotoxicity against MDA-MB-231 cells;

[0032] Figure 10 is a graph of the analysis results of the effect of the CD3e single-domain antibody of the application on CD3 +Figure showing the results of the analysis on the effect of T cell proliferation;

[0033] Figure 11 The diagram illustrates the construction of the nucleic acid of the present invention and the nucleic acid of the comparative examples;

[0034] Figure 12A and Figure 12B The figure shows the analysis results of the multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor expression cells expressing HLA-G single-domain antibody chimeric antigen receptor according to the present invention;

[0035] Figure 13A , Figure 13B , Figure 14A , Figure 14B , Figure 15A , Figure 15B , Figure 16A , Figure 16B and Figure 17 This is a diagram showing the analysis results of the specific lysis of tumor cells by multispecific single-domain antibody chimeric antigen receptor and T cell adaptor expression cells in Example 4 of the present invention.

[0036] Figure 18 The diagram illustrates the mechanism of action of the multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor expressed by cells secreting the multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor according to the present invention.

[0037] Figure 19 This is a diagram showing the analysis results of the multispecific single-domain antibody chimeric antigen receptor and T cell adaptor expression cells secreting bispecific T cell adaptors according to the present invention;

[0038] Figure 20A , Figure 20B and Figure 20C The figure shows the results of the analysis of the effect of conditioned medium enhancing PBMC-induced cytotoxicity on glioblastoma cells of the present invention, which is based on the multispecific single-domain antibody chimeric antigen receptor and T cell adaptor expression cells.

[0039] Figure 21A The diagram illustrates the strategy for animal therapeutic trials of the multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor expression cells of the present invention; and

[0040] Figure 21B , Figure 21C and Figure 21D This figure shows the analysis results of the effect of multispecific single-domain antibody chimeric antigen receptor and T cell adaptor expression cells on tumor growth inhibition in tumor mice.

Detailed Implementation Methods

[0041] The present disclosure provides a multispecific single domain antibody chimeric antigen receptor and T cell engager, a nucleic acid encoding the multispecific single domain antibody chimeric antigen receptor and T cell engager, a multispecific single domain antibody chimeric antigen receptor and T cell engager expression cell comprising the nucleic acid, uses thereof, and a pharmaceutical composition for treating cancer comprising the multispecific single domain antibody chimeric antigen receptor and T cell engager expression cell. The present disclosure demonstrates that the multispecific single domain antibody chimeric antigen receptor and T cell engager of the present disclosure can enhance the cytotoxicity of immune cells against tumor cells in cell experiments of tumor cells, and thus the multispecific single domain antibody chimeric antigen receptor and T cell engager expression cell expressing the multispecific single domain antibody chimeric antigen receptor and T cell engager of the present disclosure has excellent specific lysis ability against tumor cells. The present disclosure also demonstrates that the multispecific single domain antibody chimeric antigen receptor and T cell engager expression cell of the present disclosure has excellent tumor growth inhibition effect in animal experiments, and thus can be used for preparing a medicament for inducing tumor cell death in mammals. The pharmaceutical composition for treating cancer of the present disclosure comprising the multispecific single domain antibody chimeric antigen receptor and T cell engager expression cell of the present disclosure can effectively kill tumor cells and thus treat cancer.

[0042] The "single domain antibody (sdAb)" described in the present disclosure refers to a type of antibody that lacks the light chain of an antibody and only has the variable region of the heavy chain. Because a complete antibody comprises two immunoglobulin light chains and two heavy chains, the molecular weight of a complete antibody is about 150-160 kDa. In contrast, the molecular weight of a single domain antibody is only about 12-15 kDa. Because the molecular weight of a single domain antibody is small, it is also called a nanobody. Although the structure of a single domain antibody is simple, it can still achieve a specific antigen binding affinity comparable to or even higher than that of a complete antibody.

[0043] The "human leukocyte antigen G (HLA-G)" described in the present disclosure is encoded by the HLA-G gene and is a non-canonical class I major histocompatibility complex (MHC) with a heavy chain of about 45 kDa. HLA-G is expressed on placental cells of fetal origin and is very active in the negative regulation of immune responses, and its main role is to inhibit the function of cytotoxic immune cells.

[0044] The "programmed death-ligand 1 (PD-L1)" described in the specification is a type I transmembrane protein with a size of 40 kDa, which is encoded by the CD274 gene, and the PD-L1 can bind to its receptor-programmed cell death protein-1 (PD-1). Current research has found that the increased expression of PD-L1 on the surface of tumor cells can bind to PD-1 on immune cells, inhibit the function of host immune cells, and cause apoptosis, thereby allowing tumor cells to escape immune surveillance.

[0045] The "CD3e molecule (also known as CD3E)" described in the specification is a type I transmembrane protein on the surface of T cells, which is encoded by the CD3E gene, and the CD3e molecule plays an important role in T cell development. The CD3e molecule forms a T cell receptor-CD3 complex with CD3γ, CD3δ, and CD3ζ, as well as T cell receptor α / β and γ / δ heterodimers. The CD3 complex plays an important role in coupling antigen recognition to several intracellular signal transduction pathways.

[0046] The following specific test examples are further illustrated to demonstrate the present application, which are used to facilitate those skilled in the art to fully utilize and practice the present application without excessive interpretation, and should not be considered as limiting the scope of the present application, but for the materials and methods for illustrating how to implement the present application.

[0047] I. Multispecific single-domain antibody chimeric antigen receptor and T cell engager and nucleic acid

[0048] 1.1. Multispecific single-domain antibody chimeric antigen receptor and T cell engager

[0049] Please refer to Figure 1 , which shows the structure and mechanism of the multispecific single-domain antibody chimeric antigen receptor and T cell engager of the present application. The multispecific single-domain antibody chimeric antigen receptor and T cell engager of the present application comprises, in order from N-terminus to C-terminus, an HLA-G single-domain antibody chimeric antigen receptor and a bispecific T cell engager.

[0050] The HLA-G single-domain antibody chimeric antigen receptor comprises an HLA-G single-domain antibody unit, a transmembrane domain, and a CD3z signaling domain. The HLA-G single-domain antibody unit specifically binds to HLA-G, and the HLA-G single-domain antibody unit comprises at least one HLA-G single-domain antibody, and the amino acid sequence of the at least one HLA-G single-domain antibody is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. The amino acid sequence of the transmembrane domain is shown in SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, or SEQ ID NO: 29, and the amino acid sequence of the CD3z signaling domain is shown in SEQ ID NO: 25. The HLA-G single-domain antibody chimeric antigen receptor can form a tumor-targeting receptor complex, so that the multispecific single-domain antibody chimeric antigen receptor and T cell engager of the present application bind to the specifically recognized human leukocyte antigen G on the surface of tumor cells, triggering signal transduction, producing a signal cascade, leading to the activation and proliferation of the cells expressing the multispecific single-domain antibody chimeric antigen receptor and T cell engager of the present application, and then triggering lysosomal exocytosis and killing of the target tumor cells.

[0051] The HLA-G single-domain antibody chimeric antigen receptor can further comprise a first signal peptide at the N-terminus, and the amino acid sequence of the first signal peptide is shown in SEQ ID NO: 11. The HLA-G single-domain antibody chimeric antigen receptor can further comprise a CD8 hinge region, which is connected to the HLA-G single-domain antibody unit and the transmembrane domain, and the amino acid sequence of the CD8 hinge region is shown in SEQ ID NO: 17.

[0052] The bispecific T cell engager is connected to the C-terminus of the HLA-G single-domain antibody chimeric antigen receptor, and comprises a PD-L1 single-domain antibody unit and a CD3e single-domain antibody. The PD-L1 single-domain antibody unit specifically binds to PD-L1, and the PD-L1 single-domain antibody unit comprises at least one PD-L1 single-domain antibody, and the amino acid sequence of the at least one PD-L1 single-domain antibody is shown in SEQ ID NO: 5 and / or SEQ ID NO: 6. The CD3e single-domain antibody specifically binds to a CD3e molecule, and the amino acid sequence of the CD3e single-domain antibody is shown in SEQ ID NO: 9.

[0053] A second signal peptide having an amino acid sequence as set forth in SEQ ID NO: 15 can be further included at the N-terminus of the bispecific T-cell engager. In addition, the multispecific single-domain antibody chimeric antigen receptor and T-cell engager of the present application can further comprise a P2A peptide which is concatenated to the HLA-G single-domain antibody chimeric antigen receptor and the bispecific T-cell engager, and the P2A peptide has an amino acid sequence as set forth in SEQ ID NO: 27. The P2A peptide can enable the expressed multispecific single-domain antibody chimeric antigen receptor and T-cell engager to perform self-cleavage at the HLA-G single-domain antibody chimeric antigen receptor and the bispecific T-cell engager, thereby cleaving the bispecific T-cell engager and secreting it outside the cell.

[0054] 1.2. Nucleic acid

[0055] The nucleic acid of the present application, which encodes the multispecific single-domain antibody chimeric antigen receptor and T-cell engager as described in the preceding paragraph, comprises, in order from the 5' end to the 3' end, a fragment encoding the HLA-G single-domain antibody chimeric antigen receptor and a fragment encoding the bispecific T-cell engager.

[0056] The fragment encoding the HLA-G single-domain antibody chimeric antigen receptor comprises a fragment encoding the HLA-G single-domain antibody unit, a fragment encoding the transmembrane domain, and a fragment encoding the CD3z signaling domain. The fragment encoding the HLA-G single-domain antibody unit comprises at least one HLA-G single-domain antibody-encoding fragment, and the nucleotide sequence of the at least one HLA-G single-domain antibody-encoding fragment is as set forth in SEQ ID NO: 3 and / or SEQ ID NO: 4. The nucleotide sequence of the fragment encoding the transmembrane domain is as set forth in SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, or SEQ ID NO: 30, and the nucleotide sequence of the fragment encoding the CD3z signaling domain is as set forth in SEQ ID NO: 26.

[0057] A first signal peptide-encoding fragment having a nucleotide sequence as set forth in SEQ ID NO: 12 can be further included at the 5' end of the fragment encoding the HLA-G single-domain antibody chimeric antigen receptor. In addition, the fragment encoding the HLA-G single-domain antibody chimeric antigen receptor can further comprise a CD8 hinge region-encoding fragment which is concatenated to the fragment encoding the HLA-G single-domain antibody unit and the fragment encoding the transmembrane domain, and the nucleotide sequence of the CD8 hinge region-encoding fragment is as set forth in SEQ ID NO: 18.

[0058] The nucleic acid of the present application comprises a nucleotide sequence encoding a bispecific T-cell engager fragment linked to the 3' end of a nucleotide sequence encoding a HLA-G single domain antibody chimeric antigen receptor fragment, and comprises a nucleotide sequence encoding a PD-L1 single domain antibody unit fragment and a nucleotide sequence encoding a CD3e single domain antibody fragment. The nucleotide sequence encoding the PD-L1 single domain antibody unit fragment comprises at least one nucleotide sequence encoding a PD-L1 single domain antibody fragment, and the nucleotide sequence of the at least one nucleotide sequence encoding a PD-L1 single domain antibody fragment is shown in SEQ ID NO: 7 and / or SEQ ID NO: 8. The nucleotide sequence encoding the CD3e single domain antibody fragment is shown in SEQ ID NO: 10.

[0059] The nucleotide sequence encoding the bispecific T-cell engager fragment can further comprise a nucleotide sequence encoding a second signal peptide fragment, and the nucleotide sequence of the second signal peptide fragment is shown in SEQ ID NO: 16. The nucleic acid of the present application can further comprise a nucleotide sequence encoding a P2A peptide fragment, which is concatenated to the nucleotide sequence encoding the HLA-G single domain antibody chimeric antigen receptor fragment and the nucleotide sequence encoding the bispecific T-cell engager fragment, and the nucleotide sequence encoding the P2A peptide fragment is shown in SEQ ID NO: 28.

[0060] Please refer to Figure 2A and Figure 2B , Figure 2A The schematic diagram of the construction of the nucleic acid of Example 1 of the present application is shown in FIG. 1, which is constructed by using in vitro transcription (IVT) mRNA technology. Figure 2B The schematic diagram of the construction of the nucleic acid of Example 2 of the present application is shown in FIG. 2, which is constructed by using a lentiviral vector. In the present application, the protein encoded by the nucleic acid is shown in Figure 2A and Figure 2B

[0061] ​The nucleotide sequence encoding the first signal peptide fragment is shown in SEQ ID NO: 12, the nucleotide sequence encoding the HLA-G single-domain antibody unit fragment comprises two HLA-G single-domain antibody fragments, the nucleotide sequences of which are shown in SEQ ID NO: 3 (HLA-G Nb#1) and SEQ ID NO: 4 (HLA-G Nb#109), respectively, the nucleotide sequence encoding the 4-1BB / TYK fragment is shown in SEQ ID NO: 30, and the nucleotide sequence encoding the CD3z signaling domain fragment is shown in SEQ ID NO: 26. The nucleotide sequence encoding the second signal peptide fragment is shown in SEQ ID NO: 16, the nucleotide sequence encoding the PD-L1 single-domain antibody unit fragment comprises two PD-L1 single-domain antibody fragments, the nucleotide sequences of which are shown in SEQ ID NO: 8 (PD-L1 Nb#15) and SEQ ID NO: 7 (PD-L1 Nb#3), respectively, and the nucleotide sequence encoding the CD3e single-domain antibody fragment is shown in SEQ ID NO: 10. The nucleotide sequence of the G-S linker in Example 1 and Example 2 is shown in SEQ ID NO: 14. In addition, the nucleic acid of the present application can select a promoter at the 5' end according to the system to be constructed. In the nucleic acid of Example 1, the promoter can be a T7 promoter, and in the nucleic acid of Example 2, the promoter can be an EF-1a promoter.

[0062] 1.3. HLA-G single-domain antibody

[0063] The HLA-G single-domain antibody was first prepared, and then the kinetic analysis and the binding affinity analysis with the HLA-G recombinant protein (Origene, CAT#: TP305216) were performed by surface plasmon resonance (SPR) analysis. The HLA-G single-domain antibody prepared in this test example comprises the HLA-G single-domain antibody shown in SEQ ID NO: 1 (HLA-G Nb#1) and SEQ ID NO: 2 (HLA-G Nb#109).

[0064] Please refer to Figure 3A , Figure 3B and Table 1 below, Figure 3A is a graph of the analysis results of the binding affinity of HLA-G Nb#1, Figure 3B is a graph of the analysis results of the binding affinity of HLA-G Nb#109, and Table 1 is the kinetic analysis results of HLA-G Nb#1 (abbreviated as #1 in the table) and HLA-G Nb#109 (abbreviated as #109 in the table).

[0065] Table 1

[0066]

[0067] By Figure 3A , Figure 3B and the results of Table 1 show that the HLA-G single domain antibodies of the present application have excellent binding affinity to HLA-G, wherein the K D of HLA-G Nb#1 can reach 0.11 nM, and the K D of HLA-G Nb#109 can reach 2.6 nM.

[0068] To further test whether the HLA-G single domain antibodies of the present application can block the interaction and / or binding of HLA-G with HLA-G receptors, KIR2DL4 and LILRB1 were tested, and the HLA-G single domain antibody used was HLA-G Nb#1, and whether HLA-G Nb#1 can block the interaction and / or binding of biotinylated KIR2DL4 (SinoBiological, CAT#: 13052-H02S) and biotinylated LILRB1 (Sino Biological, CAT#: 16014-H08H) with HLA-G recombinant protein (Origene, CAT#: TP305216) was tested by competitive ELISA. Commercially available HLA-G monoclonal antibody (87G, Thermo Fisher) was also included in the test as a control group.

[0069] Please refer to Figure 4 and Figure 5 , Figure 4 Figure 2 is a graph showing the analysis results of LILRB1 blocking activity of the HLA-G single domain antibodies of the present application, Figure 5 Figure 3 is a graph showing the analysis results of KIR2DL4 blocking activity of the HLA-G single domain antibodies of the present application. Figure 4 The results of Figure 2 show that the IC 50 of 87G for LILRB1 blocking activity is greater than 1 μM, while the IC 50 of HLA-G Nb#1 for LILRB1 blocking activity is about 70 nM. Figure 5 The results of Figure 3 show that the IC 50 of 87G for KIR2DL4 blocking activity is about 104 nM, while the IC 50 of HLA-G Nb#1 for KIR2DL4 blocking activity is about 22 nM. The above results show that the HLA-G single domain antibodies of the present application have excellent ability to block the interaction and / or binding of HLA-G with LILRB1 / KIR2DL4.

[0070] The effect of the HLA-G single-domain antibody of the present application on enhancing natural killer (NK) cell-mediated cytotoxicity against tumor cells was also tested. In this test, the tumor cells tested were MDA-MB-231 cells, and the HLA-G single-domain antibodies tested were HLA-G Nb#1 and HLA-G Nb#109. In the test, MDA-MB-231 cells with a cell density of 1 x 10 5 cells / well were seeded in a 12-well plate, and after incubation overnight, 3 x 10 5 cells / well or 5 x 10 5 cells / well of primary NK cells were added to the wells containing the MDA-MB-231 cells, and 1 mg / ml of HLA-G Nb#1 and / or HLA-G Nb#109 or 10 mg / ml of 87G were added, respectively. After 48 hours, the specific lysis of the primary NK cells against the MDA-MB-231 cells was determined by flow cytometry using LIVE / DEAD cell-mediated cytotoxicity assay.

[0071] Please refer to Figure 6A and Figure 6B , which are graphs showing the results of the analysis of the effect of the HLA-G single-domain antibody of the present application on enhancing natural killer (NK) cell-mediated cytotoxicity against MDA-MB-231 cells. In Figure 6B , * indicates p < 0.05, and ** indicates p < 0.01. Figure 6A The results show that the HLA-G single-domain antibody of the present application can enhance the specific lysis of the primary NK cells against the MDA-MB-231 cells when compared with the untreated group, and the group treated with both HLA-G Nb#1 and HLA-G Nb#109 can further enhance the specific lysis of the primary NK cells against the MDA-MB-231 cells. Figure 6B The results show that the HLA-G single-domain antibody of the present application can enhance the specific lysis of the primary NK cells against the MDA-MB-231 cells when compared with the untreated group, and the group treated with both HLA-G Nb#1 and HLA-G Nb#109 can further enhance the specific lysis of the primary NK cells against the MDA-MB-231 cells.

[0072] 1.4. PD-L1 single-domain antibody

[0073] The PD-L1 single-domain antibodies were first prepared and then tested whether the PD-L1 single-domain antibodies of the present application can block the interaction and / or binding of PD-L1 with PD-L1 receptor. The PD-L1 single-domain antibodies prepared in this test example include the PD-L1 single-domain antibodies shown in SEQ ID NO: 5 (PD-L1 Nb#3) and SEQ ID NO: 6 (PD-L1 Nb#15).

[0074] The blocking test was performed using PD-1 / PD-L1 Blockade Bioassay Kit (Promega). The PD-L1 single-domain antibodies used in the test were PD-L1 Nb#3 and PD-L1 Nb#15, and the PD-L1 receptor tested was PD-1. The PD-L1 aAPC / CHO-K1 cells with a cell density of 1 x 10 4 cells / well were seeded in a 96-well plate, and after incubation overnight, 1 x 10 4 cells / well of PD-1 effector cells were added to the wells containing the PD-L1 aAPC / CHO-K1 cells, and then different concentrations of PD-L1 Nb#3, PD-L1 Nb#15 or atezolizumab were added, respectively. After 6 hours, Bio-Glo TM reagent was added and the luminescence was measured using Glo Discover system. The data were plotted as 4PL curves using Sigmaplot software. Atezolizumab, a commercially available PD-L1 monoclonal antibody, was used as a control group.

[0075] Please refer to Figure 7 , which are the analysis results of the PD-L1 / PD-1 biological blocking activity of the PD-L1 single-domain antibodies of the present application. The results show that the IC 50 of atezolizumab for PD-1 blocking activity is about 41 nM, the IC 50 of PD-L1 Nb#15 for PD-1 blocking activity is about 0.48 nM, and the IC 50 of PD-L1 Nb#3 for PD-1 blocking activity is about 37.7 nM. It shows that the PD-L1 single-domain antibodies of the present application have excellent ability to block the interaction and binding of PD-L1 with PD-1.

[0076] The kinetic analysis of the PD-L1 single-domain antibodies of the present application and the binding affinity analysis of the PD-L1 single-domain antibodies of the present application with PD-L1 recombinant protein (Sino Biological, CAT#: 10084-H05H) were further performed by SPR analysis. Please refer to Figure 8A , Figure 8B and Table 2 below, which are the analysis results of the binding affinity of the PD-L1 single-domain antibodies of the present application.Figure 8A Figure 2 is a graph showing the analysis results of the binding affinity of PD-L1 Nb#15, Figure 8B Figure 3 is a graph showing the analysis results of the binding affinity of PD-L1 Nb#3, and Table 2 shows the kinetic analysis results of PD-L1 Nb#15 (referred to as #15 in the table) and PD-L1 Nb#3 (referred to as #3 in the table).

[0077] Table 2

[0078] K on (1 / Ms)]]> K off (1 / s) K D (nM) [R max (RU)]]> Chi 2 ]]> #15 1.03E+6 9.361E-4 0.91 317.3 33.0 #3 6.045E+6 5.21E-3 0.86 331.9 7.65

[0079] From the results of Figure 8A , Figure 8B and Table 2, it can be seen that the PD-L1 single-domain antibody of the present application has excellent binding affinity to PD-L1, wherein the K D of PD-L1 Nb#15 can reach 0.91 nM, and the K D of PD-L1 Nb#3 can reach 0.86 nM.

[0080] In addition, the effect of the PD-L1 single-domain antibody of the present application on enhancing the cytotoxicity of γδ T cells to tumor cells was also tested. In this test, the tumor cells tested were MDA-MB-231 cells, and the PD-L1 single-domain antibodies tested were PD-L1 Nb#15 and PD-L1 Nb#3. In the test, MDA-MB-231 cells with a cell density of 1 × 10 5 cells / well were inoculated in a 12-well plate, and after being cultured overnight, 3 × 10 5 cells / well of primary γδ T cells were added to the wells containing MDA-MB-231 cells, and then 1 mg / ml of PD-L1 Nb#15 or PD-L1 Nb#3, or 10 mg / ml of atezolizumab was added, respectively. After 48 hours, the specific lysis of primary γδ T cells to MDA-MB-231 cells was determined by flow cytometry for LIVE / DEAD cell-mediated cytotoxicity assay.

[0081] Please refer to Figure 9 Figure 4 is a graph showing the analysis results of the effect of the PD-L1 single-domain antibody of the present application on enhancing the cytotoxicity of γδ T cells to MDA-MB-231 cells, wherein * indicates p < 0.05. The results show that compared with the untreated group, the group treated with PD-L1 Nb#15 or PD-L1 Nb#3 has a statistically significant difference (p < 0.05) in the specific lysis of primary γδ T cells to MDA-MB-231 cells, and compared with atezolizumab, the PD-L1 single-domain antibody of the present application can enhance the specific lysis of primary γδ T cells to MDA-MB-231 cells more under the same antibody concentration.

[0082] 1.5.CD3e single domain antibody

[0083] The CD3e single domain antibody of the present application was first prepared and then tested for its effect on CD3 + T cell proliferation in peripheral blood mononuclear cells (PBMC) and γδ T cells. The amino acid sequence of the CD3e single domain antibody prepared in this test example is shown in SEQ ID NO: 9 (CD3eNb). A 12-well plate was first prepared by coating 1 mg / ml of CD3eNb, 10 mg / ml of OKT3 (Invitrogen, CAT#: MA1-10175), a commercially available CD3 monoclonal antibody, or left untreated. Then, 1 x 105PBMC or γδ T cells per well were inoculated into the 12-well plate, and 50 IU / ml of IL-2 (Gibco, CAT#: PHC0021) and 2 mg / ml of IL-15 (Sino Biological, CAT#: 10360-H07E) were added to each well. After 7 days, the total number of cells was recorded, and staining was performed using FITC-conjugated OKT3 (eBioscience, CAT#: 11-0037-42), and the number of CD3-positive T cells (CD3 6 T cells) was calculated by flow cytometry analysis, and the number of CD3-positive T cells (CD3 + T cells) was calculated by flow cytometry analysis, and the number of CD3-positive T cells (CD3 + T cells) was calculated by flow cytometry analysis, and the number of CD3-positive T cells (CD3

[0084] Please refer to Figure 10 the analysis results of the effect of the CD3e single domain antibody of the present application on CD3 + T cell proliferation in PBMC and γδ T cells, in which * indicates p < 0.05, ** indicates p < 0.01, and *** indicates p < 0.001. The results show that in the PBMC part, both the CD3e single domain antibody of the present application and OKT3 can enhance the proliferation of CD3 + T cells in PBMC, but the CD3e single domain antibody of the present application has a statistically significant effect on enhancing the proliferation of CD3 + T cells in PBMC compared with the untreated group or the OKT3-treated group (p < 0.001 and p < 0.05, respectively). In the γδ T cell part, both the CD3e single domain antibody of the present application and OKT3 can enhance the proliferation of CD3 +The proliferation of T cells and the difference are statistically significant (p<0.001 and p<0.01, respectively), and the CD3e single-domain antibody of the present application has a more significant enhancement effect compared with the OKT3 treatment group. In summary, the CD3e single-domain antibody of the present application has an excellent effect of enhancing the CD3 + The ability of T cell proliferation.

[0085] Second, the multispecific single-domain antibody chimeric antigen receptor and T cell linker expression cell of the present application, its use, and the pharmaceutical composition for treating cancer

[0086] Please refer to Figure 11 , which illustrates the construction of the nucleic acid of the embodiment of the present application and the nucleic acid of the comparative example, wherein the marks are the proteins after coding. The nucleic acid of Example 1 (hereinafter referred to as Example 1) is constructed by using IVT mRNA technology, and the nucleic acid of Example 2 (hereinafter referred to as Example 2) is constructed by using a lentiviral vector. The construction details are as described above and will not be repeated here. The nucleic acid of Comparative Example 1 is an HLA-G single-domain antibody chimeric antigen receptor constructed by using IVT mRNA technology, which does not contain a bispecific T cell linker targeting PD-L1 and CD3e. The coding first signal peptide fragment in the nucleic acid of Comparative Example 1 is the coding CD8a signal peptide fragment shown in SEQ ID NO: 12, the coding HLA-G single-domain antibody unit fragment contains two coding HLA-G single-domain antibody fragments, the nucleotide sequences of which are shown in SEQ ID NO: 3 (HLA-G Nb#1) and SEQ ID NO: 4 (HLA-G Nb#109), respectively, the coding transmembrane domain fragment is the coding 4-1BB / TYK fragment shown in SEQ ID NO: 30, and the nucleotide sequence of the coding CD3z information transmission domain fragment is shown in SEQ ID NO: 26.

[0087] In the experiment, 2 μg of the nucleic acid of Example 1 or the nucleic acid of Comparative Example 1 was electroporated into 1×10 6 γδT cells to obtain the multispecific single-domain antibody chimeric antigen receptor and T cell linker expression cell of Example 3 (hereinafter referred to as Example 3) and the HLA-G single-domain antibody chimeric antigen receptor expression cell of Comparative Example 2 (hereinafter referred to as Comparative Example 2). In addition, the nucleic acid of Example 2 was transduced into γδT cells by using a lentivirus to obtain the multispecific single-domain antibody chimeric antigen receptor and T cell linker expression cell of Example 4 (hereinafter referred to as Example 4). Then, 1×10 6Comparative Example 2, Example 3, Example 4 and the parental γδ T cells (hereinafter referred to as the parental cells) were stained with an anti-VHH antibody conjugated with iFluor 647 (GenScript). After washing twice with PBS containing 1% BSA, the expression of the HLA-G single-domain antibody chimeric antigen receptor of Comparative Example 2, Example 3 and Example 4 was determined by flow cytometry using the parental cells as a background control every day from day 1 to day 7 to determine the transduction rate of Example 1 and Example 2 in the γδ T cells.

[0088] The pharmaceutical composition for treating cancer of the present application comprises the multispecific single-domain antibody chimeric antigen receptor and T cell engager expressing cells of the present application. Preferably, the pharmaceutical composition for treating cancer can further comprise another cancer treatment agent, such as a chemotherapeutic drug, a targeted therapy drug, an antibody drug, an immunomodulator or a combination thereof.

[0089] Please refer to Figure 12A and Figure 12B for the analysis results of the expression of the HLA-G single-domain antibody chimeric antigen receptor of Comparative Example 2, Example 3 and Example 4, wherein Figure 12A is the analysis results from day 1 to day 4, Figure 12B is the analysis results from day 5 to day 7. Figure 12A and Figure 12B The results show that the expression of the HLA-G single-domain antibody chimeric antigen receptor of Comparative Example 2 is the highest on day 1, reaching 59.8%, but the expression decreases day by day, and the expression on day 7 is only 13.5%. The expression of the HLA-G single-domain antibody chimeric antigen receptor of Example 3 is also the highest on day 1, reaching 56.1%, and the expression also decreases day by day, but the expression on day 7 is still 26.1%. The HLA-G single-domain antibody chimeric antigen receptor of Example 4 only has 10.3% on day 1, but increases day by day to reach the highest expression of 74% on day 6, and decreases to 54.8% on day 7. The above results show that the multispecific single-domain antibody chimeric antigen receptor and T cell engager expressing cells of the present application can stably express the HLA-G single-domain antibody chimeric antigen receptor transduced therein.

[0090] The multispecific single-domain antibody chimeric antigen receptor and T cell engager expressing cells of the present application were further tested for their cytotoxicity against tumor cells in vitro. The multispecific single-domain antibody chimeric antigen receptor and T cell engager expressing cells used in this experiment were Example 4, and the cells tested included triple-negative breast cancer (TNBC) cells, glioblastoma multiforme cells, lung cancer cells, ovarian cancer cells, and pancreatic cancer cells, wherein the TNBC cells included MDA-MB-231 cells and MDA-MB-231 HLA-Gov cells, the glioblastoma multiforme cells included GBM-8901 cells and DBTRG-05MG cells, the lung cancer cells included A549 cells and H1975 cells, the ovarian cancer cells included SKOV3 cells and SKOV3 HLA-Gov cells, and the pancreatic cancer cells were AsPC1 cells. The MDA-MB-231 HLA-Gov cells were a MDA-MB-231 cell line stably overexpressing HLA-G, and the SKOV3 HLA-Gov cells were a SKOV3 cell line stably overexpressing HLA-G, which were obtained by transfecting a pCMV1 plasmid encoding HLA-G into the MDA-MB-231 cell line and the SKOV3 cell line, respectively, using Lipofectamine 3000 (Invitrogen).

[0091] Example 4 or the parental cells were used as effector cells, and the effector cells and the tumor cells were co-cultured at an effector cell / tumor cell (E:T) ratio of 1:1, 2:1, 3:1, 6:1, and 10:1 at 37°C. All the tumor cells were stained with calcein-AM, which has green fluorescence, before co-culturing, and with propidium iodide, which has red fluorescence, after co-culturing for 48 hours, and the specific lysis of Example 4 against the tumor cells was determined by flow cytometry for LIVE / DEAD cell-mediated cytotoxicity assay.

[0092] Please refer to Figures 13A to 17 for the analysis results of the specific lysis of Example 4 against the tumor cells, wherein Figure 13A and Figure 13B The tumor cells analyzed were MDA-MB-231 cells and MDA-MB-231 HLA-Gov cells, Figure 14A and Figure 14B The tumor cells analyzed were GBM-8901 cells and DBTRG-05MG cells, Figure 15A and Figure 15B The tumor cells analyzed were A549 cells and H1975 cells, Figure 16A and Figure 16BThe tumor cells analyzed were SKOV3 cells and SKOV3 HLA-Gov cells. Figure 17 The tumor cells analyzed were AsPC1 cells. Figures 13A to 17 In the text, * indicates p < 0.05, ** indicates p < 0.01, and *** indicates p < 0.001.

[0093] Depend on Figure 13A and Figure 13B The results showed that, compared with the parental cells, Example 4 enhanced the specific lysis of MDA-MB-231 cells and MDA-MB-231 HLA-Gov cells under E:T ratios of 1:1, 2:1, 3:1, 6:1 and 10:1, and the differences were statistically significant. Figure 14A and Figure 14B The results showed that, compared with the parent cells, Example 4 enhanced the specific lysis of GBM-8901 cells and DBTRG-05MG cells under E:T ratios of 1:1, 2:1, 3:1, 6:1 and 10:1, and the differences were statistically significant. Figure 15A and Figure 15B The results showed that, compared with the parent cells, Example 4 enhanced the specific lysis of A549 cells and H1975 cells under E:T ratios of 1:1, 2:1, 3:1, 6:1 and 10:1, and the differences were statistically significant. Figure 16A and Figure 16B The results showed that, compared with the parent cells, Example 4 enhanced the specific lysis of SKOV3 cells and SKOV3 HLA-Gov cells under E:T ratios of 1:1, 2:1, 3:1, 6:1 and 10:1, and the differences were statistically significant. Figure 17 The results showed that, compared with parental cells, Example 4 enhanced the specific lysis of AsPC1 cells under E:T ratios of 1:1, 2:1, 3:1, 6:1, and 10:1, and the differences were statistically significant. These results demonstrate that the multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor expression cells of the present invention exhibit excellent cytotoxic effects against TNBC cells, glioblastoma cells, lung cancer cells, ovarian cancer cells, and pancreatic cancer cells.

[0094] Please refer to Figure 18 and Figure 1 , Figure 18This diagram illustrates the mechanism of action of the multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor expressing cells secreting the multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor of the present invention. Because the multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor of the present invention possesses a P2A peptide between the HLA-G single-domain antibody chimeric antigen receptor and the bispecific T-cell adaptor, which can undergo self-cleavage, when the multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor expressing cells express the multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor, it can cleave the bispecific T-cell adaptor and secrete it extracellularly.

[0095] To test the secretion status of bispecific T cell adaptors in cells expressing the multispecific single-domain antibody chimeric antigen receptor and T cell adaptor of the present invention, parental cells, cells from Example 3 or Example 4, and MDA-MB-231 cells were seeded in 12-well plates coated with PD-L1 at an E:T ratio of 3:1. After co-culturing for 48 hours, the secretion amount of bispecific T cell adaptors was detected using an anti-CD3 antibody.

[0096] Please refer to Figure 19 The figure shows the analysis results of bispecific T cell adaptor secretion by cells expressing the multispecific single-domain antibody chimeric antigen receptor and T cell adaptor according to the present invention. The results show that, compared with the data before co-culture, both Example 3 and Example 4 showed an increase in the secretion of bispecific T cell adaptors after co-culturing with MDA-MB-231 cells, indicating that the bispecific T cell adaptor secreted by the cells expressing the multispecific single-domain antibody chimeric antigen receptor and T cell adaptor according to the present invention is detectable.

[0097] This experiment further utilized a cell-impermeable transwell membrane (0.4 μm pore size) to evaluate the cytotoxic effect of the multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor released by cells expressing the multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor of the present invention on tumor cells. In the experiment, effector cells (PBMCs) and / or tumor cells (GBM-8901 cells or DBTRG-05MG cells) were seeded at an E:T ratio of 5:1 at the bottom of a 12-well dish. Then, 5 × 10⁵ cells were added to the upper space containing or without a cell-impermeable transwell membrane. 5 Example 3, parental cells, or comparative example 2. At specified time points, the bottom cells underwent LIVE / DEAD cell-mediated cytotoxicity assays, followed by analysis by flow cytometry.

[0098] Please refer to Figure 20A , Figure 20B and Figure 20CThe figure shows the results of the analysis of the effects of PBMC-induced cytotoxicity enhanced by parental cells or comparative example 2 on glioblastoma cells, as described in Example 3. Figure 20A This is a photomicrograph. Figure 20B and Figure 20C for Figure 20A The statistical results are shown in the figure, where * indicates p<0.05, ** indicates p<0.01, and *** indicates p<0.001. Figure 20A and Figure 20B The results showed that, compared with the untreated blank control group, the conditioned media of parental cells, Comparative Example 2, and Example 3 all enhanced PBMC-induced cytotoxicity, thereby inducing specific lysis of GBM-8901 cells. However, the PBMC-induced cytotoxicity enhanced by the conditioned media of Example 3 was significantly better than that of the other groups, and the differences were statistically significant compared with both parental cells and Comparative Example 2 (p<0.001 and p<0.05, respectively). Figure 20A and Figure 20C The results showed that, compared with the untreated blank control group, the conditioned medium of parental cells, Comparative Example 2, and Example 3 all enhanced PBMC-induced cytotoxicity, thereby inducing specific lysis of DBTRG-05MG cells. However, the PBMC-induced cytotoxicity enhanced by the conditioned medium of Example 3 was significantly better than that of the other groups, and the differences were statistically significant compared with both parental cells and Comparative Example 2 (p<0.05 and p<0.05, respectively). The above results show that the multispecific single-domain antibody chimeric antigen receptor and T cell adaptor expression cells of the present invention can indeed secrete bispecific T cell adaptors into the cell culture medium, thereby enhancing the cytotoxicity of effector cells against tumor cells and inducing specific lysis.

[0099] Furthermore, to test whether the multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor expression cells of the present invention have cancer therapeutic efficacy, please refer to... Figure 21A This diagram illustrates the strategy of using the multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor expression cells of the present invention in animal therapeutic experiments. Ten days prior to the experiment (day -10), an orthotopic xenograft breast tumor PBMC-huNGS mouse model was established by subcutaneous injection of 1×10-1 into the left fourth mammary gland of female NGS mice. 6 5 × 10⁶ MDA-MB-231-luc cells were implanted 7 days after engraftment (day -3), and then injected via tail vein. 6 One huPBMC cell was introduced into NGS mice to establish an orthotopic xenograft breast tumor PBMC-huNGS mouse model (hereinafter referred to as tumor mouse). Treatment began 3 days later (day 0) via tail vein injection of 1×10⁻⁶ huPBMC cells. 7parental cells or Example 4 to tumor mice, and 1 x 10 7 parental cells or Example 4 to tumor mice, and the additional injection was performed 3 times (on day 7, day 14 and day 21). During the treatment, the tumor growth of the tumor mice was monitored by using an in vivo imaging system (IVIS Spectrum, PerkinElmer) every week, and the monitoring time points were day 0, day 7, day 14, day 21, day 28, day 35, day 42, day 49, day 56, day 63, day 70, day 77 and day 84. In addition, the survival rate of the tumor mice was analyzed by using the Kaplan-Meier survival curve.

[0100] Please refer to Figure 21B , Figure 21C and Figure 21D , which are the analysis results of the tumor growth inhibition effect of the multispecific single-domain antibody chimeric antigen receptor and T cell engager-expressing cells of the present application on tumor mice. Among them Figure 21B is the image of IVIS, and the number under the photo is the number of the tumor mice in the test group. Figure 21C is the bioluminescence of each group of tumor mice at each monitoring time point, and the bioluminescence is proportional to the size of the tumor. Figure 21D is the Kaplan-Meier survival curve of each group of tumor mice.

[0101] The results show that the tumors of the untreated tumor mice (hereinafter referred to as the vector group) gradually grow from day 0, and all the tumor mice (n = 6) in the vector group died on day 63. Compared with the vector group, the tumor growth rate of the tumor mice treated with parental cells (hereinafter referred to as the parental cell group) is slower, but the tumor size also increases with time from day 0, and all the tumor mice (n = 6) in the parental cell group died on day 81. The tumor size of the tumor mice treated with Example 4 (hereinafter referred to as the Example 4 group) is controlled, and even 2 out of 6 tumor mice in the Example 4 group did not detect the signal of the tumor residue on day 84, and the survival time of one of them was extended to day 128. The above results show that the multispecific single-domain antibody chimeric antigen receptor and T cell engager-expressing cells of the present application can increase the tumor inhibition effect and effectively prolong the survival time of the orthotopic xenotransplanted breast tumor PBMC-huNGS mice.

[0102] In summary, the multispecific single-domain antibody chimeric antigen receptor and T cell engager of the present application, particularly specifically binds to HLA-G expressed on the cell membrane of tumor cells, so that the cell expressing the multispecific single-domain antibody chimeric antigen receptor and T cell engager of the present application can specifically target tumor cells, thereby avoiding off-target effects. In addition, the multispecific single-domain antibody chimeric antigen receptor and T cell engager of the present application can specifically recognize the CD3 molecule on the surface of T cells and the PD-L1 on the surface of tumor cells, and can simultaneously activate T cells and block immune checkpoint activation, thereby effectively killing tumor cells, and can be used to prepare a medicament for inducing tumor cell death in mammals. The pharmaceutical composition for treating cancer of the present application comprises the cell expressing the multispecific single-domain antibody chimeric antigen receptor and T cell engager of the present application, which can effectively kill tumor cells and thereby treat cancer. Experimental data show that the cell expressing the multispecific single-domain antibody chimeric antigen receptor and T cell engager of the present application has excellent effects on inhibiting tumor progression in animal models, and has potential for use in the biomedical health care market.

[0103] However, the present application has been disclosed above by way of embodiments, but is not intended to limit the present application, and any person skilled in the art can make various modifications and decorations without departing from the spirit and scope of the present application, and therefore the scope of protection of the present application shall be subject to the appended claims. SEQUENCE LISTING <110> Changsing International Biotech Co., Ltd. <120> Multispecific single-domain antibody chimeric antigen receptor and T cell engager and uses thereof <130> CP-5346-CN <160> 30 <170> PatentIn version 3.5 <210> 1 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> HLA-G Nb #1 <400> 1 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Asp Ala Ser Lys Tyr Thr Tyr Phe Arg Asn 20 25 30 Cys Met Gly Trp Phe Arg Gln Val Pro Gly Ala Glu Arg Glu Gly Val 35 40 45 Ala Thr Ile Asp Ser Ala Gly Gly Thr Ser Tyr Ala Asp Phe Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Thr Ala Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys Phe 85 90 95 Gly Gly Ser Trp Tyr Lys Gly Ser Cys Ile Tyr Glu Tyr Asn Tyr Trp 100 105 110 Gly Gln Gly Thr Gln Val Thr Val Ser Ser Val Asp 115 120 <210> 2 <211> 154 <212> PRT <213> Artificial Sequence <220> <223> HLA-G Nb #109 <400> 2 Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala 1 5 10 15 Ala Gln Pro Ala Met Ala Met Gly Glu Val Gln Leu Val Glu Ser Gly 20 25 30 Gly Gly Ser Val Gln Ala Gly Gly Ser Leu Arg Leu Ser Cys Asp Ala 35 40 45 Ser Lys Tyr Thr Tyr Phe Arg Asn Cys Met Gly Trp Phe Arg Gln Val 50 55 60 Pro Gly Ala Glu Arg Glu Gly Val Ala Thr Ile Asp Ser Ala Gly Gly 65 70 75 80 Thr Ser Tyr Ala Asp Phe Val Lys Gly Arg Phe Thr Ile Ser Arg Asp 85 90 95 Asn Ala Lys Thr Ala Leu Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu 100 105 110 Asp Thr Ala Met Tyr Tyr Cys Phe Gly Gly Ser Trp Tyr Lys Gly Ser 115 120 125 Cys Ile Tyr Glu Tyr Asn Tyr Trp Gly Gln Gly Thr Gln Val Thr Val 130 135 140 Ser Ser Leu Glu His His His His His His 145 150 <210> 3 <211> 408 <212> DNA <213> Artificial Sequence <220> <223> Encoding HLA-G Nb #1 fragment <400> 3 atgggaagat ctgagctcga agttcagctg gttgaaagtg gtggcggtag cgtgcaggca 60 ggtggtagcc tgcgcctgag ttgtgatgcc agtaaatata cctacttccg taattgtatg 120 ggttggttcc gtcaggttcc gggcgccgaa cgcgaaggtg ttgcaaccat tgatagtgca 180 ggcggcacca gttatgccga cttcgttaaa ggtcgcttca ccattagccg tgataatgcc 240 aaaaccgcac tgtatctgca gatgaatagt ctgaaaccgg aagataccgc aatgtattat 300 tgcttcggcg gcagttggta taaaggtagc tgtatctatg aatataacta ctggggtcag 360 ggtacccagg tgaccgttag cagcgtcgac catcatcatc atcatcat 408 <210> 4 <211> 378 <212> DNA <213> Artificial sequence <220> <223> Encodes HLA-G Nb #109 fragment <400> 4 atgggcgaag tgcagctggt tgaaagcggt ggtggcagcg ttcaggcagg tggcagtctg 60 cgcctgagtt gcgatgccag taaatatacc tacttccgca attgtatggg ctggttccgt 120 caggtgccgg gcgccgaacg cgaaggtgtg gcaaccattg atagcgccgg tggtaccagc 180 TATGCCGACT TCGTGAAAGG TCGCTTCACC ATTAGCCGCG TATAATGCCA AACC GC ACTG 240 TATCTGCAGA TGAATAGCCT GAAACCGGAA GATACCGCCT ATGTATTATT GCTTCGGCGC 300 AGCTGGTATA AAGGCGAGCT GCA TCTATGAAT ATAA TTATTGGGGCC AGGGCACCC AGGTG 360 ACC GTT AGT AGTCTCGAG 378 <210> 5 <211> 119 <212> PRT <213> Artificial Sequence <220> <223> PD-L1 Nb #3 <400> 5 Glu Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Phe Thr Phe Ser Ser Ile 20 25 30 Gly Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Leu Asn Pro Val Gly Ser His Thr Gly Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu His 65 70 75 80 Leu Gin Leu Asn Ser Leu Lys Thr Glu Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Gln Arg Gly Tyr Thr Cys Ser Gly Asp Leu Cys Glu Arg Gly Gln Gly 100 105 110 Thr Gln Val Thr Val Ser Ser 115 <210> 6 <211> 121 <212> PRT <213> Artificial Sequence <220> <223> PD-L1 Nb #15 <400> 6 His Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Lys 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Asp Trp Val 35 40 45 Ser Thr Ile Asn Ser Gly Gly Gly Asn Thr Tyr Tyr Ser Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Leu Asn Ser Leu Lys Thr Glu Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Ser Arg Cys Ser Asp Ile Tyr Cys Gly Gly Gln Tyr Thr Tyr Arg Gly 100 105 110 Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 7 <211> 357 <212> DNA <213> Artificial Sequence <220> <223> encodes PD-L1 Nb #3 fragment <400> 7 gaggtgcagc tggtggagtc tgggggaggc ttggtgcagc ctggggggtc tctgagactc 60 tcctgtgtag cctctggatt caccttcagt agcattggca tgagttgggt ccgccaggct 120 ccagggaagg ggctcgagtg ggtctcaggt ctgaatcctg ttggtagtca cacaggctat 180 gcagactccg taaagggccg attcaccatc tccagagaca acgccaagaa tacgctgcat 240 ctgcagttga acagcctgaa aactgaggac acggccatgt attactgtca aagaggttat 300 acttgtagcg gtgatttgtg cgaaaggggt caggggaccc aggtcactgt ctcctca 357 <210> 8 <211> 363 <212> DNA <213> Artificial Sequence <220> <223> encodes PD-L1 Nb #15 fragment <400> 8 catgtgcagc tggtggagtc tgggggaggc ttggtgcagc ctggggggtc tctgagactc 60 TCA GAC TCC GGT GAAGGGCCG ATTCACC ATC TCC AGAGACA ACGCCAAGA AC AC GCTGTAT 240 CCA GGG AAGG GACTCG ACTG GGTCT CAA CC ATTAATAGT GGTGGTGGTA AC ATATATAT 180 TCA GAC TCC GGT GAAGGGCCG ATTCACC ATC TCC AGAGACA ACGCCAAGA AC AC GCTGTAT 240 TCA GAC TCC GGT GAAGGGCCG ATTCACC ATC TCC AGAGACA ACGCCAAGA AC AC GCTGTAT 240 GATATTTACT GC GGA GGGCA ATATACGTAT CGGGGCCAGGG GACCTGGT CACTGTCTCC 360 TCA 363 <210> 9 <211> 128 <212> PRT <213> Artificial Sequence <220> <223> CD3e Nb <400> 9 His Val Gin Leu Val Glu Ser Gly Gly Gly Ser Val Gin Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Val Ser Gly Val Ile Phe Lys Asn Glu 20 25 30 Tyr Met Gly Trp Phe Arg Gin Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Ala Ala Ala Ser Pro Gly Gly Thr Ile Thr Tyr Tyr Gly Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Arg Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Ala Leu Asp Pro Ser Thr Thr Ser Trp Ser Ile Ile Arg His Gly Pro 100 105 110 Ser Leu Trp Arg Tyr Ser Gly Arg Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 10 <211> 384 <212> DNA <213> Artificial Sequence <220> <223> Encoding CD3e Nb fragment <400> 10 catgtgcagc tggtggagtc tgggggaggc tcggtgcagg ctggggggtc tctgagactc 60 tcctgtacag tgtctggagt catctttaag aacgagtaca tgggctggtt ccgccaggcc 120 ccagggaagg agcgcgaggg ggtcgcagca gcttcgcctg gtggaacgat tacatactat 180 ggggactccg tgaagggccg attcaccatc tcccgagaca atgccaagaa cacggtgtat 240 ctgcaaatga accgcctgaa acctgaggac actgccatgt actactgtgc gttggatccc 300 TGGCTGGCTTCTGCTCCACGCCGCTCGG 60 GGGACCCAGGT CACCCTCTCCTCA 384 <210> 11 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> First signal peptide <400> 11 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro 20 <210> 12 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> Encodes first signal peptide fragment <400> 12 atggccctcc ctgtcaccgc cctgctgctt ccgctggctc ttctgctcca cgccgctcgg 60 ccc 63 <210> 13 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> G-S linker <400> 13 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 15 <210> 14 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> G-S linker fragment <400> 14 ggaggcggag gttctggagg cggaggttct ggaggcggag gttct 45 <210> 15 <211> 20 <212> PRT <213> Artificial sequence <220> <223> second signal peptide <400> 15 Met Tyr Arg Met Gin Leu Leu Ser Cys lie Ala Leu Ser Leu Ala Leu 1 5 10 15 Val Thr Asn Ser 20 <210> 16 <211> 60 <212> DNA <213> Artificial sequence <220> <223> encoding second signal peptide <400> 16 atgtacagga tgcaactcct gtcttgcatt gcactaagtc ttgcacttgt cacaaacagt 60 <210> 17 <211> 69 <212> PRT <213> Artificial sequence <220> <223> CD8 hinge region <400> 17 Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr lie Ala 1 5 10 15 Ser Gin Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly 20 25 30 Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile 35 40 45 Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val 50 55 60 Ile Thr Leu Tyr Cys 65 <210> 18 <211> 207 <212> DNA <213> Artificial Sequence <220> <223> CD8 Hinge Region Fragment <400> 18 accacgacgc cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg 60 tccctgcgcc cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg 120 gacttcgcct gtgatatcta catttgggcc cctctggctg gtacttgcgg ggtcctgctg 180 ctttcactcg tgatcactct ttactgt 207 <210> 19 <211> 126 <212> PRT <213> Artificial Sequence <220> <223> IFNAR1 / 4-1BB <400> 19 Lys Val Phe Leu Arg Cys Ile Asn Tyr Val Phe Phe Pro Ser Leu Lys 1 5 10 15 Pro Ser Ser Ser lie Asp Glu Tyr Phe Ser Glu Gin Pro Leu Lys Asn 20 25 30 Leu Leu Leu Ser Thr Ser Glu Glu Gin lie Glu Arg Cys Phe lie lie 35 40 45 Glu Asn lie Ser Thr lie Ala Thr Val Glu Glu Thr Asn Gin Thr Pro 50 55 60 Val Gin Thr Thr Gin Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu 65 70 75 80 Glu Glu Glu Gly Gly Cys Glu Leu Asp Glu Asp His Lys Lys Tyr Ser 85 90 95 Ser Gin Thr Ser Gin Asp Ser Gly Asn Tyr Ser Asn Glu Asp Glu Ser 100 105 110 Glu Ser Lys Thr Ser Glu Glu Leu Gin Leu Val Leu Asp Ser 115 120 125 <210> 20 <211> 377 <212> DNA <213> Artificial Sequence <220> <223> Encodes IFNAR1 / 4-1BB fragment <400> 20 aagtcttctt gagatgcatc aattatgtct tctttccatc acttaaacct tcttccagta 60 tagatgagta tttctctgaa cagccattga agaatcttct gctttcaact tctgaggaac 120 aaatcgaaag atgtttcata attgaaaata taagcacaat tgctacagta gaagaaacta 180 atcaaactcc agtacaaact actcaagagg aagatggctg tagctgccga tttccagaag 240 aagaagaagg aggatgtgaa ctggatgaag atcataaaaa atacagttcc caaactagcc 300 aagattcagg aaattattct aatgaagatg aaagcgaaag taaaacaagt gaagaactac 360 agctggtctt ggactcc 377 <210> 21 <211> 170 <212> PRT <213> Artificial Sequence <220> <223> Myd88 / CD40 <400> 21 Met Ala Ala Gly Gly Pro Gly Ala Gly Ser Ala Ala Pro Val Ser Ser 1 5 10 15 Thr Ser Ser Leu Pro Leu Ala Ala Leu Asn Met Arg Val Arg Arg Arg 20 25 30 Leu Ser Leu Phe Leu Asn Val Arg Thr Gln Val Ala Ala Asp Trp Thr 35 40 45 Ala Leu Ala Glu Glu Lys Lys Val Ala Lys Lys Pro Thr Asn Lys Ala 50 55 60 Pro His Pro Lys Met Asp Phe Glu Tyr Leu Glu Ile Arg Gln Leu Glu 65 70 75 80 Thr Gin Ala Asp Pro Thr Gly Arg Leu Leu Asp Ala Trp Gin Gly Arg 85 90 95 Pro Gly Ala Ser Val Gly Arg Leu Leu Glu Leu Leu Thr Lys Leu Gly 100 105 110 Cys Asp Asp Val Leu Leu Glu Leu Gly Pro Ser Ile Glu Glu Asp Cys 115 120 125 Gln Lys Tyr Ile Leu Lys Gin Gin Gin Glu Glu Ala Glu Lys Pro Leu 130 135 140 Gln Val Ala Ala Val Asp Ser Ser Val Pro Arg Thr Ala Glu Leu Ala 145 150 155 160 Gly Ile Thr Thr Leu Asp Asp Pro Leu Gly 165 170 <210> 22 <211> 510 <212> DNA <213> Artificial Sequence <220> <223> Encoding Myd88 / CD40 Fragment <400> 22 atggctgcag gaggtcccgg cgcggggtct gcggccccgg tctcctccac atcctccctt 60 cccctggctg ctctcaacat gcgagtgcgg cgccgcctgt ctctgttctt gaacgtgcgg 120 acacaggtgg cggccgactg gaccgcgctg gcggaggaga aaaaggtggc caagaagcca 180 Thr Gin Ala Asp Pro Thr Gly Arg Leu Leu Asp Ala Trp Gin Gly Arg 85 90 95 Pro Gly Ala Ser Val Gly Arg Leu Leu Glu Leu Leu Thr Lys Leu Gly 100 105 110 Cys Asp Asp Val Leu Leu Glu Leu Gly Pro Ser Ile Glu Glu Asp Cys 115 120 125 Gln Lys Tyr Ile Leu Lys Gin Gin Gin Glu Glu Ala Glu Lys Pro Leu 130 135 140 Gln Val Ala Ala Val Asp Ser Ser Val Pro Arg Thr Ala Glu Leu Ala 145 150 155 160 Gly Ile Thr Thr Leu Asp Asp Pro Leu Gly 165 170 <210> 22 <211> 510 <212> DNA <213> Artificial Sequence <220> <223> Encoding Myd88 / CD40 Fragment <400> 22 atggctgcag gaggtcccgg cgcggggtct gcggccccgg tctcctccac atcctccctt 60 cccctggctg ctctcaacat gcgagtgcgg cgccgcctgt ctctgttctt gaacgtgcgg 120 acacaggtgg cggccgactg gaccgcgctg gcggaggaga aaaaggtggc caagaagcca 180 accaataagg ccccccaccc caagatggac tttgagtact tggagatccg gcaactggag 240 acacaagcgg accccactgg caggctgctg gacgcctggc agggacgccc tggcgcctct 300 gtaggccgac tgctcgagct gcttaccaag ctgggctgcg acgacgtgct gctggagctg 360 ggacccagca ttgaggagga ttgccaaaag tatatcttga agcagcagca ggaggaggct 420 gagaagcctt tacaggtggc cgctgtagac agcagtgtcc cacggacagc agagctggcg 480 ggcatcacca cacttgatga ccccctgggg 510 <210> 23 <211> 218 <212> PRT <213> Artificial Sequence <220> <223> Myd88 / IFNAR1 <400> 23 Met Ala Ala Gly Gly Pro Gly Ala Gly Ser Ala Ala Pro Val Ser Ser 1 5 10 15 Thr Ser Ser Leu Pro Leu Ala Ala Leu Asn Met Arg Val Arg Arg Arg 20 25 30 Leu Ser Leu Phe Leu Asn Val Arg Thr Gln Val Ala Ala Asp Trp Thr 35 40 45 Ala Leu Ala Glu Glu Lys Val Phe Leu Arg Cys Ile Asn Tyr Val Phe 50 55 60 Phe Pro Ser Leu Lys Pro Ser Ser Ser Ile Asp Glu Tyr Phe Ser Glu 65 70 75 80 Gln Pro Leu Lys Asn Leu Leu Leu Ser Thr Ser Glu Glu Gln Ile Glu 85 90 95 Arg Cys Phe Ile Ile Glu Asn Ile Ser Thr Ile Ala Thr Val Glu Glu 100 105 110 Thr Asn Gln Thr Met Asp Phe Glu Tyr Leu Glu Ile Arg Gln Leu Glu 115 120 125 Thr Gln Ala Asp Pro Thr Gly Arg Leu Leu Asp Ala Trp Gln Gly Arg 130 135 140 Pro Gly Ala Ser Val Gly Arg Leu Leu Glu Leu Leu Thr Lys Leu Gly 145 150 155 160 Cys Asp Asp Val Leu Leu Glu Leu Gly Pro Ser Ile Glu Glu Asp Cys 165 170 175 Gln Lys Tyr Ile Leu Lys Gln Gln Gln Glu Glu Ala Glu Lys Pro Leu 180 185 190 Gln Val Ala Ala Val Asp Ser Ser Val Pro Arg Thr Ala Glu Leu Ala 195 200 205 Gly Ile Thr Thr Leu Asp Asp Pro Leu Gly 210 215 <210> 24 <211> 654 <212> DNA <213> Artificial Sequence <220> <223> Myd88 / IFNAR1 fragment encoding <400> 24 atggctgcag gaggtcccgg cgcggggtct gcggccccgg tctcctccac atcctccctt 60 cccctggctg ctctcaacat gcgagtgcgg cgccgcctgt ctctgttctt gaacgtgcgg 120 acacaggtgg cggccgactg gaccgcgctg gcggaggaga aagtcttctt gagatgcatc 180 aattatgtct tctttccatc acttaaacct tcttccagta tagatgagta tttctctgaa 240 cagccattga agaatcttct gctttcaact tctgaggaac aaatcgaaag atgtttcata 300 attgaaaata taagcacaat tgctacagta gaagaaacta atcaaactat ggactttgag 360 tacttggaga tccggcaact ggagacacaa gcggacccca ctggcaggct gctggacgcc 420 tggcagggac gccctggcgc ctctgtaggc cgactgctcg agctgcttac caagctgggc 480 tgcgacgacg tgctgctgga gctgggaccc agcattgagg aggattgcca aaagtatatc 540 ttgaagcagc agcaggagga ggctgagaag cctttacagg tggccgctgt agacagcagt 600 gtcccacgga cagcagagct ggcgggcatc accacactlg atgaccccct gggg 654 <210> 25 <211> 145 <212> PRT <213> Artificial Sequence <220> <223> CD3 zeta signaling domain <400> 25 Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gin Gin Gly 1 5 10 15 Gln Asn Gin Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr 20 25 30 Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys 35 40 45 Pro Gin Arg Arg Lys Asn Pro Gin Glu Gly Leu Tyr Asn Glu Leu Gin 50 55 60 Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu lie Gly Met Lys Gly Glu 65 70 75 80 Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gin Gly Leu Ser Thr 85 90 95 Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gin Tyr Phe Leu Arg 100 105 110 Lys Gin Arg lie Thr Glu Thr Glu Ser Pro Tyr Gin Glu Leu Gin Gly Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu lie Gly Met Lys Gly Glu115 120 125 Gln Arg Ser Asp Val Tyr Ser Asp Leu Asn Thr Gin Ala Leu Pro Pro 130 135 140 Arg 145 <210> 26 <211> 435 <212> DNA <213> Artificial Sequence <220> <223> encoding a CD3 zeta signaling domain fragment <400> 26 agagtgaagt tcagcaggag cgcagacgcc cccgcgtacc agcagggcca gaaccagctc 60 tataacgagc tcaatctagg acgaagagag gagtacgatg ttttggacaa gagacgtggc 120 cgggaccctg agatgggggg aaagccgcag agaaggaaga accctcagga aggcctgtac 180 aatgaactgc agaaagataa gatggcggag gcctacagtg agattgggat gaaaggcgag 240 cgccggaggg gcaaggggca cgatggcctt taccagggtc tcagtacagc caccaaggac 300 acctacgacg cccttcacat gcagtacttc ctgcggaaac agcgtatcac tgagaccgag 360 tcgccttatc aggagctcca gggtcagagg tcggatgtct acagcgacct caacacacag 420 gccctgcccc ctcgc 435 <210> 27 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> P2A peptide <400> 27 Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn 1 5 10 15 Pro Gly Pro <210> 28 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Encodes P2A peptide fragment <400> 28 gccacaaatt tcagcctgct gaaacaggcc ggcgacgtgg aagagaaccc tggacct 57 <210> 29 <211> 132 <212> PRT <213> Artificial Sequence <220> <223> 4-1BB / TYK <400> 29 Ile Ile Ser Phe Phe Leu Ala Leu Thr Ser Thr Ala Leu Leu Phe Leu 1 5 10 15 Leu Phe Phe Leu Thr Leu Arg Phe Ser Val Val Lys Arg Gly Arg Lys 20 25 30 Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Lys Val Phe Leu 35 40 45 Arg Cys Ile Asn Tyr Val Phe Phe Pro Ser Leu Lys Pro Ser Ser Ser 50 55 60 Ile Asp Glu Tyr Phe Ser Glu Gin Pro Leu Lys Asn Leu Leu Leu Ser 65 70 75 80 Thr Ser Glu Glu Gin Ile Glu Arg Cys Phe Ile Ile Glu Asn Ile Ser 85 90 95 Thr Ile Ala Thr Val Glu Glu Thr Asn Gin Thr Pro Val Gin Thr Thr 100 105 110 Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly 115 120 125 Gly Cys Glu Leu 130 <210> 30 <211> 396 <212> DNA <213> Artificial Sequence <220> <223> encodes 4-1BB / TYK fragment <400> 30 atcatctcct tctttcttgc gctgacgtcg actgcgttgc tcttcctgct gttcttcctc 60 acgctccgtt tctctgttgt taaacggggc agaaagaaac tcctgtatat attcaaacaa 120 ccatttatga gaaaagtctt cttgagatgc atcaattatg tcttctttcc atcacttaaa 180 ccttcttcca gtatagatga gtatttctct gaacagccat tgaagaatct tctgctttca 240 acttctgagg aacaaatcga aagatgtttc ataattgaaa atataagcac aattgctaca 300 GTAAGAAGAAACCAATCAAAC TCCAGTACAA ACTACTCAAG AGGAAGATGG CTGTA GCTGC 360 CGATTTCCAG AAGAAGAAGA AGGAGGATGT GAAC T 396

Claims

1. A multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor, characterized in that, From N to C, the following are included sequentially: A single-domain HLA-G antibody chimeric antigen receptor, comprising: An HLA-G single-domain antibody unit that specifically binds to human leukocyte antigen G (HLA-G), the HLA-G single-domain antibody unit comprising at least one HLA-G single-domain antibody, and the amino acid sequence of the at least one HLA-G single-domain antibody as shown in SEQ ID NO:1 and / or SEQ ID NO:2; and A transmembrane domain, the amino acid sequence of which is as shown in SEQ ID NO: As shown in Figure 29; A CD3z signal transduction domain, the amino acid sequence of which is shown in SEQ ID NO:25; and A bispecific T-cell adaptor is attached to the C-terminus of the HLA-G single-domain antibody chimeric antigen receptor, the bispecific T-cell adaptor comprising; A PD-L1 single-domain antibody unit that specifically binds to programmed death-ligand 1 (PD-L1), the PD-L1 single-domain antibody unit comprising at least one PD-L1 single-domain antibody, and the amino acid sequence of the at least one PD-L1 single-domain antibody as shown in SEQ ID NO:5 and / or SEQ ID NO:6; and A CD3e single-domain antibody that specifically binds to CD3e molecules, the amino acid sequence of which is shown in SEQ ID NO:9; The HLA-G single-domain antibody chimeric antigen receptor is linked to the bispecific T-cell adaptor via a P2A peptide.

2. The multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor as described in claim 1, characterized in that, It further includes a first signal peptide linked to the N-terminus of the HLA-G single-domain antibody chimeric antigen receptor, and the amino acid sequence of the first signal peptide is shown in SEQ ID NO:

11.

3. The multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor as described in claim 1, characterized in that, It also includes a CD8 hinge region that connects the HLA-G single-domain antibody unit and the transmembrane domain.

4. The multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor as described in claim 1, characterized in that, It further includes a second signal peptide linked to the N-terminus of the bispecific T cell adaptor, and the amino acid sequence of the second signal peptide is shown in SEQ ID NO:

15.

5. A nucleic acid encoding the multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor as described in claim 1, characterized in that, The nucleic acid contains, sequentially from the 5' end to the 3' end: A fragment encoding an HLA-G single-domain antibody chimeric antigen receptor, comprising: A fragment encoding an HLA-G single-domain antibody unit, the fragment comprising at least one HLA-G single-domain antibody fragment, wherein the nucleotide sequence of the at least one HLA-G single-domain antibody fragment is as shown in SEQ ID NO:3 and / or SEQ ID NO:4; and A transmembrane domain fragment, the nucleotide sequence of which is shown in SEQ ID NO:30; A fragment encoding a CD3z information transducer domain, the nucleotide sequence of which is shown in SEQ ID NO:26; and A fragment encoding a bispecific T-cell adaptor is attached to the 3' end of a fragment encoding an HLA-G single-domain antibody chimeric antigen receptor, the fragment encoding the bispecific T-cell adaptor comprising; A PD-L1 single-domain antibody unit fragment, the PD-L1 single-domain antibody unit fragment comprising at least one PD-L1 single-domain antibody fragment, and the nucleotide sequence of the at least one PD-L1 single-domain antibody fragment is as shown in SEQ ID NO:7 and / or SEQ ID NO:8; and A CD3e single-domain antibody fragment, the nucleotide sequence of which is shown in SEQ ID NO:10; The HLA-G single-domain antibody chimeric antigen receptor fragment is coupled with a P2A peptide fragment to a fragment encoding a bispecific T-cell adaptor.

6. A multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor expression cell, characterized in that, Include: Immune cells; and The nucleic acid as described in claim 5; The multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor expression cell was obtained by transfecting the nucleic acid into the immune cell.

7. The multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor expression cell as described in claim 6, characterized in that, The immune cells are natural killer cells or γδT cells.

8. A pharmaceutical composition for treating cancer, characterized in that, Include: The multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor expression cells as described in claim 6; and A medically acceptable carrier.

9. The use of the multispecific single-domain antibody chimeric antigen receptor and T-cell adaptor expression cell as described in claim 6, characterized in that, This is a drug used to prepare a tumor cell that induces death in a mammal, wherein the mammal is a human or a mouse, and the tumor cell is a triple-negative breast cancer cell, glioblastoma cell, lung cancer cell, ovarian cancer cell, or pancreatic cancer cell.

Citation Information

Patent Citations

  • Muc1-specific CAR-T cells capable of stably expressing PD-1 antibodies and usage thereof

    CN109971713A

  • Multispecific antibodies and use thereof

    CN111989343A