Novel Compounds as Activating Inhibitors of Toll-Like Receptor 7
By developing new TLR7 activation inhibitor compounds, the problem of poor effectiveness of existing TLR7 inhibitors has been solved, and a strong inhibition of TLR7 activation has been achieved, providing a safe and economical treatment plan for autoimmune diseases.
Patent Information
- Application Number
- CN202180038262.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2020-06-08
- Filing Date
- 2021-06-07
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2041-06-07
AI Technical Summary
The existing TLR7 inhibitors have limited effects in mice and systemic lupus erythematosus models, and it is difficult to effectively inhibit the production of inflammatory cytokines and IFN-α caused by TLR7 activation, resulting in poor therapeutic effects on autoimmune diseases.
A series of novel compounds have been developed with powerful inhibitory effects of TLR7 activation, which can significantly inhibit the production of NF-κB, IL-6, TNF-α or IFN-α caused by TLR7 activation, and are used to prepare TLR7 activation inhibitors for the prevention or treatment of autoimmune diseases.
These compounds show an inhibitory intensity of about 45 times that of the pilot compound CB-7, which can effectively reduce the symptoms of autoimmune diseases, provide a non-invasive, safe, simple and economical treatment plan, and reduce the physical and medical burden of patients.
Smart Images

Figure QLYQS_1 
Figure QLYQS_2 
Figure QLYQS_3
Abstract
Description
Technical Field
[0001] The present invention relates to an activator inhibitor of Toll-like receptor 7 (TLR7), and a novel compound containing the activator inhibitor and useful as a prophylactic or therapeutic agent for diseases accompanied by TLR7 activation.
Background Art
[0002] The immune system is roughly divided into the innate immune system and the acquired immune system. The innate immune system is a biological defense mechanism that functions at the initial stage of infection, and phagocytic cells such as macrophages and dendritic cells play a central role. In the acquired immune system, lymphocytes play a central role, and it is an acquired biological defense mechanism that responds to countless antigens. Acquired immunity begins when T cells (a type of lymphocyte) receive an antigen from activated dendritic cells. That is, activation of innate immunity is essential for inducing acquired immunity.
[0003] TLRs expressed on the cell membrane and inside cells of phagocytic cells can specifically recognize components of bacteria and viruses, and induce the production of inflammatory cytokines by activating transcription factors such as NF-κB. For example, TLR7 is locally present in endosomes and lysosomes of B cells and plasmacytoid dendritic cells, and recognizes single-stranded RNA of viral origin. TLR7 that has recognized a ligand defends against viral infection by inducing the production of type I interferon (IFN-α). TLR7 also recognizes nucleic acids (autoantigens) released from damaged autologous cells or dead cells. Therefore, IFN-α is one of the factors related to the onset and exacerbation of non-infectious inflammatory diseases such as autoimmune diseases. Classical dendritic cells induced to differentiate from monocytes by IFN-α, when activated by phagocytosing dead cells, promote the proliferation and differentiation of autoreactive T cells through antigen presentation. IFN-α also promotes class switching of autoreactive B cells and differentiation into plasma cells by inducing the expression of BAFF (B cell activating factor) or APRIL (a proliferation-inducing ligand) in dendritic cells. As a result, the production of autoantibodies in the body becomes active, and immune complexes composed of nucleic acids and autoantibodies stimulate plasmacytoid dendritic cells to promote the production of IFN-α. Therefore, slowing down the production of IFN-α leads to the development and exacerbation of the disease.
[0004] Autoimmune diseases are mostly a group of diseases characterized mainly by the appearance of antibodies against autoantigens (such as antinuclear antibodies) and accompanied by various characteristic inflammations. Along with the development of autoimmune diseases or conditions, serious damage is caused to various organs such as the skin and kidneys, as well as muscles, nerves, and blood vessels. As a representative example of autoimmune diseases caused by abnormal TLR7 signaling and the production of IFN-α, systemic lupus erythematosus can be cited. The number of patients with systemic lupus erythematosus is estimated to be about 1.4 million worldwide and about 100,000 in Japan (the number of certificates of recipients of medical treatment for specific diseases in fiscal year 2016 was 63,792 for systemic lupus erythematosus), and it is particularly common in women in their 20s and 30s. Systemic lupus erythematosus is an immune intractable disease of unknown cause and is designated as a specific disease by the Ministry of Health, Labour and Welfare. There are many reports in mice and humans of systemic lupus erythematosus caused by abnormal TLR7 signaling. The systemic lupus erythematosus model mouse BXSB revealed that the translocation of the region containing the TLR7 gene, which was originally locally present on the X chromosome, to the Y chromosome is the cause of the disease state (Kumar, K.R., et al. Science. 312: 1665 - 1669, 2006). In TLR7 transgenic mice, systemic lupus erythematosus-like glomerulonephritis develops and about half die within 20 weeks after birth (Deane, J.A., et al. Immunity. 27: 801 - 810, 2007). Mice with the 34th aspartic acid residue of Unc93B1, which is involved in the transfer of TLR7 or TLR9 from the endoplasmic reticulum to endosomes, mutated to an alanine residue show autoimmune disease-like symptoms due to hyperresponsive TLR7 and more than half die within one year due to hepatitis (Fukui, R., et al. Immunity. 35: 69 - 81, 2011). The gene expression level of TLR7 in peripheral blood mononuclear cells of patients with human systemic lupus erythematosus is higher than that of healthy people, and a large amount of inflammatory cytokines are produced by stimulation with TLR7 ligands (Komatsuda, A., et al. Clin Exp Immunol. 152: 482 - 487, 2008). In addition, it is known that the deletion of TLR7 in autoimmune disease model mice can improve the disease state. The naturally occurring autoimmune disease model mouse MRL / Mp lpr / lpr The MRL / Mp mouse is a representative animal model of human systemic lupus erythematosus, producing autoantibodies such as antinuclear antibodies, and with the growth of age, vasculitis, polyarthritis, and glomerulonephritis will occur. MRL / Mp lpr / lpr TLR7 deletion in MRL / Mp mice can inhibit lymphocyte activation and alleviate nephritis symptoms (Christensen, S.R., et al. 2006. Immunity. 25(3): 417 - 428). On the other hand, MRL / Mp lpr / lprTLR9 deficiency in mice reduces anti-DNA antibody titers but does not improve nephritis symptoms.
[0005] There are still many issues in the treatment of autoimmune diseases. Rheumatoid arthritis, which has the largest number of patients among autoimmune diseases, is an inflammatory disease mainly characterized by synovial lesions of joints. It is also an autoimmune disease in which polyarthritis occurs continuously, cartilage and bones are damaged, and joint destruction deteriorates. The involvement of inflammatory cytokines in autoimmune diseases has been analyzed mainly using rheumatoid arthritis model mice and rheumatoid arthritis patients. As an IL-1 inhibition therapy, an IL-1 receptor antagonist has been approved as a therapeutic drug for rheumatoid arthritis and is used for treatment. As a TNF-α inhibition therapy, an anti-TNF-α antibody has been approved as a therapeutic drug for rheumatoid arthritis and is used for treatment. As an IL-6 inhibition therapy, an anti-IL-6 receptor antibody has been used as a therapeutic drug for rheumatoid arthritis and is used for treatment, all of which have exceeded the effects of existing standard drug therapies. For systemic lupus erythematosus, the usefulness of biologic agents represented by antibody drugs is also expected. In fact, the recombinant human IgG1λ monoclonal antibody (trade name: belimumab) against B lymphocyte stimulator (BLyS) has the effect of inhibiting the proliferation of autoreactive B cells involved in the deterioration of the disease state. Therefore, its therapeutic effect has been recognized for some patients with systemic lupus erythematosus and it has been sold in Japan and overseas. For example, in the EU, regardless of whether standard treatment has been received, it has been approved as an additional or combined therapeutic drug for adult patients with systemic lupus erythematosus who are positive for autoantibodies and have high disease activity. In addition, in the United States, it is applicable to the same patients for treatment, but the efficacy for patients with severe active lupus nephritis and central nervous system lupus has not been clinically evaluated, so it is a restricted prescription. In the Phase III clinical study in Northeast Asia including Japan published in November 2016, positive trial results were reported for the effect of belimumab, but the response rate after 52 weeks of intravenous administration (10 mg / kg) remained at 54%. In addition, the mouse-human chimeric IgG1κ monoclonal antibody (trade name: rituximab) against CD20 specifically expressed on the surface of B cells has been used as a therapeutic drug for malignant lymphoma and has also attracted attention as a therapeutic drug for systemic lupus erythematosus, but the clinical trial failed due to the report of serious adverse events (including death). Currently, clinical trials using antibodies against IFN-α and its receptor are underway, and good results have been obtained in the evaluation of safety and efficacy, but multiple adverse events (anemia, lymphocytopenia, decreased liver function, etc.) have been reported, although the occurrence frequency is not high. Thus, although the use of biologic agents can be expected to have a high effect of improving the disease state, regular and long-term administration is required, which brings a physical and medical economic burden to patients. Therefore, the effectiveness of this treatment method may be reduced. In addition, steroid drugs, which are the first choice drugs for many autoimmune diseases for which effective therapies have not yet been established, are still used. Steroid drugs have a strong anti-inflammatory effect but also have an immunosuppressive effect, so side effects will occur if taken for a long time.Therefore, with the goal of developing alternative therapeutic agents for steroid drugs, the development of inhibitors against TLR7 or TLR9 has been carried out. So far, oligonucleotide-based inhibitors of TLR7 and TLR9 (Rommler, F., et al. J. Immunol., 191: 3240 - 3253, 2013) and low-molecular-compound-based inhibitors of TLR7 and TLR9 (Lamphier, M., et al. Mol. Pharmacol., 85: 429 - 440, 2014) have been reported, but they are not yet in actual use. On the other hand, hydroxychloroquine, which was approved in Japan in 2015, is an orally administrable low-molecular drug. However, due to possible side effects such as retinopathy, it has not been actively developed as a prescription drug.
[0006] TLR7 is also involved in various diseases other than systemic lupus erythematosus. Alzheimer's disease is a progressive cognitive decline. In patients, there are excessive senile plaques formed by the tangling of neurofibrils composed of amyloid-β and τ protein in the cerebral cortex and subcortical gray matter. It is considered that the main cause of this disease is the deposition of amyloid-β protein in nerve cells. The juvenile-onset type accounts for 2 - 7% of the cases. The common type is hereditary caused by mutations and occurs in the elderly over 60 years old, and the prevalence increases with age. The number of dementia patients in Japan announced by the Ministry of Health, Labour and Welfare in 2013 was 4.62 million, and most of them were Alzheimer's disease. In the United States, there are more than 5 million Alzheimer's disease patients, and accompanying problems include home medical care, home nursing, social medical care, productivity decline, premature death, etc., with an annual cost exceeding $100 billion. In recent years, it has been found that TLR7 is involved in brain diseases caused by neurodegenerative diseases, stroke, or multiple sclerosis. It has been reported that the let-7 (microRNA)-induced neurotoxicity abundantly present in the brain depends on TLR7 (Lehmann, S.M., et al. Nat Neurosci. 15(6): 827 - 835). Currently, it is considered that there is more let-7 in the cerebrospinal fluid of Alzheimer's disease patients than in healthy people and it is involved in neuronal degeneration.
[0007] Previously, the present inventors et al. found through screening research that cyclobakuchiol and its analogs isolated from the mature seeds of the leguminous plant Psoralea corylifolia and also contained in the Chinese herbal medicine Psoralea corylifolia have the effect of selectively inhibiting NF-κB activation induced by TLR7 or TLR9 ligand stimulation, and jointly filed an international application (International Publication No. WO / 2017 / 047769) with Teikoku Pharmaceutical Co., Ltd. and Tokyo Institute of Technology that participated in the joint research.
[0008]
Prior Art Documents
[0009]
Non-Patent Literature
[0010]
Non-Patent Literature 1
[0011]
Non-Patent Literature 2
[0012]
Non-Patent Literature 3
[0013]
Non-Patent Literature 4
[0014]
Non-Patent Literature 5
[0015]
Non-Patent Document 6
[0016]
Non-Patent Document 7
[0017]
Patent Document
[0018]
Patent Document 1
Summary of the Invention
[0019]
Problems to be Solved by the Invention
[0020] In Patent Document 1, CB-7, which shows the highest TLR7 inhibitory effect, can inhibit the activation of TLR7 in mouse immune cells (macrophages, dendritic cells) and human immune cells (peripheral blood mononuclear cells, dendritic cells), but has a weak TLR7 inhibitory effect in normal mice and limited efficacy in systemic lupus erythematosus model mice.
[0021]
Means for Solving the Problems
[0022] The present inventors repeatedly studied methods and substances for developing compounds with higher TLR7 inhibitory activity than the lead compound CB-7 and showing effectiveness at the animal level. As a result, it was found that multiple derivatives with a novel structure have a maximum inhibitory intensity of the production induction of inflammatory cytokines IL-6 or IFN-α caused by TLR7 activation, which is about 45 times that of CB-7, thus completing the present invention.
[0023] According to the present invention, there is provided a compound represented by the following formula (I) or (II), a pharmacologically acceptable salt thereof, or a prodrug thereof.
[0024]
Chemical Formula 1
[0025]
[0026]
Chemical Formula 2
[0027]
[0028] (In formulas (I) and (II), R1 is one of the following groups:
[0029] an alkoxy group having 3 to 5 carbon atoms and containing at least 2 oxygen atoms;
[0030] an alkoxy group having 2 to 4 carbon atoms and containing at least 1 hydroxyl group;
[0031] a group represented by the formula:
[0032]
Chemical Formula 3
[0033]
[0034] (wherein, R2 and R3 are each independently an alkyl group having 1 to 3 carbon atoms); or
[0035] a group represented by the formula:
[0036]
Chemical Formula 4
[0037]
[0038] (wherein, ring C is a 3- to 7-membered nitrogen-containing heterocyclic ring, and R4 is a group represented by -NH-, -O-, -CF2-, -CHF-, -C2H2F2- or -CHF-X-CHF-, and X is an alkyl group having 1 to 4 carbon atoms).)
[0039] The above-mentioned compound, its pharmaceutically acceptable salt, or its prodrug can at least inhibit the activation of TLR7.
[0040] In addition, according to the present invention, there is also provided the above-mentioned compound, its pharmaceutically acceptable salt, or its prodrug, wherein
[0041] R1 is one of the following groups.
[0042]
Chemical Formula 5
[0043]
[0044]
Chemical Formula 6
[0045]
[0046]
Chemical Formula 7
[0047]
[0048]
Chemical Formula 8
[0049]
[0050]
Chemical Formula 9
[0051]
[0052]
Chemical 10
[0053]
[0054]
Chemical 11
[0055]
[0056] or
[0057]
Chemical 12
[0058]
[0059] In addition, according to the present invention, there is also provided the above compound, its pharmaceutically acceptable salt, or their prodrugs, wherein the above compound is represented by any one of the following formulas (III) to (XIII).
[0060]
Chemical 13
[0061]
[0062]
Chemical 14
[0063]
[0064]
Chemical 15
[0065]
[0066]
Chemical 16
[0067]
[0068]
Chemical 17
[0069]
[0070]
Chemical 18
[0071]
[0072]
Chemical 19
[0073]
[0074]
Chemical 20
[0075]
[0076]
Chemical 21
[0077]
[0078]
[0079]
[0080]
[0081]
[0082] In addition, according to the present invention, there is also provided the above compound, a pharmacologically acceptable salt thereof, or a prodrug thereof, wherein the pharmacologically acceptable salt is a hydrochloride salt or a formate salt.
[0083] In addition, according to the present invention, there is also provided an inhibitor of Toll-like receptor 7 (TLR7) activation, which contains the above compound, a pharmacologically acceptable salt thereof, or a prodrug thereof.
[0084] In addition, according to the present invention, there is also provided the above TLR7 activation inhibitor, which has the effect of inhibiting the production of NF-κB, IL-6, TNF-α or IFN-α caused by the activation of TLR7.
[0085] In addition, according to the present invention, there is also provided a prophylactic or therapeutic agent for a disease accompanied by TLR7 activation, which contains the above TLR7 activation inhibitor.
[0086] In addition, according to the present invention, there is also provided the above prophylactic or therapeutic agent, wherein the disease related to TLR7 activation is an autoimmune disease, an autoinflammatory syndrome, autoimmune pancreatitis, arteriosclerosis, sepsis, a neurodegenerative disease, graft rejection, graft-versus-host disease, periodontal disease, viral immunodeficiency, IgA nephropathy, primary nephrotic syndrome, primary membranoproliferative glomerulonephritis, purpuric nephritis, Langerhans cell histiocytosis, hemophagocytic lymphohistiocytosis, Rosai-Dorfman disease, obesity, type 2 diabetes or ulcerative colitis.
[0087] In addition, according to the present invention, there is also provided the above prophylactic or therapeutic agent, wherein the disease related to TLR7 activation is an autoimmune disease.
[0088] In addition, according to the present invention, there is also provided the above-mentioned prophylactic or therapeutic agent, wherein the autoimmune disease is systemic lupus erythematosus, Sjogren's syndrome, scleroderma, polymyositis / dermatomyositis, mixed connective tissue disease, overlap syndrome, antiphospholipid antibody syndrome, Behcet's disease, adult Still's disease, rheumatic fever, malignant rheumatoid arthritis, rheumatoid arthritis, juvenile rheumatoid arthritis, HLA-B27-related rheumatic disease, IgG4-related syndrome, ANCA-related vasculitis, vasculitis syndrome, multiple sclerosis, psoriasis vulgaris, inflammatory bowel disease, autoimmune thyroid disease, autoimmune hemolytic anemia, idiopathic thrombocytopenic purpura, primary biliary cirrhosis, primary biliary cholangitis, myasthenia gravis, Goodpasture's syndrome, Guillain-Barre syndrome, chronic atrophic gastritis, rapidly progressive glomerulonephritis, anti-glomerular basement membrane nephritis, Addison's disease, type I diabetes, vitiligo vulgaris, pemphigus vulgaris, pemphigoid, autoimmune neutropenia, autoimmune hepatitis, autoimmune pancreatitis.
[0089] In addition, according to the present invention, there is also provided the above-mentioned prophylactic or therapeutic agent, wherein the autoimmune disease is the above-mentioned systemic lupus erythematosus.
[0090]
Invention Effect
[0091] Through long-term observation of clinical research, it has been found that abnormal TLR7 signaling in patients with systemic lupus erythematosus is one of the causes. Inhibiting the activation of TLR7 and the production of accompanying inflammatory cytokines and IFN-α are considered important treatment strategies. From the viewpoints of the physical burden and medical economic burden of patients, biological agents for treating or preventing autoimmune diseases are not suitable as long-term therapeutic agents for autoimmune diseases. Therefore, as an effective means for long-term treatment of autoimmune diseases, treatment means with advantages such as non-invasiveness, safety, simplicity, and economy are needed.
[0092] The TLR7 activation inhibitor of the present invention and the prophylactic or therapeutic agent for diseases accompanied by TLR7 activation containing the TLR7 activation inhibitor have advantages such as non-invasiveness, safety, simplicity, and economy. In addition, there are also provided therapeutic and prophylactic agents for inflammatory diseases that are effective in inhibiting the activities of NF-κB, IL-6, and IFN-α.
Brief Description of the Drawings
[0093] Figure 1 Shows the modified regions (regions a and b) in the lead compound CB-7.
[0094] Figure 2 Is a graph showing the TLR7 inhibitory activity (inhibition of IL-6 expression) of CB-7 or B2-24-4-5A·HCOOH in mouse bone marrow-derived macrophages (BMDM).
[0095] Figure 3 This figure shows that B2-24-4-5A·HCOOH in mouse BMDM has TLR7 selectivity.
[0096] Figure 4 The graph shows the TLR7 inhibitory activity (IL-6 expression inhibition) of B2-24-4-5A·HCOOH, B2-24-4·HCl, or hydroxychloroquine sulfate (HCQ) in peripheral blood mononuclear cells (PBMC) derived from systemic lupus erythematosus patients.
[0097] Figure 5 This is a graph showing the plasma concentrations of CB-7 or B2-24-4-5A·HCOOH after oral administration to mice.
[0098] Figure 6 This is a graph showing the plasma concentration of B2-24-4-5A·HCOOH after oral administration to systemic lupus erythematosus model mice.
[0099] Figure 7 This is a graph showing the TLR7 inhibitory activity (inhibition of IFN-α expression) induced by intraperitoneal administration of B2-24-4-5A·HCOOH or HCQ to mice.
[0100] Figure 8 This is a graph showing the TLR7 inhibitory activity (inhibition of IFN-α expression) induced by intraperitoneal administration of B2-24-4·HCl, B2-24-4-5A, B2-24-4-5A·HCOOH or HCQ to mice.
[0101] Figure 9A The photographs are of spleens of mice induced with systemic lupus erythematosus-like symptoms (saline-administered group and B2-24-4-5A·HCOOH-administered group).
[0102] Figure 9B The spleen weights of mice induced with systemic lupus erythematosus-like symptoms (saline-administered group and B2-24-4-5A·HCOOH-administered group) are shown.
[0103] Figure 9C The graph shows the ratio of activated T cells in the spleen of mice induced with systemic lupus erythematosus-like symptoms (saline-administered group and B2-24-4-5A·HCOOH-administered group).
[0104] Figure 9D The photographs show IgG deposition in the glomeruli of mice induced with systemic lupus erythematosus-like symptoms (saline-administered group and B2-24-4-5A·HCOOH-administered group).
[0105] Figure 10A Represents the survival curves of mice with systemic lupus erythematosus model (saline administration group, B2-24-4-5A·HCOOH administration group, B2-24-4·HCOOH administration group, and HCQ administration group) during the administration period.
[0106] Figure 10B Represents the serum urea nitrogen values of mice with systemic lupus erythematosus model (saline administration group, B2-24-4-5A·HCOOH administration group, B2-24-4·HCOOH administration group, and HCQ administration group).
[0107] Figure 10C Represents the serum creatinine values of mice with systemic lupus erythematosus model (saline administration group, B2-24-4-5A·HCOOH administration group, B2-24-4·HCOOH administration group, and HCQ administration group).
[0108] Figure 10D Represents the urinary albumin levels of mice with systemic lupus erythematosus model (saline administration group, B2-24-4-5A·HCOOH administration group, B2-24-4·HCOOH administration group, and HCQ administration group).
[0109] Figure 10E Is a photograph showing IgG deposition in the glomeruli of mice with systemic lupus erythematosus model (mice in the saline administration group (#1), mice in the B2-24-4-5A·HCOOH administration group (#10), mice in the B2-24-4·HCOOH administration group (#4), and mice in the HCQ administration group (#14)).
[0110] Figure 10F Is a photograph showing C3 deposition in the glomeruli of mice with systemic lupus erythematosus model (mice in the saline administration group (#1), mice in the B2-24-4-5A·HCOOH administration group (#10), mice in the B2-24-4·HCOOH administration group (#4), and mice in the HCQ administration group (#14)).
[0111] Figure 10G Represents a stained photograph of a kidney tissue section of a mouse in the saline administration group (#1).
[0112] Figure 10H Represents a stained photograph of a kidney tissue section of a mouse in the B2-24-4-5A·HCOOH administration group (#1).
[0113] Figure 11A Represents the spleen weights of mice with systemic lupus erythematosus model (saline administration group, B2-24-4-5A·HCOOH administration group, and HCQ administration group).
[0114] Figure 11B Indicates the number of splenocytes in systemic lupus erythematosus model mice (saline administration group, B2-24-4-5A·HCOOH administration group, and HCQ administration group).
[0115] Figure 12 (A) to (E) indicate the proportions of various cells in the spleen.
[0116] Figure 13 (A) to (E) indicate the proportions of various cells in the spleen.
[0117] Figure 14 (A) to (E) indicate the proportions of various cells in the spleen.
[0118] Figure 15 It is a graph showing the TLR7 inhibitory activity (inhibition of IL-6 expression) of B2-24-4-5A·HCOOH in mouse Flt-3 ligand-induced dendritic cells (FLDC).
Detailed implementation manners
[0119] <Summary and definitions>
[0120] The implementation manners of the present invention are described in detail below. It should be noted that, in order to avoid repeated descriptions of the same content, the descriptions are appropriately omitted.
[0121] For convenience, specific terms used in this application are gathered here. Unless otherwise specified, the meanings of all technical terms and scientific terms used in this application are the same as those commonly understood by those skilled in the art. Unless otherwise indicated in the context, the singular forms of "a", "an", and "the" also include the plural meanings.
[0122] The numerical ranges and parameters shown in the present invention are approximate values, but the numerical values shown in specific embodiments are recorded as accurately as possible. However, each number inherently contains certain errors, which are inevitably caused by the standard deviation that appears in each test measurement. In addition, the term "about" used in this specification generally means within 10%, 5%, 1%, or 0.5% of a given value or range. Or the term "about" means within an acceptable standard error for those skilled in the art.
[0123] In the formula, the wavy line indicates a covalent bond with the compound represented by formula (I) or (II).
[0124] <Implementation manners>
[0125] According to the present invention, there is provided a compound represented by the following formula (I) or (II), a pharmacologically acceptable salt thereof, or a prodrug thereof.
[0126] [Chemical Formula 24]
[0127]
[0128] [Chemical Formula 25]
[0129]
[0130] (In formulas (I) and (II), R1 is one of the following groups:
[0131] an alkoxy group having 3 to 5 carbon atoms and containing at least 2 oxygen atoms;
[0132] an alkoxy group having 2 to 4 carbon atoms and containing at least 1 hydroxyl group;
[0133] a group represented by the formula:
[0134] [Chemical Formula 26]
[0135]
[0136] (wherein R2 and R3 are each independently an alkyl group having 1 to 3 carbon atoms); or
[0137] a group represented by the formula:
[0138] [Chemical Formula 27]
[0139]
[0140] (wherein ring C is a 3- to 7-membered nitrogen-containing heterocycle, and R4 is a group represented by -NH-, -O-, -CF2-, -CHF-, -C2H2F2-, or -CHF-X-CHF-, and X is an alkyl group having 1 to 4 carbon atoms).)
[0141] R1 can be one of the following groups.
[0142] [Chemical Formula 28]
[0143]
[0144] [Chemical Formula 29]
[0145]
[0146] [Chemical Formula 30]
[0147]
[0148] [Chemical Formula 31]
[0149]
[0150] [Chemical Formula 32]
[0151]
[0152]
Chemical 33
[0153]
[0154]
Chemical 34
[0155]
[0156] or
[0157]
Chemical 35
[0158]
[0159] Among the above-mentioned compounds, their pharmacologically acceptable salts, or their prodrugs, the above-mentioned compound can be any one of the compounds represented by the following formulas (III) to (XIII).
[0160]
Chemical 36
[0161]
[0162]
Chemical 37
[0163]
[0164]
Chemical 38
[0165]
[0166]
Chemical 39
[0167]
[0168]
Chemical 40
[0169]
[0170]
Chemical 41
[0171]
[0172]
Chemical 42
[0173]
[0174]
Chemical 43
[0175]
[0176]
Chemical 44
[0177]
[0178]
Chemical 45
[0179]
[0180] [Chemical Formula 46]
[0181]
[0182] The compounds of the present invention can form salts, and as such salts, pharmacologically acceptable salts are preferred. There are no particular limitations on pharmacologically acceptable salts as long as they can maintain the activity of the compounds and have no adverse effects on the body. For example, salts with acids such as acetic acid, propionic acid, butyric acid, formic acid, trifluoroacetic acid, maleic acid, tartaric acid, citric acid, stearic acid, succinic acid, ethyl succinic acid, malonic acid, lactobionic acid, gluconic acid, glucoheptonic acid, benzoic acid, methanesulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid (tosylic acid), lauryl sulfate, malic acid, aspartic acid, glutamic acid, adipic acid, cysteine, N-acetylcysteine, hydrochloric acid, hydrogen bromide, phosphoric acid, sulfuric acid, hydrogen iodide, nicotinic acid, oxalic acid, picric acid, thiocyanic acid, undecanoic acid, acrylic polymer, carboxyvinyl polymer, etc.; salts with inorganic bases such as lithium, sodium, potassium, calcium, etc.; salts with organic bases such as morpholine, piperidine, etc.; salts with amino acids, etc. Salts with hydrochloric acid (hydrochloride) or salts with formic acid (formate) are preferred.
[0183] A prodrug refers to a compound that is converted into a compound represented by any one of the above formulas (I) to (XIII) through a reaction caused by an enzyme or gastric acid, etc. under physiological conditions of the body. For example, esters that are hydrolyzed in the body to liberate these compounds can be cited.
[0184] The compounds of the present invention or their salts can be solvates. The solvates are preferably non-toxic and water-soluble. As suitable solvates, for example, solvates with water, solvates with alcoholic solvents (such as methanol, ethanol, etc.) can be cited.
[0185] The present invention also provides a TLR7 activation inhibitor containing the above-mentioned compound, its pharmacologically acceptable salt, or their prodrugs. TLR7 activation may include known activities of TLR7, such as the production of cytokines such as TNF-α, IL-6, IL-12, IFN-α, or IFN-β in macrophages or dendritic cells; the production of chemokines such as CCL2, CCL5, CXCL8, or CXCL10; the enhancement of cell proliferation in B cells; the enhanced expression of co-stimulatory molecules such as CD80 or CD86; the induction of class switch or antibody production; the induction of immune anergy in T cells and other body responses. The TLR7 activation inhibitor of the present invention can inhibit the above-mentioned activation (body response), and preferably can have the effect of inhibiting the production of NF-κB, IL-6, TNF-α, or IFN-α caused by TLR7 activation. TLR7 activation inhibition means reducing the activation of TLR7 (for example, the production amount of NF-κB, IL-6, TNF-α, or IFN-α) by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or 99.9% or a range between any two values selected from the above values. The TLR7 activation inhibitor of the present invention can be used as a research reagent for analyzing TLR7 expression, function, and related signal transduction mechanisms.
[0186] The TLR7 activation inhibitor of the present invention can inhibit TLR7 activation, and thus can be used as a prophylactic or therapeutic drug for diseases accompanied by TLR7 activation. That is, the present invention also provides a prophylactic or therapeutic drug for diseases accompanied by TLR7 activation containing the above-mentioned TLR7 activation inhibitor of the present invention.
[0187] Examples of diseases accompanied by TLR7 activation include, but are not limited to, autoimmune diseases, autoinflammatory syndromes, autoimmune pancreatitis, arteriosclerosis, sepsis, neurodegenerative diseases, graft rejection, graft-versus-host disease, periodontal diseases, viral immunodeficiency, IgA nephropathy, primary nephrotic syndrome, primary membranoproliferative glomerulonephritis, purpuric nephritis, Langerhans cell histiocytosis, hemophagocytic lymphohistiocytosis, Rosai-Dorfman disease, obesity, type 2 diabetes, ulcerative colitis, etc.
[0188] The disease to be the subject of the prophylactic or therapeutic agent of the present invention is preferably an autoimmune disease. Examples of autoimmune diseases include systemic lupus erythematosus, Sjogren's syndrome, scleroderma, polymyositis / dermatomyositis, mixed connective tissue disease, overlap syndrome, antiphospholipid antibody syndrome, Behcet's disease, adult Still's disease, rheumatic fever, malignant rheumatoid arthritis, rheumatoid arthritis, juvenile rheumatoid arthritis, HLA-B27 related rheumatism (ankylosing spondylitis, Reiter's syndrome, psoriatic arthritis, etc.), IgG4 related syndrome, ANCA related vasculitis (microscopic polyangiitis, granulomatosis with polyangiitis, eosinophilic granulomatosis with polyangiitis, etc.), vasculitis syndrome (polymyalgia rheumatica, giant cell arteritis, polyarteritis nodosa, etc.), multiple sclerosis, psoriasis vulgaris, inflammatory bowel disease, autoimmune thyroid disease (Hashimoto's disease, Graves' disease, etc.), autoimmune hemolytic anemia, idiopathic thrombocytopenic purpura, primary biliary cirrhosis, primary biliary cholangitis, myasthenia gravis, Goodpasture's syndrome, Guillain-Barré syndrome, chronic atrophic gastritis, rapidly progressive glomerulonephritis, anti-glomerular basement membrane nephritis, Addison's disease, type I diabetes, vitiligo vulgaris, pemphigus vulgaris, pemphigoid, autoimmune neutropenia, autoimmune hepatitis, autoimmune pancreatitis, etc. More preferably, it is systemic lupus erythematosus.
[0189] The prophylactic or therapeutic agent of the present invention can be prepared into a preparation by using a compound represented by any one of the above formulas (I) to (XIII) as an active ingredient and appropriately formulating a pharmaceutically acceptable carrier or additive by a known manufacturing method of pharmaceutical preparations (such as the method described in the Japanese Pharmacopoeia, etc.). Specifically, for example, tablets (including sugar-coated tablets, film-coated tablets, sublingual tablets, orally disintegrating tablets, oral patches, etc.), pills, powders, granules, capsules (including soft capsules, microcapsules), lozenges, syrups, liquids, emulsions, suspensions, release control agents (such as immediate-release preparations, sustained-release preparations, sustained-release microcapsules, etc.), aerosols, films (such as orally disintegrating films, oral mucosal patches, etc.), injections (such as subcutaneous injections, intravenous injections, intramuscular injections, intraperitoneal injections, etc.), drip infusions, transdermal preparations, ointments, lotions, patches, suppositories (such as rectal suppositories, vaginal suppositories, etc.), granules, nasal preparations, pulmonary preparations (inhalants), eye drops, etc., oral or parenteral preparations can be mentioned. The mixing ratio of the carrier or additive can be appropriately set according to the range commonly used in the pharmaceutical field. There is no particular limitation on the carrier or additive that can be formulated, and for example, various carriers such as water, physiological saline, other aqueous solvents, aqueous or oily bases; various additives such as excipients, binders, pH regulators, disintegrants, absorption promoters, lubricants, coloring agents, flavoring agents, fragrances, etc. can be mentioned.
[0190] As an additive that can be mixed with tablets, capsules, etc., for example, binders such as gelatin, corn starch, tragacanth, and gum arabic can be used; excipients such as crystalline cellulose; disintegrants such as corn starch, gelatin, and alginic acid; lubricants such as magnesium stearate; sweeteners such as sucrose, lactose, or saccharin; flavoring agents such as peppermint, red sardine oil, or cherry. When the dosage form unit is a capsule, a liquid carrier such as an oil can be further contained in the above types of materials. It can be prepared according to the usual formulation steps for sterile compositions for injection (for example, dissolving or suspending the active ingredient in a solvent such as water for injection, natural vegetable oil, etc.). As an aqueous liquid for injection, for example, physiological saline, glucose, or an isotonic solution containing other adjuvants (such as D-sorbitol, D-mannitol, sodium chloride, etc.) can be used. It can also be used in combination with appropriate solubilizing aids such as alcohols (ethanol, etc.), polyols (propylene glycol, polyethylene glycol, etc.), nonionic surfactants (polysorbate 80, HCO-50, etc.). As an oily liquid, for example, sesame oil, soybean oil, etc. can be used, and it can be used in combination with benzyl benzoate, benzyl alcohol, etc. as solubilizing aids. In addition, it can also be formulated with buffers (such as phosphate buffer, sodium acetate buffer, etc.), soothing agents (such as benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (such as human serum albumin, polyethylene glycol, etc.), preservatives (such as benzyl alcohol, phenol, etc.), antioxidants, etc.
[0191] The prophylactic or therapeutic agent of the present invention can be safely administered to humans and mammals other than humans (such as rats, mice, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.).
[0192] The manufacturing method of the prophylactic or therapeutic agent of the present invention varies depending on the dosage form, administration method, carrier, etc., but it can be manufactured by adding the active ingredient in a proportion of usually 0.01 - 100% (w / w), preferably 0.1 - 95% (w / w) based on the total amount of the preparation, using conventional methods.
[0193] The dosage of the prophylactic or therapeutic agent of the present invention varies depending on the administration subject, symptoms, administration route, etc. When administered orally, usually, for example, for a person weighing about 60 kg, about 0.01 - 1000 mg is administered per day, preferably about 0.1 - 100 mg, and more preferably about 0.5 - 50 mg. When administered parenterally, the single-dose amount varies depending on the patient's condition, symptoms, administration method, etc. For example, when it is an injection, usually about 0.01 - 100 mg is intravenously administered per 1 kg of body weight, preferably about 0.01 - 50 mg, and more preferably about 0.01 - 20 mg. The total daily dosage can be a single dose or divided doses.
[0194] The prophylactic or therapeutic agent of the present invention can be used in combination with other agents. Examples of other agents include therapeutic agents for autoimmune diseases, therapeutic agents for hyperlipidemia, non-steroidal anti-inflammatory drugs, steroid drugs, etc. Among them, it is preferably used in combination with a therapeutic agent for autoimmune diseases. Examples of therapeutic agents for autoimmune diseases include steroid drugs containing glucocorticoids, non-steroidal anti-inflammatory drugs, biological agents such as antibody drugs, immunosuppressants, antimalarial drugs, etc.
[0195] The present invention includes the following inventions.
[0196] A method for inhibiting TLR7 activation, which comprises administering to a mammal an effective amount of a compound represented by any one of the above formulas (I) to (XIII), a pharmaceutically acceptable salt thereof, or a prodrug thereof.
[0197] A compound represented by any one of the above formulas (I) to (XIII), a pharmaceutically acceptable salt thereof, or a prodrug thereof for inhibiting TLR7 activation.
[0198] Use of a compound represented by any one of the above formulas (I) to (XIII), a pharmaceutically acceptable salt thereof, or a prodrug thereof in the manufacture of an inhibitor of TLR7 activation.
[0199] A method for preventing or treating a disease accompanied by TLR7 activation, which comprises administering to a mammal an effective amount of a compound represented by any one of the above formulas (I) to (XIII), a pharmaceutically acceptable salt thereof, or a prodrug thereof.
[0200] A compound represented by any one of the above formulas (I) to (XIII), a pharmaceutically acceptable salt thereof, or a prodrug thereof for preventing or treating a disease accompanied by TLR7 activation.
[0201] Use of a compound represented by any one of the above formulas (I) to (XIII), a pharmaceutically acceptable salt thereof, or a prodrug thereof in the manufacture of a prophylactic or therapeutic agent for a disease accompanied by TLR7 activation.
[0202]
Examples
[0203] Example 1: Synthesis of derivatives obtained by modifying regions a and b
[0204] Modify Figure 1 Regions a and b in CB-7 shown. The modification was entrusted to Albany Molecular Research Inc. (USA). Tables 1 and 2 show the CB-7 derivatives obtained by the modification. It should be noted that B2-24-4·HCl was obtained in the form of a hydrochloride salt.
[0205]
Table 1
[0206]
[0207]
Table 2
[0208]
[0209] Synthesis of Each Compound
[0210] The reagents were obtained commercially and used directly. Tetramethylsilane was used as an internal reference, and 1H NMR spectra were obtained using a 300 MHz Bruker AVANCE 300 spectrometer and a 400 MHz Bruker AVANCE 400 spectrometer. 1 Thin layer chromatography (TLC) was carried out using Whatman No. 4500-101 (Diamond No. MK6F silica gel 60 Å (Angstrom)) plates.
[0211] The compound names (numbered compounds) represented by ["Compound" + "number"] (e.g., Compound 1) or ["Compound Int-" + "number"] (e.g., Compound Int-1) are only valid in each synthesis example. Therefore, even if the numbered compounds in one synthesis example are the same as those in another synthesis example, their structures may be different, and even if the numbered compounds in one synthesis example are different from those in another synthesis example, their structures may be the same. In other words, the identity between numbered compounds depends on the structure.
[0212] Synthesis Example 1: Synthesis of Compounds B2-6 and B2-6A
[0213] The manufacturing methods (also referred to as Scheme 1) of Compounds B2-6 (also known as ALB-208276) and B2-6A (also known as ALB-208787) are as follows.
[0214]
Chemical Formula 47
[0215]
[0216] Manufacture of Compound 2
[0217] To a solution of (-)-β-pinene (compound 1) (100 g, 0.73 mol) dissolved in CH2Cl2 (1.0 L), MeCN (1.0 L), and H2O (1.0 L) at 0 °C was added NaIO4 (670 g, 3.13 mmol) and RuCl3·nH2O (4.95 g, 0.02 mol). The reaction mixture was stirred at room temperature for 5 h. The reaction mixture was diluted with EtOAc (1.0 L) and washed with water (500 mL) and brine (500 mL). The resulting mixture was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give compound 2 [97.0 g (crude product)] as a dark brown liquid. 1 1H NMR (400 MHz, CDCl3) δ 2.58 - 2.51 (m, 3H), 2.38 - 2.30 (m, 1H), 2.25 - 2.21 (m, 1H), 2.08 - 2.01 (m, 1H), 1.98 - 1.90 (m, 1H), 1.57 (s, 1H), 1.35 (s, 3H), 0.84 (s, 3H).
[0218] Preparation of Compound 3
[0219] A mixture of compound 2 (97.0 g, 0.70 mol), (PhSe)2 (108.57 g, 0.35 mol), SeO2 (93.10 g, 0.84 mol), and H2SO4 (29.8 mL, 0.559 mol) dissolved in MeOH (1.0 L) was stirred at room temperature for 5 h. The reaction mixture was quenched with H2O (1.0 L) and extracted with EtOAc (1 L × 2). The organic layer was washed with brine (500 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica gel (60 - 120 mesh) column chromatography using 5% EtOAc / hexane to give compound 3 (100 g, 48%) as a yellowish brown liquid. 1 1H NMR (400 MHz, CDCl3) δ 7.61 - 7.58 (m, 2H), 7.32 - 7.25 (m, 3H), 3.87 (dd, J = 1.6 Hz, 8.0 Hz, 1H), 2.71 - 2.68 (m, 1H), 2.61 - 2.52 (m, 2H), 2.24 - 2.20 (m, 2H), 1.88 (s, 1H), 1.35 (s, 3H), 0.84 (m, 3H).
[0220] Preparation of Compound 4
[0221] To a solution of compound 3 (32.50 g, 0.110 mol) dissolved in CH2Cl2 (400 mL) was added 7% H2O2 (70.00 mL, 0.160 mmol) and pyridine (12.20 mL, 0.22 mol) at 0 °C, and the mixture was stirred at room temperature for 12 h. The reaction mixture was diluted with CH2Cl2 (500 mL) and washed with water (200 mL) and brine (250 mL). The obtained organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The crude product was purified by silica gel (60 - 120 mesh) column chromatography using 0 - 5% EtOAc / hexane to give compound 4 (13.00 g, 81%) as a brown liquid. 1 1H NMR (400 MHz, CDCl3) δ 7.54 - 7.50 (m, 1H), 5.95 (d, J = 8.8 Hz, 1H), 2.86 - 2.83 (m, 1H), 2.73 - 2.57 (m, 2H), 2.13 (s, 1H), 1.51 (s, 3H), 1.04 (m, 3H).
[0222] Preparation of compound 5
[0223] To a mixture of 4 - methoxyphenylmagnesium bromide (70.60 mL, 1 M in THF, 70.6 mmol) and CuI (5.60 g, 29.4 mmol) dissolved in THF (10 mL) at - 78 °C was added a solution of compound 4 (8.00 g, 58.8 mmol) dissolved in THF (100 mL), and the mixture was stirred at - 78 °C for 2 h. The reaction mixture was quenched with saturated NH4Cl (250 mL) and extracted with EtOAc (200 mL × 2). The organic layer was washed with brine (100 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The crude product was purified by silica gel (60 - 120 mesh) column chromatography using 0 - 10% EtOAc / hexane to give compound 5 (9.00 g, 63%) as a colorless liquid. 1 1H NMR (400 MHz, CDCl3) δ 7.17 (d, J = 8.4 Hz, 2H), 6.85 (d, J = 8.4 Hz, 2H), 3.80 (s, 3H), 3.377 (t, J = 8.0 Hz, 1H), 2.81 - 2.61 (m, 3H), 2.57 - 2.51 (m, 1H), 2.39 - 2.36 (m, 1H), 1.89 (d, J = 10.8 Hz, 1H), 1.39 (s, 3H), 0.98 (m, 3H).
[0224] Preparation of compound 6
[0225] To a solution of compound 5 (10.70 g, 43.0 mmol) dissolved in Ac2O (100 mL) was added Zn(OAc)2 (8.36 g, 45.0 mmol) and BF3·OEt2 (2.81 mL, 22.0 mmol), and the mixture was stirred at room temperature for 16 hours. The reaction mixture was diluted with H2O (100 mL). The resulting mixture was extracted with EtOAc (100 mL × 2). The organic layers were combined, washed with saturated NaHCO3 (1000 mL) and brine (500 mL), dried over MgSO4, and concentrated under reduced pressure to give a residual oil. Purification by combiflash column chromatography using 0 - 10% EtOAc / hexane gave compound 6 (7.00 g, 56%) as an off-white solid. 1 1H NMR (400 MHz, CDCl3) δ 7.09 (d, J = 8.4 Hz, 2H), 6.80 (d, J = 8.8 Hz, 2H), 5.45 - 5.44 (m, 1H), 4.67 - 4.59 (m, 2H), 3.77 (s, 3H), 2.96 - 2.89 (m, 1H), 2.70 - 2.64 (m, 1H), 2.39 - 2.24 (m, 4H), 2.11 (s, 3H), 1.49 (s, 3H).
[0226] Preparation of compound 7 (also known as ALB - 208224 or I - 7 (intermediate)) To a solution of compound 6 (7.00 g, 28.0 mmol) dissolved in MeOH (100 mL) at 0 °C was added portionwise NaH (0.57 g, 60% in mineral oil, 14.0 mmol) over 30 minutes, and the mixture was stirred at room temperature for 30 minutes. The reaction mixture was quenched with saturated NH4Cl (10 mL), and MeOH was evaporated under reduced pressure. The resulting solid was filtered, washed with water (250 mL), and dried to give compound 7 (ALB - 208224 or I - 7 (intermediate)) (5.90 g, 99%) as an off-white solid. 1 1H NMR (400 MHz, CDCl3) δ 7.00 (d, J = 8.4 Hz, 2H), 6.75 (d, J = 8.8 Hz, 2H), 4.56 (d, J = 10.4 Hz, 2H), 3.71 (s, 3H), 2.89 - 2.82 (m, 1H), 2.67 - 2.60 (m, 1H), 2.45 (d, J = 10 Hz, 4H), 2.04 - 2.00 (m, 1H), 1.84 - 1.76 (m, 1H), 1.44 (s, 3H).
[0227] Preparation of compound 8
[0228] A cold solution of tosylmethyl isocyanide (2.39 g, 12.2 mmol) and tert-BuOK (2.75 g, 24.6 mmol) dissolved in THF (25 mL) was stirred for 10 minutes, and a solution of compound 7 (1.50 g, 6.14 mmol) dissolved in THF (5.0 mL) was added. After the reaction mixture was stirred at 0 °C for 10 minutes, MeOH (20 mL) was added. The resulting mixture was stirred under reflux for 1 hour and concentrated under reduced pressure. The crude product was purified by combiflash column chromatography using 0 - 30% EtOAc / hexane to give compound 8 (0.60 g, 38%) as a colorless liquid. 1 1H NMR (400 MHz, CDCl3) δ 7.05 (d, J = 8.4 Hz, 2H), 6.82 (d, J = 8.8 Hz, 2H), 4.64 (d, J = 10.4 Hz, 2H), 3.78 (s, 3H), 2.96 - 2.89 (m, 1H), 2.74 - 2.68 (m, 1H), 2.53 - 2.49 (m, 4H), 2.11 - 2.07 (m, 1H), 1.91 - 1.55 (m, 1H), 1.51 (s, 3H).
[0229] Preparation of Compound 9
[0230] To a solution of compound 8 (2.40 g, 9.41 mmol) dissolved in 2-propanol (30 mL) was added KOH (5.20 g, 94.1 mmol) at room temperature. The reaction mixture was stirred under reflux for 16 hours. The reaction mixture was diluted with cold water (100 mL) and acidified by adding HCl (2N). The resulting mixture was extracted with EtOAc (50 mL × 2). The organic layers were combined, washed with brine (100 mL), dried over MgSO4, and concentrated under reduced pressure to give compound 9 (2.20 g, 85%) as an off-white solid. 1 1H NMR (400 MHz, CDCl3) δ 7.17 (d, J = 8.8 Hz, 2H), 6.85 (d, J = 8.8 Hz, 2H), 4.64 (d, J = 10.4 Hz, 2H), 3.79 (s, 3H), 3.37 (t, J = 8.0 Hz, 2H), 2.81 - 2.54 (m, 4H), 2.39 - 2.36 (m, 1H), 1.89 (t, J = 5.4 Hz, 1H), 2.11 - 2.07 (m, 1H), 1.91 - 1.55 (m, 1H), 1.51 (s, 3H).
[0231] Preparation of Compound 10
[0232] To a cold solution of compound 9 (2.30 g, 8.424 mmol) dissolved in CH3CN (20 mL) was added dropwise K2CO3 (3.25 g, 23.58 mmol) and MeI (1.57 mL, 25.27 mmol) at 0 °C. The reaction mixture was stirred at room temperature for 12 h. The resulting mixture was extracted with EtOAc (100 mL × 3). The organic layers were combined, washed with brine (100 mL), dried over MgSO4, and concentrated under reduced pressure. The crude product was purified by combiflash column chromatography using 0 - 20% EtOAc / hexane to give compound 10 (2.20 g, 91.6%) as a pale yellow oil. 1 H NMR (400 MHz, CDCl3) δ 7.04 (d, J = 8.8 Hz, 2H), 6.79 (d, J = 8.4 Hz, 2H), 4.55 (m, 2H), 3.76 (s, 3H), 3.65 (s, 3H), 2.54 - 2.45 (m, 2H), 2.30 - 2.24 (m, 1H), 2.10 - 2.06 (m, 2H), 1.89 - 1.85 (m, 1H), 1.62 - 1.58 (m, 3H), 1.49 (s, 3H).
[0233] Preparation of compound 11
[0234] To a solution of lithium diisopropylamide (5.20 mL, 2.0 M in THF, 10.4 mmol) dissolved in THF (6.0 mL) was added dropwise a solution of compound 10 (1.00 g, 3.40 mmol) dissolved in THF (4.0 mL) at -78 °C. The reaction mixture was stirred at -78 °C for 30 min. 2-Bromo-tert-butyl acetate (1.00 mL, 6.80 mmol) was added and the reaction mixture was stirred at -78 °C for 30 min, then quenched with saturated NH4Cl solution (15 mL). The resulting mixture was extracted with EtOAc (50 mL × 3). The organic layers were combined, washed with brine (25 mL), dried over Na2SO4, and concentrated under reduced pressure. The crude product was purified by combiflash column chromatography using 0 - 10% EtOAc / hexane to give compound 11 (0.50 g, 36%) as a colorless liquid.
[0235] Preparation of compound 12
[0236] A solution of compound 11 (0.5 g, 1.24 mmol) dissolved in 2,2,2-trifluoroethanol (2.0 mL) was added dropwise with TMSCl (0.5 mL, 3.94 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 2 h. The residual solvent was evaporated, and the residue was diluted with EtOAc (15 mL) and washed with water (20 mL). The organic layer was washed with brine (15 mL) and dried over MgSO4, and concentrated under reduced pressure to give a colorless viscous substance. It was purified by combiflash column chromatography using 0 - 50% EtOAc / hexane to give compound 12 (0.40 g, 74%) as a colorless viscous substance.
[0237] Preparation of Compound 13
[0238] To a cold solution of compound 12 (0.14 g, 0.40 mmol) dissolved in CH2Cl2 (20 mL) was added TEA (0.26 mL, 1.20 mmol), T3P (50% w / w in EtOAc) (0.39 mL, 1.20 mmol) at 0 °C, and then N,N-dimethylamine (1 M in THF) (0.4 mL, 0.80 mmol) was added. The reaction mixture was stirred at room temperature for 2 h and diluted with H2O (5.0 mL). The resulting mixture was extracted with CH2Cl2 (5.0 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure. The crude product was purified by combiflash column chromatography using 0 - 60% EtOAc / hexane to give compound 13 (0.15 g, 87%) as a colorless viscous substance. ESI MS m / z 374 [M+H] + 。
[0239] Preparation of Compounds ALB-208276 (B2-6) and ALB-208787 (B2-6A) To a cold solution of compound 13 (0.13 g, 0.30 mmol) dissolved in THF (5.0 mL) was added LiAlH4 (0.50 mL, 2.0 M in THF, 0.90 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 15 min and diluted with H2O and HCl (2 N). The resulting mixture was extracted with EtOAc (10 mL × 2). The organic layers were combined, washed with brine (10 mL), dried over MgSO4, and concentrated under reduced pressure. The crude product was purified by combiflash column chromatography using 0 - 70% EtOAc / hexane to give ALB-208276 (B2-6) (0.03 g, 25%) and ALB-208787 (B2-6A) (0.015 g, 13%) as off-white and colorless viscous substances.
[0240] ALB-208276(B2-6)
[0241] 1 1H NMR (400 MHz, DMSO-d6) δ 7.05 (d, J = 8.4 Hz, 2H), 6.77 (d, J = 8.4 Hz, 2H), 4.78 (t, J = 5.2 Hz, 1H), 4.48 (d, 2H), 3.70 (s, 3H), 3.60 - 3.52 (m, 2H), 2.97 (s, 3H), 2.78 (s, 3H), 2.67 - 2.60 (m, 1H), 2.24 - 2.22 (m, 3H), 1.79 - 1.52 (m, 3H), 1.46 - 1.35 (m, 6H); ESI MS m / z 346 [M+H] + 。
[0242] ALB-208787(B2-6A)
[0243] 1 1H NMR (400 MHz, CDCl3) δ 7.06 (d, J = 8.4 Hz, 2H), 6.79 (d, J = 8.4 Hz, 2H), 4.53 (d, 2H), 3.77 (s, 3H), 3.77 - 3.60 (m, 2H), 2.71 - 2.65 (m, 1H), 2.59 - 2.41 (m, 2H), 2.32 (s, 6H), 2.27 - 2.20 (m, 1H), 1.88 - 1.83 (m, 2H), 1.68 - 1.51 (m, 3H), 1.52 (s, 3H), 1.48 - 1.42 (m, 3H); ESI MS m / z 332 [M+H] + 。
[0244] Synthesis Example 2: Synthesis of Compound B2-5A
[0245] The method for producing Compound B2-5A (also known as ALB-208786) (also known as Scheme 2) is as follows.
[0246]
Chemical Formula 48
[0247]
[0248] To a cold solution of compound Int-12 (compound 12 of Scheme 1) (0.10 g, 0.28 mmol) dissolved in THF (5.0 mL) was added LiBH4 (1.40 mL, 1.0 M in THF, 2.80 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 15 minutes, heated at 60 °C for 12 hours, and quenched with saturated NH4Cl solution (10 mL). The resulting reaction mixture was extracted with EtOAc (10 mL × 2). The extracts were combined, washed with brine (10 mL), dried over MgSO4, and concentrated under reduced pressure. The crude product was purified by combiflash column chromatography using 0 - 70% EtOAc / hexane and then subjected to mass triggered preparative-HPLC to give ALB-208786 (B2-5A) (0.005 g, 6%) as a colorless viscous substance. 1 H NMR (400 MHz, CDCl3) δ 7.03 (d, J = 8.4 Hz, 2H), 6.81 (d, J = 8.8 Hz, 2H), 4.57 (s, 2H), 4.31 - 4.27 (m, 2H), 3.78 (s, 3H), 2.53 - 2.46 (m, 1H), 2.35 - 2.23 (m, 3H), 1.93 - 1.88 (m, 2H), 1.81 - 1.77 (m, 1H), 1.67 - 1.53 (m, 3H), 1.51 (s, 3H); ESI MS m / z 301 [M + H] + 。
[0249] Synthesis Example 3: Synthesis of Compound B2-6-7
[0250] The manufacturing method (also known as Scheme 3) of compound B2-6-7 (also known as ALB-209871) is as follows.
[0251]
Chemical 49
[0252]
[0253] Synthesis of Compound 1
[0254] To a cold solution of compound Int-12 (compound 12 of Scheme 1) (0.05 g, 0.14 mmol) dissolved in CH2Cl2 (3.0 mL) was added TEA (0.04 mL, 0.29 mmol), T3P (50% w / w in EtOAc) (0.14 mL, 0.43 mmol), and then morpholine (0.02 g, 0.21 mmol) was added sequentially at 0 °C. The reaction mixture was stirred at room temperature for 2 h and diluted with H2O (5.0 mL). The resulting reaction mixture was extracted with CH2Cl2 (5.0 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure. The crude product was purified by combiflash column chromatography using 0 - 70% EtOAc / hexane to give compound 1 (0.055 g, 70%) as a colorless viscous substance. ESI MS m / z 416 [M+H] + 。
[0255] Preparation of compound ALB-209871 (B2-6-7) To a cold solution of compound 1 (0.03 g, 0.70 mmol) dissolved in THF (3.0 mL) was added LiAlH4 (0.10 mL, 2.0 M in THF, 0.21 mmol). The reaction mixture was stirred at 0 °C for 5 min and diluted with saturated NH4Cl solution (5.0 mL). The resulting reaction mixture was extracted with EtOAc (10 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure. The crude product was purified by combiflash column chromatography using 0 - 70% EtOAc / hexane to give compound ALB-209871 (B2-6-7) (0.002 g, 8%) as a pale gray transparent viscous substance. 1 H NMR (400 MHz, CDCl3) δ 7.04 (d, J = 8.4 Hz, 2H), 6.78 (d, J = 8.8 Hz, 2H), 4.61 - 4.45 (m, 3H), 3.77 - 3.53 (m, 13H), 2.74 - 2.67 (m, 1H), 2.39 - 2.20 (m, 3H), 1.96 - 1.90 (m, 2H), 1.69 - 1.54 (m, 3H), 1.51 (s, 4H); ESI MS m / z 388 [M+H] + 。
[0256] Synthesis Example 4: Synthesis of Compound B2-22
[0257] The method for preparing compound B2-22 (also known as ALB-210362) (also known as Scheme 4) is as follows.
[0258]
Chemical Formula 50
[0259]
[0260] Preparation of Compound 2
[0261] To a stirred solution of Compound 1 (15.0 g, 0.09 mol) dissolved in DMF (150 mL) was added imidazole (17.1 g, 0.29 mol) portionwise at 0 °C, and then TBDMSCl (22.2 g, 0.14 mol) was added portionwise. The reaction mixture was stirred at room temperature for 16 h, diluted with EtOAc (2 × 100 mL), and washed with saturated NaHCO3 (500 mL). The organic layers were combined, dried over anhydrous Na2SO4, and concentrated under reduced pressure. The crude product was purified by combiflash column chromatography using 0 - 50% EtOAc / hexane to give Compound 2 (12.00 g, 48%) as an off-white solid.
[0262] Preparation of Compound 3
[0263] To a solution of Compound Int-4 (Compound 4 of Scheme 1) (3.00 g, 22.00 mmol) dissolved in 1,4-dioxane (70 mL) were added Compound 2 (8.70 g, 33.0 mmol), KOH (2 M, 2.45 g, 44.00 mmol), and the mixture was degassed with argon for 15 min. The [Rh(COD)Cl]2 complex (0.33 g, 0.66 mmol) was added to the reaction mixture, stirred, and heated at reflux for 12 h. The residual solvent was evaporated. The crude product was dissolved in CH2Cl2 (250 mL), filtered through a bed of Celite. The filtrate was washed with water (250 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The crude product was purified by combiflash column chromatography using 0 - 10% EtOAc / hexane to give Compound 3 (4.60 g, 59%) as an off-white solid. ESI MS m / z 376 [M+NH4] +
[0264] Preparation of Compound 4
[0265] To a solution of compound 3 (4.00 g, 11.1 mmol) in Ac2O (20 mL) was added Zn(OAc)2 (2.24 g, 12.0 mmol) and BF3·OEt2 (1.64 mL, 13.3 mmol), and the mixture was stirred at room temperature for 12 h. The reaction mixture was diluted with H2O (100 mL). The resulting mixture was extracted with EtOAc (100 mL × 2). The organic layers were combined and washed with saturated NaHCO3 solution (250 mL) and brine (100 mL). The resulting reaction mixture was dried over MgSO4 and concentrated under reduced pressure to give a residual oil. It was purified by combiflash column chromatography using 0 - 20% EtOAc / hexane to give compound 4 (2.50 g, 78%) as an off-white solid.
[0266] Preparation of Compound 5
[0267] To a solution of compound 4 (5.00 g, 17.4 mmol) dissolved in MeOH (50 mL) was added portionwise NaH (0.70 g, 60% in mineral oil, 17.4 mmol) at 0 °C over 30 min, and the reaction mixture was stirred at room temperature for 30 min. The reaction mixture was quenched with water (10 mL) at 0 °C. The MeOH was evaporated, and the resulting solid was filtered, washed with water and then with hexane (250 mL) to give compound 5 (3.60 g, 85%) as an off-white solid. ESI MS m / z 262 [M+NH4] + 。
[0268] Preparation of Compound 6
[0269] To a cold solution of tosylmethyl isocyanide (3.90 g, 20.4 mmol) and tert-BuOK (4.59 g, 40.9 mmol) dissolved in THF (20 mL) was added a solution of compound 5 (2.50 g, 10.2 mmol) dissolved in THF (5.0 mL). The mixture was stirred at 0 °C for 10 min, and MeOH (15 mL) was added. The resulting mixture was stirred under reflux for 1 h and concentrated under reduced pressure. The crude product was purified by combiflash column chromatography using 0 - 50% EtOAc / hexane to give compound 6 (1.70 g, 65%) as a pale yellow liquid. ESI MS m / z 273 [M+NH4] + 。
[0270] Preparation of Compound 7
[0271] To a solution of compound 6 (2.60 g, 10.01 mmol) dissolved in 2-propanol (40 mL) was added KOH (5.70 g, 101.00 mmol) at room temperature. The reaction mixture was stirred under reflux for 48 hours. The residual solvent was evaporated under reduced pressure. The crude product was dissolved in EtOAc (50 mL) and washed with water (50 mL). After adding HCl (2N), the aqueous layer was neutralized and extracted with EtOAc (50 mL × 2). The organic layers were combined, washed with brine (50 mL), dried over MgSO4, and concentrated under reduced pressure to give compound 7 (1.30 g, 48%) as a pale yellow solid. ESI MS m / z 273 [M-H] + 。
[0272] Preparation of Compound 8
[0273] To a solution of compound 7 (1.30 g, 4.50 mmol) dissolved in CH3CN:MeOH (15:5 mL) was added dropwise K2CO3 (1.88 g, 13.50 mmol) and MeI (0.83 mL, 13.50 mmol) at 0 °C. The reaction mixture was stirred at room temperature for 12 hours and extracted with EtOAc (50 mL × 2). The organic layers were combined, washed with brine (50 mL), dried over MgSO4, and concentrated under reduced pressure to give compound 8 [1.10 g (crude product)] as a brown viscous substance. ESI MS m / z 271 [M+NH4] + 。
[0274] Preparation of Compound 9
[0275] To a stirred solution of compound 8 (0.70 g, 2.40 mol) dissolved in CH2Cl2 (10 mL) was added portionwise imidazole (0.35 g, 6.00 mmol) at 0 °C, followed by TBDMS-Cl (0.44 g, 2.90 mmol). The reaction mixture was heated to room temperature and stirred for 16 hours. The reaction solution was diluted with CH2Cl2 (2 × 500 mL) and washed with saturated NaHCO3 (500 mL). The organic layers were combined, dried over anhydrous Na2SO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 10% EtOAc / hexane to give compound 9 (0.63 g, 64%) as a colorless oil.
[0276] Preparation of Compound 10
[0277] To a solution of lithium diisopropylamide (6.30 mL, 2.0 M in THF, 12.60 mmol) dissolved in THF (15 mL) was added dropwise a solution of compound 9 (1.70 g, 4.20 mmol) dissolved in THF (5.0 mL) at -78 °C. The reaction mixture was stirred at -78 °C for 30 minutes, cooled to -105 °C (using MeOH, liquid N2), and phenyl vinyl sulfoxide (1.12 mL, 8.40 mmol) was added. The reaction mixture was stirred at -105 °C for 30 minutes, and saturated NH4Cl solution (15 mL) was added to the flask. The resulting mixture was extracted with EtOAc (50 mL × 2). The organic layers were combined, washed with brine (50 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 10% EtOAc / hexane to give compound 10 (0.80 g, 34%) as a pale yellow oil. ESI MS m / z 555 [M+H] + 。
[0278] Preparation of Compound 11
[0279] A mixture of compound 10 (0.80 g, 1.44 mmol) and NaHCO3 (1.20 g, 14.40 mmol) dissolved in xylene (10 mL) was stirred under reflux for 18 hours and diluted with H2O. The resulting mixture was extracted with EtOAc (30 mL × 3). The organic layers were combined, washed with brine (25 mL), dried over MgSO4, and concentrated under reduced pressure to give a residual oil. It was purified by combiflash column chromatography using 0 - 20% EtOAc / hexane to give compound 11 (0.40 g, 60%) as a colorless viscous substance.
[0280] Preparation of Compound 12
[0281] To a cold solution of compound 11 (0.40 g, 0.93 mmol) dissolved in THF (5.0 mL) was added TBAF (1.86 mL, 1 M in THF, 1.80 mmol) at 0 °C. The reaction mixture was stirred at room temperature for 6 hours and diluted with H2O. The resulting mixture was extracted with EtOAc (10 mL × 2). The organic layers were combined, washed with brine (10 mL), dried over MgSO4, and concentrated under reduced pressure to give a residual oil. It was purified by combiflash column chromatography using 0 - 30% EtOAc / hexane to give compound 12 (0.15 g, 51%) as a colorless oil. ESI MS m / z 332 [M+NH4] + 。
[0282] Preparation of Compound 13
[0283] To a cold solution of compound 12 (0.135 g, 0.40 mmol) dissolved in CH2Cl2 (5.0 mL) was added Dess-Martin periodinane (0.40 g, 0.90 mmol) at 0 °C. The reaction mixture was stirred at room temperature for 2 h. The reaction mixture was quenched with saturated Na2S2O3 (5.0 mL) and saturated NaHCO3 solution (5.0 mL), and extracted with CH2Cl2 (10 mL × 2). After combining the organic layers, they were washed with brine (10 mL), dried over MgSO4, and concentrated under reduced pressure to give compound 13 (0.11 g, 82%) as a colorless oil. ESI MS m / z 313 [M+H] + 。
[0284] Preparation of compound 14
[0285] To a solution of compound 13 (0.025 g, 0.06 mmol) dissolved in MeOH (5.0 mL) and a small amount of AcOH was added diethylamine (0.009 g, 0.12 mmol) at room temperature, followed by NaCNBH3 (0.016 g, 0.25 mmol). The reaction mixture was stirred at room temperature for 48 h. The MeOH was evaporated under reduced pressure and diluted with H2O. The resulting mixture was extracted with EtOAc (10 mL × 2). After combining the organic layers, they were washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure to give compound 14 [0.025 g (crude product)] as a colorless viscous substance. ESI MS m / z 370 [M+H] + 。
[0286] Preparation of compound ALB-210362 (B2-22)
[0287] To a cold solution of compound 14 (0.025 g, 0.06 mmol) dissolved in THF (4.0 mL) was added LiAlH4 (0.08 mL, 2.0 M in THF, 0.16 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 15 min and quenched with HCl solution (2 N, 3 mL). The resulting mixture was extracted with EtOAc (5.0 mL × 2). After combining the organic layers, they were washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by mass-triggered preparative-HPLC to give compound ALB-210362 (B2-22) (0.0055 g, 26%) as a colorless viscous substance. 11H NMR (400 MHz, CDCl3) δ 7.25 (d, J = 8.0 Hz, 2H), 7.10 (d, J = 8.0 Hz, 2H), 5.78 - 5.71 (m, 1H), 5.16 - 5.05 (m, 2H), 4.52 (d, 2H), 3.70 - 3.64 (m, 4H), 2.75 - 2.69 (m, 1H), 2.64 - 2.50 (m, 4H), 2.30 - 2.24 (m, 1H), 1.90 - 1.86 (m, 2H), 1.70 - 1.64 (m, 3H), 1.51 (s, 3H), 1.47 - 1.41 (m, 2H), 1.108 (t, J = 7.2 Hz, 6H); ESI MS m / z 342
[0288] [M + H] + 。
[0289] Synthesis Example 5: Synthesis of Compound B2 - 24 - 1
[0290] The production method (also referred to as Scheme 5) of compound B2 - 24 - 1 (also known as ALB - 210798) is as follows.
[0291]
Chemical Formula 51
[0292]
[0293] Production of Compound 1
[0294] To a solution of compound Int - 13 (compound 13 of Scheme 4) (0.025 g, 0.08 mmol) dissolved in MeOH (4.0 mL) and a small amount of AcOH was added 4,4 - difluoropiperidine hydrochloride (0.025 g, 0.12 mmol) at room temperature, and then NaCNBH3 (0.016 g, 0.25 mmol) was added. The reaction mixture was stirred at room temperature for 16 hours. The MeOH was evaporated and diluted with H2O. The resulting mixture was extracted with EtOAc (10 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure to obtain compound 1 [0.025 g (crude product)] as a colorless viscous substance. ESI MS m / z 418 [M + H] + 。
[0295] Production of Compound ALB - 210798 (B2 - 24 - 1)
[0296] To a cold solution of Compound 1 (0.025 g, 0.05 mmol) dissolved in THF (4.0 mL) was added LiAlH4 (0.07 mL, 2.0 M in THF, 0.14 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 30 minutes, and the reaction was quenched with saturated NH4Cl solution (5.0 mL). The resulting mixture was extracted with EtOAc (5.0 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by mass-triggered preparative-HPLC to give Compound ALB-210798 (B2-24-1) (0.007 g, 26%) as an off-white solid. 1 1H NMR (400 MHz, CDCl3) δ 7.17 (d, J = 8.0 Hz, 2H), 7.09 (d, J = 8.0 Hz, 2H), 5.77 - 5.70 (m, 1H), 5.16 - 5.04 (m, 2H), 4.53 (d, 2H), 3.70 (m, 2H), 3.50 (s, 2H), 2.76 - 2.70 (m, 1H), 2.57 - 2.49 (m, 4H), 2.35 - 2.25 (m, 1H), 2.02 - 1.87 (m, 6H), 1.70 - 1.64 (m, 2H), 1.51 (s, 3H), 1.47 - 1.44 (m, 2H); ESI MS m / z 390 [M+H] + 。
[0297] Synthesis Example 6: Synthesis of Compound B2-24-2
[0298] The method for producing Compound B2-24-2 (also known as ALB-210361) (also known as Scheme 6) is as follows.
[0299]
Chemical Formula 52
[0300]
[0301] Production of Compound 1
[0302] To a solution of compound Int-13 (compound 13 in Scheme 4) (0.025 g, 0.08 mmol) dissolved in MeOH (4.0 mL) and a small amount of AcOH was added morpholine (0.014 g, 0.12 mmol) at room temperature, and then NaCNBH3 (0.016 g, 0.25 mmol) was added. The reaction mixture was stirred at room temperature for 16 h. The MeOH was evaporated and diluted with H2O. The resulting mixture was extracted with EtOAc (10 mL×2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure to give compound 1 [0.025 g (crude product)] as a colorless viscous substance. ESI MS m / z 384 [M+H] + .
[0303] Preparation of compound ALB-210361 (B2-24-2)
[0304] To a cold solution of compound 1 (0.025 g, 0.05 mmol) dissolved in THF (4.0 mL) was added LiAlH4 (0.10 mL, 2.0 M in THF, 0.19 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 30 min and the reaction was quenched with saturated NH4Cl solution (5.0 mL). The resulting mixture was extracted with EtOAc (5.0 mL×2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by mass-triggered preparative HPLC to give compound ALB-210361 (B2-24-2) (0.007 g, 26%) as an off-white solid. 1 1H NMR (400 MHz, CDCl3) δ 7.19 (d, J = 8.0 Hz, 2H), 7.09 (d, J = 8.0 Hz, 2H), 5.78 - 5.70 (m, 1H), 5.16 - 5.04 (m, 2H), 4.53 (d, 2H), 3.70 (m, 6H), 3.47 (s, 2H), 2.76 - 2.70 (m, 1H), 2.44 - 2.25 (m, 5H), 1.91 - 1.85 (m, 2H), 1.70 - 1.64 (m, 3H), 1.50 (s, 3H), 1.47 - 1.41 (m, 2H); ESI MS m / z 356 [M+H] + .
[0305] Synthesis Example 7: Synthesis of compound B2-24-3
[0306] The manufacturing method of compound B2-24-3 (also known as ALB-210795) (also known as Scheme 7) is as follows.
[0307]
Chemical 53
[0308]
[0309] Preparation of Compound 1
[0310] To a solution of Compound Int-13 (Compound 13 in Scheme 4) (0.025 g, 0.08 mmol) dissolved in MeOH (4.0 mL) and a small amount of AcOH was added 3,3-difluoroazetidine hydrochloride (0.02 g, 0.12 mmol) at room temperature, and then NaCNBH3 (0.016 g, 0.25 mmol) was added. The reaction mixture was stirred at room temperature for 16 h. The MeOH was evaporated and diluted with H2O. The resulting mixture was extracted with EtOAc (10 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure to give Compound 1 [0.025 g (crude product)] as a colorless viscous substance. ESI MS m / z 390 [M+H] + 。
[0311] Preparation of Compound ALB-210795 (B2-24-3) To a cold solution of Compound 1 (0.025 g, 0.05 mmol) dissolved in THF (4.0 mL) was added LiAlH4 (0.08 mL, 2.0 M in THF, 0.15 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 30 min and the reaction was quenched with saturated NH4Cl solution (5.0 mL). The resulting mixture was extracted with EtOAc (5.0 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by mass-triggered preparative-HPLC to give Compound ALB-210795 (B2-24-3) (0.005 g, 26%) as an off-white solid. 1 1H NMR (400 MHz, CDCl3) δ 7.16 (d, J = 8.0 Hz, 2H), 7.09 (d, J = 8.0 Hz, 2H), 5.77 - 5.70 (m, 1H), 5.15 - 5.04 (m, 2H), 4.53 (d, 2H), 3.69 (s, 2H), 3.67 (s, 2H), 3.57 (t, J = 12.0 Hz, 4H), 2.76 - 2.69 (m, 1H), 2.30 - 2.24 (m, 1H), 1.91 - 1.87 (m, 2H), 1.70 - 1.64 (m, 3H), 1.50 (s, 3H), 1.47 - 1.41 (m, 2H); ESI MS m / z 362 [M+H] + 。
[0312] Synthesis Example 8: Synthesis of Compound B2-24-4·HCl
[0313] The method for manufacturing compound B2-24-4·HCl (also known as ALB-210796) (also known as Scheme 8) is as follows.
[0314]
Chemical Formula 54
[0315]
[0316] Manufacture of Compound 1
[0317] To a solution of compound Int-13 (compound 13 of Scheme 4) (0.035 g, 0.11 mmol) dissolved in MeOH (5.0 mL) and a small amount of AcOH, tert-butyl piperazine-1-carboxylate (0.041 g, 0.22 mmol) was added at room temperature, and then NaCNBH3 (0.022 g, 0.30 mmol) was added. The reaction mixture was stirred at room temperature for 16 hours. The MeOH was evaporated and diluted with H2O. The resulting mixture was extracted with EtOAc (10 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure to obtain compound 1 [0.050 g (crude product)] as a colorless viscous substance. ESI MS m / z 483 [M+H] + 。
[0318] Manufacture of Compound 2
[0319] To a cold solution of compound 1 (0.050 g, 0.10 mmol) dissolved in THF (4.0 mL) at 0 °C, LiAlH4 (0.15 mL, 2.0 M in THF, 0.31 mmol) was added. The reaction mixture was stirred at 0 °C for 30 minutes, and the reaction was quenched with saturated NH4Cl solution (5.0 mL). The resulting mixture was extracted with EtOAc (5.0 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by mass-triggered preparative-HPLC to obtain compound 2 (0.005 g, 26%) as a colorless viscous substance. ESI MS m / z 455 [M+H] + 。
[0320] Manufacture of Compound ALB-210796 (B2-24-4·HCl)
[0321] To a cold solution of Compound 2 (0.050 g, 0.10 mmol) dissolved in CH2Cl2 (5.0 mL) was added dioxane·HCl (4 N, 0.5 mL) at 0 °C. The reaction mixture was stirred at room temperature for 3 hours. The residual solvent was evaporated under reduced pressure. The crude product was washed with 30% CH2Cl2 dissolved in hexane and purified by mass-triggered preparative HPLC to obtain Compound ALB-210796 (B2-24-4·HCl) (0.012 g, 27%) as an off-white solid. 1 1H NMR (400 MHz, DMSO-d6) δ 7.15 - 7.10 (m, 4H), 5.88 - 5.81 (m, 1H), 4.94 - 4.89 (m, 2H), 4.54 - 4.44 (d, 2H), 3.54 (s, 2H), 3.39 (s, 2H), 2.84 (t, J = 4.4 Hz, 4H), 2.78 - 2.67 (m, 1H), 2.37 - 2.27 (m, 5H), 1.77 - 1.51 (m, 4H), 1.49 (s, 3H), 1.41 - 1.25 (m, 2H); ESI MS m / z 355 [M + H] + 。
[0322] Synthesis Example 9: Synthesis of Compound B2-13
[0323] The manufacturing method (also known as Scheme 9) of Compound B2-13 (also known as ALB-209346) is as follows.
[0324]
Chemical Formula 55
[0325]
[0326] Manufacture of Compound 2
[0327] To a suspension of Compound Int-12 (Compound 12 of Scheme 4) (0.025 g, 0.07 mmol) and NaH (0.012 g, 60% in mineral oil, 0.32 mmol) dissolved in DMF (1.0 mL) at 0 °C was added Compound 1 (0.022 g, 0.15 mmol) at 0 °C to obtain a reaction mixture. The reaction mixture was heated to room temperature, stirred for 6 hours, and the reaction was quenched by adding HCl solution (1 N, 5.0 mL). The resulting mixture was extracted with EtOAc (10 mL × 3). The organic layers were combined, dried over MgSO4, and concentrated under reduced pressure to obtain a residue. The residue was purified by combiflash column chromatography using 0 - 30% EtOAc / hexane to obtain Compound 2 (0.015 g, 51%) as a colorless oil. ESI MS m / z 390 [M + NH4] + 。
[0328] Preparation of Compound ALB-209346 (B2-13)
[0329] To a cold solution of Compound 2 (0.015 g, 0.04 mmol) dissolved in THF (5.0 mL) was added LiAlH4 (2.0 M in THF, 0.06 mL, 0.12 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 15 minutes, and the reaction was quenched with saturated NH4Cl (10 mL). The resulting mixture was extracted with EtOAc (10 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 50% EtOAc / hexane to give Compound ALB-209346 (B2-13) (0.0085 g, 43%) as a colorless viscous substance. 1 1H NMR (400 MHz, CDCl3) δ 7.23 (d, J = 8.0 Hz, 2H), 7.11 (d, J = 8.0 Hz, 2H), 5.77 - 5.70 (m, 1H), 5.15 - 5.04 (m, 2H), 4.54 (d, 2H), 4.51 (s, 2H), 3.69 (s, 2H), 3.69 - 3.57 (m, 4H), 3.38 (s, 3H), 2.77 - 2.70 (m, 1H), 2.33 - 2.26 (m, 1H), 1.91 - 1.84 (m, 2H), 1.70 - 1.60 (m, 2H), 1.52 (s, 3H), 1.48 - 1.41 (m, 2H); ESI MS m / z 362 [M + NH4] + 。
[0330] Synthesis Example 10: Synthesis of Compound B2-26
[0331] The manufacturing method of Compound B2-26 (also known as ALB-209873) (also known as Scheme 10) is as follows.
[0332]
Chemical Formula 56
[0333]
[0334] Preparation of Compound 2
[0335] To a stirred solution of Compound 1 (0.50 g, 3.60 mmol) dissolved in CH2Cl2 (10 mL) was added imidazole (0.53 g, 9.00 mmol) portionwise at 0 °C, and then TBDMSCl (0.65 g, 4.30 mmol) was added portionwise. The reaction mixture was stirred at room temperature for 16 h, diluted with CH2Cl2 (50 mL), washed with saturated NaHCO3 (50 mL), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 20% EtOAc / hexane to give Compound 2 (0.5 g, 54%) as a colorless oil.
[0336] Preparation of Compound 3
[0337] To a solution of Compound Int-12 (Compound 12 in Scheme 4) (0.04 g, 0.13 mmol) dissolved in DMF (3.0 mL) was added NaH (0.02 g, 60% in mineral oil, 0.51 mmol) at 0 °C, and the mixture was stirred for 15 min. Compound 2 (0.064 g, 0.25 mmol) was added to the reaction mixture at 0 °C. The reaction was carried out at room temperature for 6 h and quenched by adding HCl (2 N, 5.0 mL). The resulting mixture was extracted with EtOAc (10 mL × 3), dried over MgSO4, and concentrated under reduced pressure to give a residue. The residue was purified by combiflash column chromatography using 0 - 30% EtOAc / hexane to give Compound 3 (0.025 g, 40%) as a colorless oil. ESI MS m / z 487 [M+H] + 。
[0338] Preparation of Compound 4
[0339] To a cold solution of Compound 3 (0.025 g, 0.05 mmol) dissolved in THF (3.0 mL) was added LiAlH4 (2.0 M in THF, 0.08 mL, 0.15 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 15 min and quenched with saturated NH4Cl (10 mL). The resulting mixture was extracted with EtOAc (10 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 40% EtOAc / hexane to give Compound 4 (0.02 g, 85%) as a colorless oil.
[0340] Preparation of Compound ALB-209873 (B2-26)
[0341] To a cold solution of Compound 4 (0.02 g, 0.04 mmol) dissolved in THF (2.0 mL) was added TBAF (0.08 mL, 1 M in THF, 0.08 mmol) at 0 °C. The reaction mixture was stirred at room temperature for 8 hours and diluted with H2O (5.0 mL). The resulting mixture was extracted with EtOAc (10 mL × 2). After combining the extracts, they were washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure to give a residual oil. This was purified by combiflash column chromatography using 0 - 50% EtOAc / hexane to give Compound ALB - 209873 (B2 - 26) (0.009 g, 60%) as a colorless viscous substance. 1 H NMR (400 MHz, CDCl3) δ 7.21 (d, J = 8.0 Hz, 2H), 7.12 (d, J = 8.0 Hz, 2H), 5.77 - 5.70 (m, 1H), 5.15 - 5.04 (m, 2H), 4.54 (d, 2H), 4.47 (s, 2H), 3.78 (t, J = 5.6 Hz, 2H), 3.70 (s, 2H), 3.65 (t, J = 6.0 Hz, 2H), 2.75 - 2.71 (m, 1H), 2.33 - 2.26 (m, 1H), 1.91 - 1.83 (m, 4H), 1.70 - 1.60 (m, 2H), 1.52 (s, 3H), 1.48 - 1.41 (m, 2H); ESI MS m / z 362 [M + NH4] + 。
[0342] Synthesis Example 11: Synthesis of Compound B2 - 24
[0343] The method for manufacturing Compound B2 - 24 (also known as ALB - 209348) (also known as Scheme 11) is as follows.
[0344]
Chemical Formula 57
[0345]
[0346] Manufacture of Compound 1
[0347] To a cold solution of compound Int-8 (compound 8 in Scheme 4) (0.28 g, 0.97 mmol) dissolved in CH2Cl2 (10 mL) was added Dess-Martin periodinane (0.82 g, 1.90 mmol) at 0 °C. The reaction mixture was heated to room temperature and stirred at the same temperature for 2 h. The reaction mixture was quenched with saturated Na2S2O3 solution (5.0 mL) and saturated NaHCO3 solution (5.0 mL), and extracted with CH2Cl2 (10 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure to give compound 1 (0.2 g, 72%) as a colorless oil. ESI MS m / z 287 [M+H] + 。
[0348] Preparation of compound 2
[0349] To a solution of compound 1 (0.2 g, 0.69 mmol) dissolved in MeOH (5.0 mL) and a small amount of AcOH was added pyrrolidine (0.10 mL, 1.30 mmol) at room temperature, and then NaCNBH3 (0.13 g, 2.08 mmol) was added. The reaction mixture was stirred at room temperature for 16 h. The MeOH was evaporated and diluted with H2O. The resulting mixture was extracted with EtOAc (10 mL × 2). The organic layers were combined, washed with brine (10 mL), dried over MgSO4, and concentrated under reduced pressure to give a residual oil. It was purified by combiflash column chromatography using 0 - 90% EtOAc / hexane to give compound 2 (0.15 g, 63%) as a colorless viscous substance. ESI MS m / z 342 [M+H] + 。
[0350] Preparation of compound 3
[0351] To a solution of lithium diisopropylamide (0.65 mL, 2.0 M in THF, 1.30 mmol) dissolved in THF (5.0 mL) was added dropwise a solution of compound 2 (0.15 g, 0.43 mmol) dissolved in THF (4.0 mL) at -78 °C. The solution was stirred at -78 °C for 30 min, then cooled to -105 °C (MeOH, liquid N2), and phenyl vinyl sulfoxide (0.12 mL, 0.87 mmol) was added. The reaction mixture was stirred at -105 °C for 30 min and quenched with saturated NH4Cl solution (15 mL). The resulting mixture was extracted with EtOAc (20 mL × 2). The organic layers were combined, washed with brine (10 mL), dried over MgSO4, and concentrated under reduced pressure to give compound 3 [0.2 g (crude product)] as a brown oil. ESI MS m / z 494 [M+H] + 。
[0352] Preparation of Compound 4
[0353] A solution of Compound 3 [0.20 g (crude product), 0.40 mmol] and NaHCO3 (0.34 g, 4.00 mmol) dissolved in xylene (5.0 mL) was stirred under reflux for 16 h and diluted with H2O. The resulting mixture was extracted with EtOAc (30 mL × 3). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure to give Compound 4 [0.10 g (crude product)] as a brown liquid. ESI MS m / z 368 [M+H] + 。
[0354] Preparation of Compound ALB-209348 (B2-24)
[0355] To a cold solution of Compound 4 (0.06 g, 0.12 mmol) dissolved in THF (2.0 mL) was added LiAlH4 (0.18 mL, 2.0 M in THF, 0.36 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 15 min and the reaction was quenched with saturated NH4Cl solution (5.0 mL). The resulting mixture was extracted with EtOAc (5.0 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by mass-triggered preparative-HPLC to give Compound ALB-209348 (B2-24) (0.007 g, 8%) as a colorless viscous substance. 1 H NMR (400 MHz, CDCl3) δ 7.31 (d, J = 8.0 Hz, 2H), 7.21 (d, J = 8.0 Hz, 2H), 5.78 - 5.71 (m, 1H), 5.17 - 5.05 (m, 2H), 4.52 (d, 2H), 4.03 - 3.99 (m, 2H), 3.80 - 3.63 (m, 3H), 3.09 - 3.05 (m, 3H), 2.79 - 2.74 (m, 1H), 2.31 - 2.25 (m, 1H), 2.08 - 2.04 (m, 4H), 1.91 - 1.87 (m, 3H), 1.70 - 1.64 (m, 2H), 1.51 (s, 3H), 1.48 - 1.41 (m, 2H); ESI MS m / z 340 [M+H] + 。
[0356] Synthesis Example 12: Synthesis of Compound B2-5A-9
[0357] The method for preparing Compound B2-5A-9 (also known as ALB-210799) (also known as Scheme 12) is as follows.
[0358]
Chemical 58
[0359]
[0360] Preparation of Compound 1
[0361] To a solution of lithium diisopropylamide (3.73 mL, 2.0 M in THF, 7.40 mmol) dissolved in THF (6.0 mL) was added dropwise a solution of Compound Int-9 (Compound 9 in Scheme 4) [1.0 g (crude product), 2.48 mmol] dissolved in THF (4.0 mL) at -78 °C. The solution was stirred at -78 °C for 30 minutes, and tert-butyl 2-bromoacetate (1.00 mL, 4.90 mmol) was added to the reaction mixture. The reaction mixture was stirred at -78 °C for 30 minutes, and the reaction was quenched with saturated NH4Cl solution (15 mL). The resulting mixture was extracted with EtOAc (50 mL × 2). After combining the organic layers, they were washed with brine (25 mL), dried over Na2SO4, and concentrated under reduced pressure to obtain Compound 1 [0.90 g (crude product)] as a brown liquid.
[0362] Preparation of Compound 2
[0363] To a cold solution of Compound 10 (0.90 g, 1.70 mmol) dissolved in THF (15 mL) was added TBAF (5.20 mL, 1 M in THF, 5.20 mmol) at 0 °C. The reaction mixture was stirred at room temperature for 12 hours and diluted with H2O. The resulting mixture was extracted with EtOAc (50 mL × 2). After combining the organic layers, they were washed with brine (25 mL), dried over MgSO4, and concentrated under reduced pressure to obtain a residual oil. It was purified by combiflash column chromatography using 0 - 30% EtOAc / hexane to obtain Compound 2 (0.40 g, 40%) as a colorless viscous substance.
[0364] Preparation of Compound 3
[0365] To a cold solution of Compound 2 (0.15 g, 0.40 mmol) dissolved in CH2Cl2 (5.0 mL) was added Dess-Martin reagent (0.32 g, 0.80 mmol) at 0 °C. The reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was quenched with saturated Na2S2O3 (10 mL) and saturated NaHCO3 (10 mL) solutions, and extracted with CH2Cl2 (10 mL × 2). After combining the organic layers, they were washed with brine (10 mL), dried over MgSO4, and concentrated under reduced pressure to obtain Compound 3 [0.15 g (crude product)] as a colorless oil.
[0366] Preparation of Compound 4
[0367] To a solution of compound 3 (0.15 g, 3.70 mmol) dissolved in MeOH (5.0 mL) and a small amount of AcOH was added pyrrolidine (0.06 g, 7.50 mmol) at room temperature, and then NaCNBH3 (0.07 g, 1.13 mmol) was added. The reaction mixture was stirred at room temperature for 18 h. The MeOH was evaporated and diluted with H2O. The resulting mixture was extracted with EtOAc (10 mL×2). The combined organic layers were washed with brine (10 mL), dried over MgSO4, and concentrated under reduced pressure to give a colorless oil. It was purified by combiflash column chromatography using 0 - 90% EtOAc / hexane to give compound 4 (0.15 g, 88%) as a colorless viscous substance. ESIMS m / z 456 [M+H] + 。
[0368] Preparation of Compound 5
[0369] To a cold solution of compound 4 (0.13 g, 0.28 mmol) dissolved in THF (4.0 mL) was added LiAlH4 (2.0 M in THF, 0.90 mL, 0.85 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 3 min and the reaction was quenched with saturated NH4Cl solution (5.0 mL). The resulting mixture was extracted with EtOAc (10 mL×2). The combined organic layers were washed with brine (15 mL), dried over MgSO4, and concentrated under reduced pressure to give compound 5 [0.08 g (crude product)] as a colorless oil. ESI MS m / z 428 [M+H] + 。
[0370] Preparation of Compound ALB - 210799 (B2 - 5A - 9)
[0371] To a solution of compound 5 (0.08 g, 0.18 mmol) dissolved in CH2Cl2 (5.0 mL) was added p - toluenesulfonic acid (0.040 g, 0.37 mmol) at room temperature. The reaction mixture was stirred at room temperature for 12 h. The reaction mixture was quenched with saturated NaHCO3 solution (10 mL) and extracted with CH2Cl2 (10 mL×2). The combined organic layers were washed with brine (10 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by mass - triggered preparative - HPLC to give compound ALB - 210799 (B2 - 5A - 9) (0.00775 g, 8%) as an off - white solid. 11H NMR (400 MHz, CDCl3) δ 7.22 (d, J = 8.0 Hz, 2H), 7.04 (d, J = 8.0 Hz, 2H), 4.55 (s, 2H), 4.28 (q, J = 8.0 Hz, 2H), 3.58 (s, 2H), 2.56 - 2.50 (m, 5H), 2.35 - 2.25 (m, 3H), 1.93 - 1.89 (m, 2H), 1.82 - 1.78 (m, 5H), 1.70 - 1.53 (m, 3H), 1.48 (s, 3H); ESI MS m / z 354 [M + H] + 。
[0372] Synthesis Example 13: Synthesis of Compound B2-5A-6
[0373] The method for producing compound B2-5A-6 (also known as ALB-211297) (also known as Scheme 13) is as follows.
[0374] [Chemical Formula 59]
[0375]
[0376] Production of Compound 1
[0377] To a solution of compound Int-3 (compound 3 of Scheme 12) (0.10 g, 0.25 mmol) dissolved in MeOH (5.0 mL) and a small amount of AcOH, diethylamine (0.05 g, 0.50 mmol) was added at room temperature, and then NaCNBH3 (0.05 g, 0.75 mmol) was added. The reaction mixture was stirred at room temperature for 48 hours. The MeOH was evaporated and diluted with H2O. The resulting mixture was extracted with EtOAc (10 mL × 2). After mixing the organic layers, they were washed with brine (10 mL), dried over MgSO4, and concentrated under reduced pressure to obtain a colorless oil. It was purified by combiflash column chromatography using 0 - 90% EtOAc / hexane to obtain compound 1 (0.06 g, 52%) as a colorless viscous substance. ESI MS m / z 458 [M + H] + 。
[0378] Production of Compound 2
[0379] To a cold solution of Compound 1 (0.06 g, 0.13 mmol) dissolved in THF (4.0 mL) was added LiAlH4 (2.0 M in THF, 0.39 mL, 0.39 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 3 minutes, and the reaction was quenched with saturated NH4Cl (5.0 mL). The resulting mixture was extracted with EtOAc (10 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure to give Compound 2 [0.05 g (crude product)] as a colorless oil. ESI MS m / z 430 [M+H] + 。
[0380] Preparation of Compound ALB-211297 (B2-5A-6)
[0381] To a solution of Compound 2 (0.05 g, 0.11 mmol) dissolved in CH2Cl2 (5.0 mL) was added p-toluenesulfonic acid (0.03 g, 0.23 mmol) at room temperature. The reaction mixture was stirred at room temperature for 12 hours. The reaction mixture was quenched with saturated NaHCO3 solution (5.0 mL) and extracted with CH2Cl2 (10 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by mass-triggered preparative HPLC to give Compound ALB-211297 (B2-5A-6) (0.0075 g, 8%) as an off-white solid. 1 H NMR (400 MHz, CDCl3) δ 7.22 - 7.20 (d, J = 8.0 Hz, 2H), 7.05 - 7.03 (d, J = 8.0 Hz, 2H), 4.55 (s, 2H), 4.28 (q, J = 8.0 Hz, 2H), 3.51 (s, 2H), 2.53 - 2.48 (m, 5H), 2.35 - 2.25 (m, 3H), 1.93 - 1.90 (m, 2H), 1.81 - 1.77 (m, 1H), 1.70 - 1.53 (m, 3H), 1.49 (s, 3H), 1.03 (t, 6H). ESI MS m / z 356 [M+H] + 。
[0382] Synthesis Example 14: Synthesis of Compound B2-5A-4
[0383] The manufacturing method of Compound B2-5A-4 (also known as ALB-211299) (also known as Scheme 14) is as follows.
[0384]
Chemical 60
[0385]
[0386] Preparation of Compound 2
[0387] To a suspension of Compound Int-2 (Compound 2 of Scheme 12) (0.08 g, 0.19 mmol) and NaH (0.016 g, 60% in mineral oil, 0.39 mmol) dissolved in DMF (3.0 mL) was added Compound 1 (0.037 g, 0.39 mmol) at 0 °C to obtain a reaction mixture. The reaction was carried out at room temperature for 6 h and quenched by adding saturated NH4Cl solution (5.0 mL). The resulting mixture was extracted with EtOAc (10 mL × 3). After mixing the organic layers, it was dried over MgSO4 and concentrated under reduced pressure to obtain a residue. It was purified by combiflash column chromatography using 0 - 30% EtOAc / hexane to obtain Compound 2 (0.04 g, 50%) as a colorless oil. ESI MS m / z 478 [M+NH4] + 。
[0388] Preparation of Compound 3
[0389] To a cold solution of Compound 2 (0.04 g, 0.08 mmol) dissolved in THF (4.0 mL) was mixed with LiAlH4 (2.0 M in THF, 0.26 mL, 0.26 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 3 min and quenched by adding saturated NH4Cl solution (5.0 mL). The resulting mixture was extracted with EtOAc (10 mL × 2). The organic layers were mixed, washed with brine (5.0 mL), dried over MgSO4 and concentrated under reduced pressure to obtain Compound 3 (0.018 g, 49%) as a colorless oil. ESI MS m / z 450 [M+NH4] + 。
[0390] Preparation of Compound ALB-211299 (B2-5A-4)
[0391] To a solution of Compound 3 (0.018 g, 0.04 mmol) dissolved in CH2Cl2 (5.0 mL) was added p-toluenesulfonic acid (0.007 g, 0.08 mmol) at room temperature. The reaction mixture was stirred at room temperature for 12 h. The reaction mixture was quenched by adding saturated NaHCO3 solution (5.0 mL) and extracted with CH2Cl2 (10 mL × 2). The organic layers were mixed, washed with brine (5.0 mL), dried over MgSO4 and concentrated under reduced pressure. The residue was purified by mass-triggered preparative HPLC to obtain Compound ALB-211299 (B2-5A-4) (0.012 g, 72%) as an off-white solid. 11H NMR (400 MHz, CDCl3) δ 7.27 (d, J = 8.0 Hz, 2H), 7.10 (d, J = 8.0 Hz, 2H), 4.58 (d, J = 4.0 Hz, 2H), 4.54 (s, 2H), 4.31 (q, J = 8.0 Hz, 2H), 3.64 - 3.62 (m, 2H), 3.60 - 3.58 (m, 2H), 3.41 (s, 3H), 2.60 - 2.53 (m, 1H), 2.37 - 2.29 (m, 3H), 1.96 - 1.89 (m, 2H), 1.84 - 1.80 (m, 1H), 1.70 - 1.60 (m, 3H), 1.50 (s, 3H); ESI MS m / z 376 [M+NH4] + 。
[0392] Synthesis Example 15: Synthesis of Compound B2-29
[0393] The production method (also referred to as Scheme 15) of Compound B2-29 (also known as ALB-210364) is as follows.
[0394] [Chemical 61]
[0395]
[0396] Production of Compound 2
[0397] To a solution of Compound 1 (0.50 g, 3.27 mmol) dissolved in CH2Cl2 (10 mL) was added imidazole (0.55 g, 8.16 mmol) at 0 °C, and then TBDMSCl (0.59 g, 3.92 mmol) was added. The reaction mixture was stirred at room temperature for 16 hours, diluted with CH2Cl2 (25 mL), and washed with saturated NaHCO3 (20 mL). The reaction mixture was dried over Na2SO4 and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 40% EtOAc / hexane to obtain Compound 2 (0.50 g, 57%) as a colorless liquid.
[0398] Production of Compound 3
[0399] To a cold solution of Compound Int-10 (Compound 10 of Scheme 1) (0.20 g, 0.69 mmol) dissolved in THF (5.0 mL) was added dropwise LDA (1.04 mL, 2.0 M in THF, 2.08 mmol) at -78 °C. The solution was stirred at -78 °C for 30 minutes. Allyl bromide (0.18 g, 1.39 mmol) was added to the reaction mixture. The mixture was stirred at -78 °C for 30 minutes. The reaction was quenched by adding saturated NH4Cl solution (10 mL) to the reaction mixture. The resulting mixture was extracted with EtOAc (20 mL × 3). After combining the organic layers, they were washed with brine (10 mL), dried over MgSO4, and concentrated. The residue was purified by combiflash column chromatography using 0 - 20% EtOAc / hexane to give Compound 3 (0.18 g, 79%) as a pale yellow liquid.
[0400] Preparation of Compound 4
[0401] To a stirred solution of Compound 3 (0.18 g, 0.55 mmol) dissolved in CH2Cl2 (5.0 mL) was added BBr3 (1 M in CH2Cl2) (1.60 mL, 1.64 mmol) at -78 °C. The reaction mixture was gradually heated from -78 °C to room temperature over 4 hours. The reaction mixture was concentrated under reduced pressure to give a residue. It was purified by combiflash column chromatography using 0 - 60% EtOAc / hexane to give Compound 4 (0.035 g, 20%) as a colorless oil.
[0402] Preparation of Compound 5
[0403] To a stirred solution of Compound 4 (0.035 g, 0.11 mmol) dissolved in DMF (3.0 mL) was added NaH (0.01 g, 60% in mineral oil, 0.28 mmol) at 0 °C and stirred for 5 minutes. After 5 minutes, Compound 2 (0.04 g, 0.14 mmol) was added to the reaction mixture. The mixture was stirred at room temperature for 5 hours and diluted with cold H2O (20 mL). The resulting mixture was extracted with EtOAc (30 mL × 2). After combining the extracts, they were washed with brine (20 mL), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 40% EtOAc / hexane to give Compound 5 (0.02 g, 46%) as a colorless liquid.
[0404] Preparation of Compound ALB - 210364 (B2 - 29)
[0405] To a cold solution of compound 5 (0.02 g, 0.05 mmol) dissolved in THF (4.0 mL) was added LiAlH4 (0.07 mL, 2.0 M in THF, 0.16 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 30 minutes and diluted with H2O and Na2SO4·10H2O. The resulting mixture was extracted with EtOAc (10 mL × 3). After combining the extracts, they were washed with brine (5.0 mL), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 60% EtOAc / hexane to give compound ALB - 210364 (B2 - 29) (0.0039 g, 21%) as a colorless viscous substance. 1 H NMR (400 MHz, CDCl3) δ 7.03 (d, J = 8.4 Hz, 2H), 6.79 (d, J = 8.8 Hz, 2H), 5.93 - 5.83 (m, 1H), 5.09 - 5.04 (m, 2H), 4.53 (d, J = 5.6 Hz, 2H), 3.95 - 3.85 (m, 2H), 3.68 (t, J = 4.4 Hz, 4H), 2.66 - 2.59 (m, 1H), 2.23 - 2.14 (m, 2H), 2.07 - 1.99 (m, 2H), 1.76 (d, J = 13.6 Hz, 2H), 1.62 - 1.58 (m, 5H), 1.49 (s, 3H), 1.38 - 1.28 (m, 2H), 1.01 (d, J = 7.6 Hz, 3H). ESI MS m / z 359 [M + H] + 。
[0406] Synthesis Example 16: Synthesis of Compound B2 - 28
[0407] The method for producing compound B2 - 28 (also known as ALB - 210359) (also known as Scheme 16) is as follows.
[0408]
Chemical Formula 62
[0409]
[0410] Production of Compound 2
[0411] To a solution of lithium diisopropylamide (1.04 mL, 2.0 M in THF, 2.08 mmol) dissolved in THF (5.0 mL) was added dropwise Compound Int-10 (Compound 10 of Scheme 1) (0.20 g, 0.69 mmol) at -78 °C. The solution was stirred at -78 °C for 30 minutes. Compound 1 (0.09 mL, 1.04 mmol) was added to the reaction mixture at -78 °C. The reaction mixture was stirred at -78 °C for 30 minutes and the reaction was quenched with saturated NH4Cl solution (10 mL). The resulting mixture was extracted with EtOAc (20 mL × 3). The combined organic layers were washed with brine (10 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 20% EtOAc / hexane to give Compound 2 (0.18 g, 79%) as a pale yellow liquid. 1 H NMR (400 MHz, CDCl3) δ 7.06 (d, J = 8.8 Hz, 2H), 6.79 (d, J = 8.4 Hz, 2H), 5.71 - 5.63 (m, 1H), 5.02 - 4.96 (m, 2H), 4.53 (m, 2H), 3.77 (s, 3H), 3.74 (s, 3H), 2.62 - 2.57 (m, 1H), 2.32 - 2.19 (m, 4H), 1.73 - 1.69 (m, 1H), 1.53 - 1.50 (m, 1H), 1.46 (s, 3H), 1.33 - 1.25 (m, 2H).
[0412] Preparation of Compound 3
[0413] To a solution of Compound 2 (0.09 g, 0.27 mmol) dissolved in CH2Cl2 (5.0 mL) was added BBr3 (0.82 mL, 0.82 mmol) dissolved in CH2Cl2 at -78 °C. The reaction mixture was heated to room temperature and stirred for 3 hours, and the reaction was quenched by the addition of HCl (1 N, 2.0 mL). The resulting mixture was extracted with EtOAc (30 mL × 3), dried over MgSO4, and concentrated under reduced pressure to give a residue. It was purified by combiflash column chromatography using 0 - 30% EtOAc / hexane to give Compound 3 (0.03 g, 35%) as a colorless oil. 11H NMR (400 MHz, CDCl3) δ 7.00 (d, J = 8.4 Hz, 2H), 6.72 (d, J = 8.4 Hz, 2H), 5.71 - 5.65 (m, 1H), 5.02 - 4.97 (m, 2H), 4.52 (m, 2H), 3.74 (s, 3H), 2.62 - 2.55 (m, 1H), 2.32 - 2.19 (m, 5H), 1.72 - 1.68 (m, 1H), 1.45 (s, 4H), 1.33 - 1.23 (m, 4H).
[0414] Preparation of Compound 4
[0415] To a cold solution of Compound 3 (0.02 g, 0.06 mmol) dissolved in DMF (1.0 mL) was added NaH (0.005 g, 0.13 mmol) at 0 °C. After 30 minutes, (3 - bromopropoxy)(tert - butyl)dimethylsilane (0.032 g, 0.13 mmol) was added to the reaction mixture. The reaction mixture was stirred at 0 °C for 4 hours and diluted with H2O. The resulting mixture was extracted with EtOAc (10 mL × 3). The combined organic layers were washed with brine (10 mL), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 10% EtOAc / hexane to give Compound 4 (0.03 g, 97%) as a colorless oil. ESI MS m / z 387C 29 H 46 O4Si + H] + 。
[0416] Preparation of Compound 5
[0417] To a cold solution of Compound 4 (0.03 g, 0.06 mmol) dissolved in THF (1.0 mL) was added LiAlH4 (0.18 mL, 1.0 M in THF, 0.18 mmol) at 0 °C. The mixture was stirred at 0 °C for 15 minutes and diluted with H2O and Na2SO4·10H2O. The resulting mixture was extracted with EtOAc (10 mL × 3). The combined organic layers were washed with brine (5.0 mL), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 30% EtOAc / hexane to give Compound 5 (0.015 g, 68%) as a colorless oil. 11H NMR (400 MHz, CDCl3) δ 6.95 (d, J = 8.8 Hz, 2H), 6.71 (d, J = 8.8 Hz, 2H), 5.85 - 5.79 (m, 1H), 5.02 - 4.97 (m, 2H), 4.46 (m, 2H), 4.06 - 3.94 (m, 2H), 3.72 - 3.49 (m, 6H), 2.58 - 2.49 (m, 1H), 2.18 - 2.11 (m, 1H), 1.89 - 1.68 (m, 6H), 1.48 (s, 4H), 0.81 (m, 9H), 0.00 (m, 6H).
[0418] Preparation of Compound ALB - 210359 (B2 - 28)
[0419] To a cold solution of Compound 5 (0.015 g, 0.041 mmol) dissolved in THF (1.0 mL) was added TBAF (0.12 mL, 1.0 M in THF, 0.12 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 2 hours and diluted with H2O. The resulting mixture was extracted with EtOAc (5.0 mL × 3). The organic layers were combined, washed with brine (5.0 mL), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 60% EtOAc / hexane to give Compound ALB - 210359 (B2 - 28) (0.0065 g, 45%) as a colorless viscous substance. 1 1H NMR (400 MHz, CDCl3) δ 7.03 (d, J = 8.4 Hz, 2H), 6.79 (d, J = 8.8 Hz, 2H), 5.93 - 5.83 (m, 1H), 5.09 - 5.04 (m, 2H), 4.53 (m, 2H), 4.08 (t, J = 6.0 Hz, 2H), 3.84 (t, J = 6.0 Hz, 2H), 3.70 (m, 2H), 2.66 - 2.59 (m, 1H), 2.33 - 2.19 (m, 1H), 2.04 - 2.00 (m, 4H), 1.78 - 1.58 (m, 6H), 1.49 (s, 4H). ESI MS m / z 345C 22 H 32 O3 + H] + .
[0420] Synthesis Example 17: Synthesis of Compounds B2 - 27 and B2 - 21
[0421] The method for preparing Compounds B2 - 27 (also known as ALB - 209872) and B2 - 21 (also known as ALB - 208788) (also known as Scheme 17) is as follows.
[0422] [Chemical Formula 63]
[0423]
[0424] Preparation of Compound 1
[0425] To a solution of lithium diisopropylamide (20.8 mL, 1.0 M in THF, 20.8 mmol) dissolved in THF (20 mL) was added dropwise Compound Int-10 (Compound 10 in Scheme 1) (2.00 g, 6.94 mmol) at -78 °C. The solution was stirred at -78 °C for 30 minutes and then cooled to -105 °C (MeOH, liquid N2). Phenyl vinyl sulfoxide (2.10 g, 13.88 mmol) was added to the reaction mixture. The reaction mixture was stirred at -105 °C for 30 minutes and the reaction was quenched with saturated NH4Cl solution (25 mL). The resulting mixture was extracted with EtOAc (50 mL × 3). The combined organic layers were washed with brine (50 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 20% EtOAc / hexane to give Compound 1 (1.70 g, 56.6%) as a colorless liquid. 1 H NMR (400 MHz, CDCl3) δ 7.56 - 7.48 (m, 5H), 7.03 - 6.99 (m, 2H), 6.80 - 6.77 (m, 2H), 4.52 (s, 2H), 3.76 - 3.70 (m, 6H), 2.73 - 2.52 (m, 3H), 2.33 - 2.17 (m, 3H), 1.87 - 1.59 (m, 5H), 1.89 - 1.85 (m, 1H), 1.49 (s, 3H); ESI MS m / z 441C 26 H 32 O4S+H] + 。
[0426] Preparation of Compound 2
[0427] A mixture of Compound 11 (1.00 g, 2.27 mmol) dissolved in xylene (20 mL) and NaHCO3 (2.40 g, 22.72 mmol) was stirred under reflux for 16 hours and diluted with H2O. The resulting mixture was extracted with EtOAc (30 mL × 3). The combined organic layers were washed with brine (25 mL), dried over MgSO4, and concentrated under reduced pressure to give a residual oil. It was purified by combiflash column chromatography using 0 - 20% EtOAc / hexane to give Compound 2 (0.30 g, 42%) as a pale yellow liquid. 11H NMR (400 MHz, CDCl3) δ 7.07 (d, J = 8.8 Hz, 2H), 6.80 (d, J = 8.4 Hz, 2H), 5.85 - 5.78 (m, 1H), 5.09 - 5.03 (m, 2H), 4.54 (m, 2H), 3.77 (s, 6H) 2.66 - 2.60 (m, 1H), 2.58 - 2.28 (m, 4H), 1.78 - 1.74 (m, 1H), 1.47 (s, 4H).
[0428] Preparation of Compound 3
[0429] To a solution of Compound 2 (0.15 g, 0.48 mmol) dissolved in CH2Cl2 (5.0 mL) was added BBr3 (0.95 mL, 0.95 mmol) dissolved in CH2Cl2 at 0 °C. After heating the reaction mixture to room temperature, it was stirred for 16 hours, and the reaction was quenched by adding HCl solution (1 N, 5.0 mL). The resulting mixture was extracted with EtOAc (10 mL × 3), dried over Na2SO4, and concentrated under reduced pressure to obtain a residue. It was purified by combiflash column chromatography using 0 - 60% EtOAc / hexane to obtain Compound 3 (0.07 g, 51%) as a colorless liquid. 1 1H NMR (400 MHz, CDCl3) δ 7.03 (d, J = 8.4 Hz, 2H), 6.73 (d, J = 8.4 Hz, 2H), 5.91 - 5.84 (m, 1H), 5.20 - 5.11 (m, 2H), 4.56 (m, 2H), 2.72 - 2.65 (m, 1H), 2.46 - 2.40 (m, 3H), 2.29 - 2.23 (m, 1H), 1.81 - 1.56 (m, 4H), 1.49 (s, 3H).
[0430] Preparation of Compound ALB - 209872 (B2 - 27)
[0431] To a cold solution of Compound 13 (0.03 g, 0.10 mmol) dissolved in CH3CN (1.0 mL) was added dropwise K2CO3 (0.03 g, 0.21 mmol) and MeI (0.02 g, 0.16 mmol) at 0 °C. The reaction mixture was stirred at room temperature for 16 hours. The resulting mixture was extracted with EtOAc (5.0 mL × 3). The organic layers were combined, washed with brine (5.0 mL), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 30% EtOAc / hexane to obtain Compound ALB - 209872 (B2 - 27) (0.012 g, 50%) as a pale yellow oil. 11H NMR (400 MHz, CDCl3) δ 7.04 (d, J = 8.4 Hz, 2H), 6.75 (d, J = 8.4 Hz, 2H), 5.87 - 5.80 (m, 1H), 5.12 - 5.06 (m, 2H), 4.59 - 4.50 (m, 2H), 3.79 (s, 2H), 2.65 - 2.42 (m, 3H), 2.28 - 2.22 (m, 1H), 1.80 - 1.76 (m, 1H), 1.49 (s, 4H), 1.43 - 1.38 (m, 2H); ESI MS m / z 301 C 19 H 24 O3 + H] + 。
[0432] Preparation of Compound 5
[0433] To a mixture of compound ALB - 209872 (B2 - 27) (0.03 g, 0.10 mmol) dissolved in CH2Cl2 (1.0 mL) was added dropwise compound 4 (0.24 g, 0.20 mmol), Cu(OAc)2 (0.036 g, 0.20 mmol) and pyridine (0.015 g, 0.20 mmol) at room temperature. The reaction mixture was stirred for 48 h. The resulting mixture was extracted with EtOAc (5.0 mL × 3). The combined organic layers were washed with brine (5.0 mL), dried over Na2SO4 and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 20% EtOAc / hexane to give compound 5 (0.02 g, 54%) as a colorless oil. 1 1H NMR (400 MHz, CDCl3) δ 7.31 (t, J = 7.6 Hz, 2H), 7.07 (t, J = 7.6 Hz, 3H), 6.98 (d, J = 7.6 Hz, 2H), 6.90 (d, J = 8.4 Hz, 2H), 5.86 - 5.79 (m, 1H), 5.11 - 5.05 (m, 2H), 4.55 (s, 2H), 3.77 (s, 3H), 2.68 - 2.61 (m, 1H), 2.47 - 2.44 (m, 2H), 2.28 - 2.23 (m, 1H), 1.79 - 1.75 (m, 1H), 1.48 (s, 4H), 1.43 - 1.40 (m, 1H); ESI MS m / z 315 C 20 H 26 O3 + H] + 。ESI MS m / z 376 [M + H] + 。
[0434] Preparation of Compound ALB - 208788 (B2 - 21)
[0435] To a cold solution of Compound 5 (0.02 g, 0.05 mmol) dissolved in THF (1.0 mL) was added LiAlH4 (0.08 mL, 2.0 M in THF, 0.16 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 15 minutes and diluted with H2O and Na2SO4·10H2O. The resulting mixture was extracted with EtOAc (5.0 mL × 3). The organic layers were combined, washed with brine (5.0 mL), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 30% EtOAc / hexane to give Compound ALB - 208788 (B2 - 21) (0.0095 g, 55%) as a colorless viscous substance. 1 H NMR (400 MHz, CDCl3) δ 7.33 - 7.29 (m, 2H), 7.11 - 7.05 (m, 3H), 6.99, 6.96 (dd, J = 1.2, 8.8 Hz, 2H), 6.89 (d, J = 8.8 Hz, 2H), 5.78 - 5.71 (m, 1H), 5.17 - 5.06 (m, 2H), 4.56 (m, 2H), 3.70 (d, J = 6.4 Hz, 2H), 2.76 - 2.69 (m, 1H), 2.28 - 2.21 (m, 1H), 1.92 - 1.88 (m, 2H), 1.70 - 1.64 (m, 2H), 1.49 (s, 4H), 1.48 - 1.43 (m, 2H); ESI MS m / z 349C 24 H 28 O2 + H] + 。
[0436] Synthesis Example 18: Synthesis of Compound B2 - 19
[0437] The manufacturing method of Compound B2 - 19 (also known as ALB - 209870) (also known as Scheme 19) is as follows.
[0438]
Chemical Formula 64
[0439]
[0440] Synthesis of Compound 2
[0441] A solution of compound Int-4 (compound 4 of Scheme 1) (5.00 g, 36.76 mmol) dissolved in 1,4-dioxane:water (40 mL:10 mL) was added to a mixture of compound 1 (7.58 g, 44.11 mmol) and KOH (4.10 g, 73.52 mmol) at room temperature. The reaction mixture was degassed with argon for 15 minutes and [Rh(COD)Cl]2 (0.54 g, 1.10 mmol) was added. The reaction mixture was stirred under reflux for 16 hours. The reaction mixture was quenched with saturated NaHCO3 (30 mL) and extracted with EtOAc (20 mL×2). The combined organic layers were washed with brine (20 mL), dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure. The crude product was purified by combiflash column chromatography using 0-20% EtOAc / hexane to give compound 2 (2.00 g, quantitative) as a brown semi-solid. 1 H NMR (400 MHz, CDCl3) δ 7.80 (t, J = 8.0 Hz, 2H), 7.65 (s, 1H), 7.49 - 7.36 (m, 3H), 3.58 (t, J = 8.0 Hz, 1H), 2.91 - 2.77 (m, 2H), 2.68 - 2.52 (m, 3H), 1.43 (s, 3H), 1.03 (m, 3H).
[0442] Preparation of compound 3
[0443] To a solution of compound 2 (1.60 g, 6.06 mmol) dissolved in Ac2O (10 mL) was added Zn(OAc)2 (1.10 g, 6.06 mmol) and BF3·OEt2 (0.54 mL, 3.03 mmol), and the mixture was stirred at room temperature for 12 hours. The reaction mixture was diluted with H2O (20 mL). The resulting mixture was extracted with EtOAc (20 mL×3). The combined organic layers were washed with saturated NaHCO3 (250 mL) and brine (50 mL), dried over Na2SO4, and concentrated under reduced pressure. The resulting product was purified by combiflash column chromatography using 0-10% EtOAc / hexane to give compound 3 (1.80 g, 78%) as an off-white solid. 11H NMR (400 MHz, CDCl3) δ 7.79 - 7.74 (m, 3H), 7.61 (s, 1H), 7.45 - 7.38 (m, 2H), 7.35 - 7.32 (m, 1H), 5.50 - 5.48 (m, 1H), 4.71 - 4.54 (m, 2H), 3.19 - 3.12 (m, 1H), 2.88 - 2.81 (m, 1H), 2.56 - 2.49 (m, 2H), 2.40 - 2.25 (m, 2H), 2.10 (s, 3H), 1.51 (s, 3H).
[0444] Preparation of Compound 4
[0445] To a solution of Compound 3 (1.20 g, 3.92 mmol) dissolved in MeOH (10 mL) at 0 °C was added NaH (0.078 g, 60% in mineral oil, 1.96 mmol), and the mixture was stirred at room temperature for 30 minutes. The reaction mixture was diluted with saturated NH4Cl (10 mL). The resulting mixture was extracted with EtOAc (50 mL × 3). The combined organic layers were washed with brine (50 mL), dried over Na2SO4, and concentrated to give a residual oil. It was purified by combiflash column chromatography using 0 - 20% EtOAc / hexane to give Compound 4 (1.20 g, 77%) as an off - white solid. 1 1H NMR (400 MHz, CDCl3) δ 7.80 - 7.76 (m, 3H), 7.57 (s, 1H), 7.46 - 7.43 (m, 2H), 7.35 - 7.32 (m, 1H), 4.69 - 4.56 (m, 2H), 3.17 - 3.13 (m, 1H), 2.93 - 2.87 (m, 1H), 2.69 - 2.55 (m, 4H), 2.17 - 2.12 (m, 4H), 1.98 - 1.91 (m, 1H), 1.53 (s, 3H).
[0446] Preparation of Compound 5
[0447] To a cold solution of tosylmethyl isocyanide (0.74 g, 3.79 mmol) and t - BuOK (0.85 g, 7.57 mmol) dissolved in THF (5.0 mL) was added a solution of Compound 4 (0.50 g, 1.89 mmol) dissolved in THF (5.0 mL). After stirring at 0 °C for 10 minutes, MeOH (10 mL) was added. The resulting mixture was stirred under reflux for 1 hour and concentrated under reduced pressure. The crude product was purified by combiflash column chromatography using 0 - 20% EtOAc / hexane to give Compound 5 (0.25 g, 48%) as a colorless liquid. 11H NMR (400 MHz, CDCl3) δ 7.80 - 7.75 (m, 3H), 7.60 (s, 1H), 7.45 - 7.42 (m, 2H), 7.31 - 7.28 (m, 1H), 4.61 (m, J = 11.2 Hz, 1H), 4.51 (m, 1H), 3.14 - 3.10 (m, 1H), 2.75 - 2.63 (m, 2H), 2.51 - 2.14 (m, 2H), 1.96 - 1.74 (m, 4H), 1.49 (s, 3H).
[0448] Preparation of Compound 6
[0449] To a solution of Compound 5 (0.25 g, 0.91 mmol) dissolved in 2 - propanol (5.0 mL) was added KOH (0.51 g, 9.09 mmol) at room temperature. The reaction mixture was stirred under reflux for 16 h and the reaction was quenched by addition of HCl solution (2N). The resulting mixture was extracted with EtOAc (10 mL × 3). The combined organic layers were washed with brine (20 mL), dried over Na2SO4 and concentrated under reduced pressure to give Compound 6 (0.20 g, 75%) as an off - white solid. 1 1H NMR (400 MHz, CDCl3) δ 7.78 - 7.73 (m, 3H), 7.56 (s, 1H), 7.44 - 7.37 (m, 2H), 7.32, 7.29 (dd, J = 1.6 Hz, 8.4 Hz, 1H), 4.58 - 4.49 (m, 2H), 2.76 - 2.60 (m, 1H), 2.59 - 2.40 (m, 2H), 2.23 - 2.10 (m, 2H), 1.96 - 1.92 (m, 1H), 1.78 - 1.66 (m, 2H), 1.51 (s, 3H).
[0450] Preparation of Compound 7
[0451] To a cold solution of Compound 6 (0.20 g, 0.68 mmol) dissolved in CH3CN:MeOH (3.0 mL:1.0 mL) at 0 °C was added dropwise K2CO3 (0.19 g, 1.36 mmol), CH3I (0.15 g, 1.02 mmol). The reaction mixture was stirred at room temperature for 18 h and then concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 20% EtOAc / hexane to give Compound 7 (0.15 g, 71%) as an off - white solid. 11H NMR (400 MHz, CDCl3) δ 7.78 - 7.73 (m, 3H), 7.56 (s, 1H), 7.44 - 7.37 (m, 2H), 7.32, 7.29 (dd, J = 1.6 Hz, 8.4 Hz, 1H), 4.58 - 4.48 (m, 2H), 3.67 (s, 3H), 2.78 - 2.72 (m, 1H), 2.57 - 2.42 (m, 2H), 1.95 - 1.91 (m, 2H), 1.76 - 1.64 (m, 2H), 1.51 (s, 3H).
[0452] Preparation of Compound 8
[0453] To a solution of lithium diisopropylamide (0.73 mL, 2.0 M in THF, 1.46 mmol) dissolved in THF (1.0 mL) was added dropwise Compound 7 (0.15 g, 0.49 mmol) at -78 °C. The solution was stirred at -78 °C for 30 minutes, then cooled to -105 °C (MeOH, liquid N2), and phenyl vinyl sulfoxide (0.13 mL, 0.97 mmol) was added to the reaction mixture. The reaction mixture was stirred at -105 °C for 30 minutes, and the reaction was quenched with saturated NH4Cl solution (5.0 mL). The resulting mixture was extracted with EtOAc (10 mL × 3). The combined organic layers were washed with brine (10 mL), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 20% EtOAc / hexane to give Compound 8 (0.07 g, 31%) as a pale yellow liquid.
[0454] Preparation of Compound 9
[0455] A mixture of Compound 8 (0.07 g, 0.15 mmol) dissolved in xylene (2.0 mL) and NaHCO3 (0.16 g, 1.52 mmol) was stirred under reflux for 16 hours and diluted with H2O. The resulting mixture was extracted with EtOAc (10 mL × 3). The combined organic layers were washed with brine (5.0 mL), dried over Na2SO4, and concentrated under reduced pressure to give a residual oil. It was purified by combiflash column chromatography using 0 - 20% EtOAc / hexane to give Compound 9 (0.015 g, 30%) as a colorless liquid. 11H NMR (400 MHz, CDCl3) δ 7.79 - 7.74 (m, 3H), 7.58 (s, 1H), 7.43 - 7.31 (m, 3H), 5.87 - 5.80 (m, 1H), 5.10 - 5.05 (m, 2H), 4.58 - 4.48 (m, 2H), 3.81 (s, 3H), 2.88 - 2.82 (m, 1H), 2.52 - 2.44 (m, 3H), 1.83 - 1.80 (m, 1H), 1.49 (s, 4H).
[0456] Preparation of Compound ALB - 209870 (B2 - 19)
[0457] To a cold solution of Compound 9 (0.015 g, 0.04 mmol) dissolved in THF (1.0 mL) was added LiAlH4 (0.13 mL, 2.0 M in THF, 0.13 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 15 minutes and diluted with H2O and Na2SO4·10H2O. The resulting mixture was extracted with EtOAc (5.0 mL × 3). The organic layers were combined, washed with brine (5.0 mL), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 30% EtOAc / hexane to give Compound ALB - 209870 (B2 - 19) (0.005 g, 30%) as a colorless viscous substance. 1 1H NMR (400 MHz, CDCl3) δ 7.71 - 7.66 (m, 3H), 7.50 (s, 1H), 7.37 - 7.32 (m, 2H), 7.26, 7.24 (dd, J = 1.6 Hz, 8.8 Hz, 1H), 5.72 - 5.65 (m, 2H), 5.09 - 4.98 (m, 2H), 4.47 (m, 2H), 3.67 (d, J = 4.8 Hz, 2H), 2.88 - 2.82 (m, 1H), 2.41 - 2.34 (m, 1H), 1.90 - 1.83 (m, 2H), 1.68 - 1.62 (m, 2H), 1.46 (s, 3H), 1.30 - 1.29 (m, 2H); ESI MS m / z 307C 22 H 26 O + H] + .
[0458] Synthesis Example 19: Synthesis of Compound B2 - 18
[0459] The manufacturing method of Compound B2 - 18 (also known as ALB - 208789) (also known as Scheme 20) is as follows.
[0460]
Chemical Formula 65
[0461]
[0462] Preparation of Compound 2
[0463] To a solution of Compound Int-4 (Compound 4 of Scheme 1) (11.0 g, 79.00 mmol) dissolved in 1,4-dioxane (120 mL) was added Compound 1 (16.2 g, 79.00 mmol), KOH (2 M, 8.84 g, 158.0 mmol), and the mixture was degassed with argon for 15 minutes. The [Rh(COD)Cl]2 complex (1.16 g, 2.30 mmol) was added to the reaction mixture. The resulting mixture was stirred and heated under reflux for 12 hours. The residual solvent was evaporated under reduced pressure. The crude product was dissolved in CH2Cl2 (250 mL) and filtered through a bed of Celite. The filtrate was washed with water (250 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 20% EtOAc / hexane to give Compound 2 (13.00 g, 55%) as a yellow solid.
[0464] Preparation of Compound 3
[0465] To a solution of Compound 2 (3.50 g, 11.9 mmol) dissolved in Ac2O (20 mL) was added Zn(OAc)2 (1.30 g, 7.00 mmol) and BF3·OEt2 (0.40 mL, 2.90 mmol), and the mixture was stirred at room temperature for 12 hours. The reaction mixture was diluted with H2O (100 mL). The resulting mixture was extracted with EtOAc (100 mL × 2). The combined organic layers were washed with saturated NaHCO3 solution (250 mL) and brine (100 mL). The resulting mixture was dried over MgSO4 and concentrated under reduced pressure to give a residual oil. It was purified by combiflash column chromatography using 0 - 10% EtOAc / hexane to give Compound 3 [3.00 g (crude product)] as a brown oil. ESI MS m / z 337 [M + H] + 。
[0466] Preparation of Compound 4
[0467] To a solution of compound 3 (3.00 g, 6.20 mmol) dissolved in MeOH (30 mL) at 0 °C was added NaH (0.13 g, 60% mineral oil, 3.00 mmol), and the mixture was stirred at room temperature for 30 minutes. The reaction mixture was diluted with saturated NH4Cl solution (25 mL). The resulting mixture was extracted with EtOAc (50 mL × 2). The combined organic layers were washed with brine (100 mL), dried over MgSO4, and concentrated under reduced pressure to give a residual oil. It was purified by combiflash column chromatography using 0 - 20% EtOAc / hexane to give compound 4 (2.10 g, 61%) as an off-white solid.
[0468] Preparation of compound 5
[0469] To a cold solution of tosylmethyl isocyanide (2.71 g, 13.70 mmol) and t-BuOK (3.10 g, 27.40 mmol) dissolved in THF (10 mL) was added a solution of compound 4 (2.00 g, 6.85 mmol) dissolved in THF (10 mL). After stirring at 0 °C for 10 minutes, MeOH (15 mL) was added. The resulting mixture was stirred under reflux for 1 hour and concentrated. The crude material was purified by combiflash column chromatography using 0 - 10% EtOAc / hexane to give compound 5 (1.20 g, 60%) as a pale yellow oil. 1 HNMR (400 MHz, CDCl3) δ 7.05 (d, J = 8.4 Hz, 2H), 6.82 (d, J = 8.8 Hz, 2H), 4.64 (d, J = 10.4 Hz, 2H), 3.78 (s, 3H), 2.96 - 2.89 (m, 1H), 2.74 - 2.68 (m, 1H), 2.53 - 2.49 (m, 4H), 2.11 - 2.07 (m, 1H), 1.91 - 1.55 (m, 1H), 1.51 (s, 3H).
[0470] Preparation of compound 6
[0471] To a solution of compound 5 (0.48 g, 1.57 mmol) dissolved in 2-propanol (10 mL) was added KOH (0.89 g, 15.70 mmol) at room temperature. The reaction mixture was stirred under reflux for 16 hours and the reaction was quenched by addition of HCl solution (2N, 10 mL). The resulting mixture was extracted with EtOAc (10 mL × 3). The combined organic layers were washed with brine (25 mL), dried over MgSO4, and concentrated under reduced pressure to give compound 6 [0.50 g (crude product)] as an off-white solid. ESI MS m / z 323 [M + H] + .
[0472] Preparation of Compound 7
[0473] To a cold solution of Compound 6 (0.40 g, 1.24 mmol) dissolved in CH3CN (5.0 mL) was added dropwise K2CO3 (0.51 g, 3.72 mmol) and CH3I (0.23 mL, 3.72 mmol) at 0 °C. After the reaction mixture was heated to room temperature, it was stirred for 12 h. The resulting mixture was extracted with EtOAc (10 mL × 2). The combined organic layers were washed with brine (10 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by column chromatography using 0 - 20% EtOAc / hexane to give Compound 7 (0.30 g, 72%) as a colorless oil. 1 1H NMR (400 MHz, CDCl3) δ 7.04 (d, J = 8.8 Hz, 2H), 6.79 (d, J = 8.4 Hz, 2H), 4.55 (m, 2H), 3.76 (s, 3H), 3.65 (s, 3H), 2.54 - 2.45 (m, 2H), 2.30 - 2.24 (m, 1H), 2.10 - 2.06 (m, 2H), 1.89 - 1.85 (m, 1H), 1.62 - 1.58 (m, 3H), 1.49 (s, 3H).
[0474] Preparation of Compound 8
[0475] To a solution of Compound 7 (0.08 g, 0.24 mmol) dissolved in 1,4 - dioxane (10 mL) were added phenylboronic acid (0.06 g, 0.47 mmol), Na2CO3 (0.063 g, 2 M, 0.59 mmol), and the mixture was degassed with argon for 15 min. The Pd(dppf)Cl2·CH2Cl2 complex (0.019 g, 0.02 mmol) was added to the reaction mixture. The resulting mixture was stirred and heated to reflux for 16 h. The residual solvent was evaporated. The crude product was dissolved in CH2Cl2 (10 mL) and filtered through a bed of diatomaceous earth. The filtrate was washed with water (10 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography using 0 - 10% EtOAc / hexane to give Compound 8 (0.08 g, 69%) as an off - white solid. ESI MS m / z 352 [M + NH4] + 。
[0476] Preparation of Compound 9
[0477] To a solution of lithium diisopropylamide (0.50 mL, 2.0 M in THF, 0.89 mmol) dissolved in THF (3.0 mL) was added dropwise a solution of compound 8 (0.10 g, 0.30 mmol) dissolved in THF (3.0 mL) at -78 °C. The solution was stirred at -78 °C for 30 minutes, then cooled to -105 °C (MeOH, liquid N2), and phenyl vinyl sulfoxide (0.091 g, 0.60 mmol) was added to the reaction mixture. The reaction mixture was stirred at -105 °C for 30 minutes, and the reaction was quenched with saturated NH4Cl solution (5.0 mL). The resulting mixture was extracted with EtOAc (10 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by column chromatography using 0 - 10% EtOAc / hexane to give compound 9 (0.06 g, 41%) as a brown liquid. ESI MS m / z 487 [M+H] + 。
[0478] Preparation of Compound 10
[0479] A mixture of compound 9 (0.06 g, 0.12 mmol) dissolved in xylene (3.0 mL) and NaHCO3 (0.10 g, 1.23 mmol) was stirred under reflux for 18 hours and diluted with H2O. The resulting mixture was extracted with EtOAc (10 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure to give a residual oil. It was purified by column chromatography using 0 - 20% EtOAc / hexane to give compound 10 (0.03 g, 68%) as a colored oil. ESI MS m / z 361 [M+H] + 。
[0480] Preparation of Compound ALB - 208789 (B2 - 18)
[0481] To a cold solution of compound 10 (0.03 g, 0.08 mmol) dissolved in THF (3.0 mL) was added LiAlH4 (0.12 mL, 2.0 M in THF, 0.24 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 15 minutes and diluted with H2O and Na2SO4·10H2O. The resulting mixture was extracted with EtOAc (5.0 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by column chromatography using 0 - 30% EtOAc / hexane to give compound ALB - 208789 (B2 - 18) (0.005 g, 19%) as an off - white solid. 11H NMR (400 MHz, CDCl3) δ 7.51 (d, J = 7.2 Hz, 1H), 7.42 (d, J = 8.0 Hz, 1H), 7.36 - 7.24 (m, 5H), 7.15 (d, J = 8.4 Hz, 1H), 6.97 (d, J = 8.0 Hz, 1H), 5.70 - 5.63 (m, 1H), 5.09 - 4.97 (m, 2H), 4.52 (d, 2H), 4.48 (s, 1H), 3.66 - 3.61 (m, 2H), 2.75 - 2.61 (m, 1H), 2.28 - 2.13 (m, 2H), 1.85 - 1.80 (m, 2H), 1.66 - 1.60 (m, 3H), 1.44 (s, 3H), 1.41 - 1.25 (m, 3H).
[0482] Synthesis Example 20: Synthesis of Compound B2 - 23
[0483] The manufacturing method (also referred to as Scheme 21) of Compound B2 - 23 (also known as ALB - 208790) is as follows.
[0484]
Chemical Formula 66
[0485]
[0486] Manufacture of Compound 2
[0487] To a solution of Compound Int - 7 (Compound 7 of Scheme 20) (0.30 g, 0.89 mmol) dissolved in 1,4 - dioxane (3.0 mL) was added Compound 1 (0.27 g, 1.78 mmol), Na2CO3 (2 M, 0.19 g, 1.79 mmol), and the mixture was degassed with argon for 15 minutes. The Pd(dppf)Cl2·CH2Cl2 complex (0.07 g, 0.09 mmol) was added to the reaction mixture. The resulting mixture was stirred and refluxed under microwave irradiation for 1 hour. The residual solvent was evaporated. The crude product was dissolved in CH2Cl2 (10 mL) and filtered through a bed of diatomaceous earth. The filtrate was washed with water (10 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography using 0 - 20% EtOAc / hexane to obtain Compound 2 (0.26 g, 80%) as an off - white solid.
[0488] Manufacture of Compound 3
[0489] To a solution of lithium diisopropylamide (1.20 mL, 2.0 M in THF, 2.38 mmol) dissolved in THF (5.0 mL) was added dropwise a solution of compound 2 (0.29 g, 0.79 mmol) dissolved in THF (3.0 mL) at -78 °C. The solution was stirred at -78 °C for 30 minutes, then cooled to -105 °C (MeOH, liquid N2), and phenyl vinyl sulfoxide (0.24 g, 1.59 mmol) was added to the reaction mixture. The reaction mixture was stirred at -105 °C for 30 minutes, and the reaction was quenched with saturated NH4Cl solution (5.0 mL). The resulting mixture was extracted with EtOAc (10 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by column chromatography using 0 - 20% EtOAc / hexane to give compound 3 (0.16 g, 40%) as a brown liquid.
[0490] Preparation of Compound 4
[0491] A mixture of compound 3 (0.16 g, 0.31 mmol) and NaHCO3 (0.328 g, 3.10 mmol) dissolved in xylene (3.0 mL) was stirred under reflux for 18 hours and diluted with H2O. The resulting mixture was extracted with EtOAc (10 mL × 2). The organic layers were combined, washed with brine (5.0 mL), dried over MgSO4, and concentrated to give a residual oil. It was purified by column chromatography using 0 - 20% EtOAc / hexane to give compound 4 (0.04 g, 33%) as a colored oil. ESI MS m / z 391 [M+H] + 。
[0492] Preparation of Compound ALB - 208790 (B2 - 23)
[0493] To a cold solution of compound 4 (0.04 g, 0.10 mmol) dissolved in THF (4.0 mL) was added LiAlH4 (0.2 mL, 2.0 M in THF, 0.30 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 15 minutes and diluted with H2O and Na2SO4·10H2O. The resulting mixture was extracted with EtOAc (5.0 mL × 3). The organic layers were combined, washed with brine (5.0 mL), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by column chromatography using 0 - 30% EtOAc / hexane to give compound ALB - 208790 (B2 - 23) (0.015 g, 40%) as an off - white solid. 11H NMR (400 MHz, CDCl3) δ 7.51 (d, J = 8.8 Hz, 2H), 7.45 (d, J = 8.0 Hz, 2H), 7.19 (d, J = 8.0 Hz, 2H), 6.95 (d, J = 8.8 Hz, 2H), 5.79 - 5.71 (m, 1H), 5.17 - 5.06 (m, 2H), 4.58 (d, 2H), 3.82 (s, 3H), 2.81 - 2.75 (m, 1H), 2.37 - 2.30 (m, 2H), 1.94 - 1.88 (m, 2H), 1.73 - 1.66 (m, 2H), 1.50 - 1.43 (m, 5H); ESI MS m / z 363 [M+H] + 。
[0494] Synthesis Example 21: Synthesis of Compound B2-5B
[0495] The method for producing compound B2-5B (also known as ALB-210363) (also known as Scheme 22) is as follows.
[0496]
Chemical Formula 67
[0497]
[0498] Production of Compound 1
[0499] To a chilled solution of Compound Int-11 (Compound 11 of Scheme 1) (0.15 g, 0.373 mmol, IN-BSC-J-51) dissolved in THF (5.0 mL) was added dropwise LiAlH4 (0.37 mL, 2.0 M in THF, 0.746 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 6 minutes. The progress of the reaction was monitored by TLC, and the reaction was quenched with Na2SO4·10H2O and concentrated under reduced pressure. The residue was purified by column chromatography using 0 - 30% EtOAc / hexane to obtain Compound 1 (0.045 g, 32%) as a colorless viscous substance. ESI MS m / z 375C 23 H 24 O4 + H] + 。
[0500] Production of Compound 2
[0501] To a cold solution of Compound 1 (0.03 g, 0.080 mmol) dissolved in CH2Cl2 (10 mL) was added Proton Sponge (Sigma-Aldrich; registered trademark) (0.0859 g, 0.40 mmol) at 0 °C, and then Me3OBF4 (0.059 g, 0.40 mmol) was added. Subsequently, the reaction mixture was stirred at room temperature for 20 hours, the reaction mixture was diluted with water (25 mL), and extracted with CH2Cl2 (25 mL × 2). After combining the organic layers, it was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain a crude product. The crude product was purified by column chromatography using 0 - 6% EtOAc in hexane to obtain Compound 2 (0.022 g, 79%) as a colorless viscous substance.
[0502] Preparation of Compound ALB-210363 (B2-5B)
[0503] To a stirred solution of Compound 2 (0.022 g, 0.0635 mmol) dissolved in MeOH (1.0 mL), THF (2.0 mL), and water (0.5 mL) was added LiOH·H2O (0.013 g, 0.317 mmol). The reaction solution was stirred at room temperature for 16 hours and concentrated under reduced pressure. The residue was diluted with water (25 mL), acidified with HCl solution (2N, 3.0 mL), and extracted with EtOAc (25 mL × 2). After combining the organic layers, it was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain a crude product. The crude product was purified by preparative HPLC column chromatography, and the preparative fractions were evaporated by freeze-drying to obtain Compound ALB-210363 (B2-5B) (0.006 g, 28%) as an off-white solid. 1 H NMR (400 MHz, CDCl3) δ 7.01 (d, J = 8.4 Hz, 2H), 6.77 (d, J = 8.4 Hz, 2H), 4.55 (s, 2H), 3.75 (s, 3H), 3.63 (d, 9.2 Hz, 1H), 3.56 (d, 9.2 Hz, 1H), 3.44 (s, 3H), 2.67 - 2.57 (m, 1H), 2.388 (s, 2H), 2.31 - 2.18 (m, 2H), 1.91 (t, 14.8 Hz, 2H), 1.51 (m, 1H), 1.50 (s, 3H), 1.49 - 1.37 (m, 3H); ESI MS m / z 331.2C 20 H 28 O4-H] + 。
[0504] Conditions for preparative HPLC:
[0505] Column: Gemini NX-C18 10μm; 150×30mm
[0506] Mobile phase A: 0.05% formic acid aqueous solution;
[0507] Mobile phase B: acetonitrile.
[0508] Gradient (T / %B): 0 / 10, 2 / 30, 10 / 75, 15 / 95, 15.5 / 98, 17.5 / 98, 18 / 20, 20 / 10
[0509] Diluent: MeOH + THF
[0510] Synthesis Example 22: Synthesis of Compound B2-5A-7
[0511] The manufacturing method (also known as Scheme 23) of Compound B2-5A-7 (also known as ALB-211303) is as follows.
[0512]
Chemical Formula 68
[0513]
[0514] Manufacture of Compound 2
[0515] To a suspension of Compound Int-10 (Compound 10 of Scheme 1) (0.75 g, 2.60 mmol) and K2CO3 (0.718 g, 5.202 mmol) dissolved in NMP (8.0 mL), Compound 1 (1.1 mL, 10.4 mmol) was added at room temperature. The reaction was carried out in a sealed tube at 220 °C for 5 hours, and the reaction was quenched by adding HCl solution (2N, 40 mL). The resulting mixture was extracted with MTBE (60 mL × 3), dried over Na2SO4, and concentrated under reduced pressure to obtain a residue. It was purified by combiflash column chromatography using 0-80% EtOAc / hexane to obtain Compound 2 (0.38 g, 56%) as a pale yellow solid. ESI MS m / z 259 [C 16 H 20 O3-H] + .
[0516] Manufacture of Compound 3
[0517] To a stirred solution of Compound 2 (0.38 g, 1.46 mmol) dissolved in acetonitrile (20 mL) was added K2CO3 (0.604 g, 4.38 mmol) at 0 °C, and then methyl iodide (0.415 g, 2.92 mmol) was added. The reaction was carried out at room temperature for 16 hours, filtered, and concentrated under reduced pressure to obtain a residue. It was purified by combiflash column chromatography using 0 - 50% EtOAc / hexane to obtain Compound 3 (0.33 g, 82%) as a colorless viscous liquid.
[0518] Preparation of Compound 4
[0519] To a stirred solution of Compound 3 (0.4 g, 1.458 mmol) dissolved in acetonitrile (20 mL) was added K2CO3 (0.603 g, 4.374 mmol) at room temperature, and then (3 - bromopropoxy)(tert - butyl)dimethylsilane (0.44 g, 1.74 mmol) was added. The reaction was carried out at 80 °C for 48 hours, filtered, and concentrated under reduced pressure to obtain a residue. It was purified by combiflash column chromatography using 0 - 20% EtOAc / hexane to obtain Compound 4 (0.52 g, 79.8%) as a colorless liquid.
[0520] Preparation of Compound 5
[0521] To a stirred solution of Compound 4 (0.52 g, 1.164 mmol) dissolved in THF (8.0 mL) was added dropwise lithium diisopropylamide (1.74 mL, 2.0 M in THF, 3.492 mmol) at -78 °C. After the solution was stirred at -78 °C for 30 minutes, tert - butyl 2 - bromoacetate (0.454 g, 2.32 mmol) was added to the reaction mixture. The reaction mixture was stirred at -78 °C for 30 minutes, and the reaction was quenched with saturated NH4Cl solution (10 mL). The resulting mixture was extracted with EtOAc (50 mL × 2). The combined organic layers were washed with brine (20 mL), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 10% EtOAc / hexane to obtain Compound 5 (0.36 g, 55%) as a colorless viscous liquid.
[0522] Preparation of Compound 6
[0523] To a cold solution of Compound 5 (0.18 g, 0.328 mmol) dissolved in THF (6.0 mL) was added LiAlH4 (2.0 M in THF, 0.5 mL, 0.962 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 3 minutes, and the reaction was quenched with saturated NH4Cl (5.0 mL). The resulting mixture was extracted with EtOAc (30 mL × 2). After combining the organic layers, they were washed with brine (10 mL), dried over Na2SO4, and concentrated under reduced pressure to obtain a residue. It was purified by combiflash column chromatography using 0 - 30% EtOAc / hexane to give Compound 6 (0.065 g, 38%) as a colorless liquid.
[0524] Preparation of Compound ALB - 211303 (B2 - 5A - 7)
[0525] To a stirred solution of Compound 6 (0.065 g, 0.1219 mmol) dissolved in CH2Cl2 (5.0 mL) was added p - toluenesulfonic acid monohydrate (0.696 g, 0.365 mmol) at room temperature. The reaction mixture was stirred at room temperature for 16 hours. The reaction mixture was diluted with CH2Cl2 (50 mL) and washed with saturated NaHCO3 solution (30 mL) and brine (20 mL). The organic layer was dried over Na2SO4 and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using silica gel 0 - 30% EtOAc / hexane to give Compound ALB - 211303 (B2 - 5A - 7) (0.014 g, 33%) as a colorless viscous substance. 1 H NMR (400 MHz, CDCl3) δ 7.01 (d, J = 8.8 Hz, 2H), 6.80 (d, J = 8.8 Hz, 2H), 4.57 (d, J = 1.2 Hz, 2H), 4.30 - 4.25 (q, 2H), 4.09 (t, J = 6.0 Hz, 2H), 3.85 (d, J = 4.4 Hz, 2H), 2.56 - 2.45 (m, 1H), 2.34 (d, J = 3.2 Hz, 2H), 2.29 - 2.22 (m, 1H), 2.08 - 2.00 (m, 2H), 1.93 - 1.86 (m, 2H), 1.81 - 1.77 (m, 2H), 1.66 - 1.52 (m, 3H), 1.49 (s, 3H); ESI MS m / z 345C 21 H 28 O4 + H] + 。
[0526] Synthesis Example 23: Synthesis of Compound B2 - 5A - 7 - 1
[0527] The manufacturing method of compound B2-5A-7-1 (also known as ALB-211355) (also known as Scheme 24) is as follows.
[0528] [Chemical 69]
[0529]
[0530] To a cold solution of compound Int-5 (compound 5 of Scheme 23) (0.05 g, 0.0891 mmol) dissolved in 2,2,2-trifluoroethanol (0.25 mL) was added TMSCl (0.075 mL) at 0 °C. Subsequently, the reaction mixture was heated to room temperature and stirred for 2 hours. The progress of the reaction was monitored by TLC. The reaction mixture was concentrated under reduced pressure to obtain a crude product. The crude product was purified by preparative HPLC column chromatography, and the preparative fractions were evaporated by freeze-drying to obtain compound ALB-211355 (B2-5A-7-1) (0.01 g, 28.7%) as a colorless viscous substance. 1 1H NMR (400 MHz, CDCl3) δ 7.04 (d, J = 8.8 Hz, 2H), 6.79 (d, J = 8.4 Hz, 2H), 4.53 (d, J = 1.2 Hz, 2H), 4.08 (t, J = 5.8 Hz, 2H), 3.85 (t, J = 5.8 Hz, 2H), 3.759 (s, 3H), 2.86 - 2.75 (m, 1H), 2.63 (d, J = 15.2 Hz, 1H), 2.49 (d, J = 15.2 Hz, 1H), 2.39 - 2.19 (m, 4H), 2.08 - 1.98 (m, 2H), 1.75 - 1.60 (m, 2H), 1.47 (s, 3H), 1.47 - 1.3 (m, 2H); ESI MS m / z 391 [C 22 1H 30 O6 + H] + .
[0531] Conditions for preparative HPLC:
[0532] Column: Gemini NX-C18 10 μm; 150 × 30 mm
[0533] Mobile phase B: Acetonitrile;
[0534] Mobile phase A: 0.05% aqueous formic acid
[0535] Gradient (min / % B): 0 / 10, 2 / 30, 10 / 55, 15 / 85, 15.5 / 98, 18.5 / 98, 19 / 10, 20 / 10
[0536] Diluent: MeOH
[0537] Column flow rate: 30 mL / min
[0538] Synthesis Example 24: Synthesis of Compound B2-5A-1
[0539] The method for producing compound B2-5A-1 (also known as ALB-210360) (also known as Scheme 25) is as follows.
[0540]
Chemical Formula 70
[0541]
[0542] Production of Compound 2
[0543] To a solution of lithium diisopropylamide (0.24 mL, 2.0 M in THF, 0.41 mmol) dissolved in THF (2.0 mL) was added dropwise Compound Int-7 (Compound 7 of Scheme 19) (0.05 g, 0.162 mmol) at -78°C. The solution was stirred at -78°C for 30 minutes, and then Compound 1 (0.04 mg, 0.19 mmol) was added. The reaction mixture was stirred at -78°C for 30 minutes, and the reaction was quenched with saturated NH4Cl solution (5.0 mL). The resulting mixture was extracted with EtOAc (10 mL × 3). The organic layers were combined, washed with brine (5.0 mL), dried over Na2SO4, and concentrated. The residue was purified by combiflash column chromatography using 0-10% EtOAc / hexane to obtain Compound 2 (0.03 g, 44%) as a colorless liquid. 1 1H NMR (400 MHz, CDCl3) δ 7.74 (d, J = 8.4 Hz, 2H), 7.57 (s, 1H), 7.45 - 7.30 (m, 3H), 4.58 - 4.47 (m, 2H), 3.81 (s, 3H), 3.05 - 2.98 (m, 1H), 2.59 - 2.43 (m, 9H), 1.75 - 1.70 (m, 2H), 1.68 - 1.67 (m, 1H), 1.45 (s, 3H), 1.39 (s, 9H).
[0544] Production of Compound 3
[0545] To a cold solution of Compound 2 (0.03 g, 0.07 mmol) dissolved in THF (3.0 mL) was added LiAlH4 (0.14 mL, 1.0 M in THF, 0.14 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 15 minutes and diluted with H2O and Na2SO4·10H2O. The resulting mixture was extracted with EtOAc (5.0 mL × 3). The organic layers were combined, washed with brine (5.0 mL), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 30% EtOAc / hexane to give Compound 3 (0.01 g, 36%) as a colorless oil. 1 1H NMR (400 MHz, CDCl3) δ 7.74 - 7.71 (m, 3H), 7.55 (s, 1H), 7.43 - 7.36 (m, 2H), 7.31, 7.28 (dd, J = 1.6, 8.4 Hz, 2H), 4.57 - 4.46 (m, 2H), 3.82 (t, J = 6.0 Hz, 2H), 3.07 - 2.85 (m, 1H), 2.44 - 2.35 (m, 2H), 2.22 (s, 2H), 1.96 - 1.87 (m, 3H), 1.69 - 1.65 (m, 3H), 1.49 (s, 4H), 1.41 (s, 9H).
[0546] Preparation of Compound ALB - 210360 (B2 - 5A - 1)
[0547] To a cold solution of Compound 3 (0.01 g, 0.025 mmol) dissolved in CH2Cl2 (1.0 mL) was added p - TSA (0.009 g, 0.05 mmol) at room temperature. The reaction mixture was stirred at room temperature for 16 hours and diluted with H2O. The resulting mixture was extracted with EtOAc (5.0 mL × 3). The organic layers were combined, washed with brine (5.0 mL), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by combiflash column chromatography using 0 - 20% EtOAc / hexane and Compound ALB - 210360 (B2 - 5A - 1) (0.0008 g) was obtained as an off - white solid by preparative HPLC. 11H NMR (400 MHz, CDCl3) δ 7.77 - 7.72 (m, 3H), 7.52 (s, 1H), 7.42 - 7.39 (m, 3H), 4.58 - 4.50 (m, 2H), 4.31 (s, 2H), 2.74 - 2.67 (m, 1H), 2.46 - 2.39 (m, 1H), 2.34 (d, J = 3.6 Hz, 2H), 1.96 - 1.72 (m, 3H), 1.66 - 1.60 (m, 2H), 1.49 (s, 3H); ESI MS m / z 321 C 22 H 24 O2 + H] + 。
[0548] Synthesis Example 25: Synthesis of Compounds B2 - 2A and B2 - 3A
[0549] The manufacturing method of compound B2 - 2A (also known as ALB - 210365) (also known as Scheme 26) and the manufacturing method of B2 - 3A (also known as ALB - 210797) are as follows.
[0550]
Chemical Formula 71
[0551]
[0552] Manufacture of Compound 1
[0553] To a solution of Compound Int - 7 (Compound 7 of Scheme 1) (0.02 g, 0.081 mmol) dissolved in THF (3.0 mL) and t - BuOH (2.0 mL) at 0 °C was added t - BuOK (0.0137 g, 0.122 mmol), and then CH3NO2 (0.01 g, 0.1639) was added. The mixture was stirred at 0 °C for 1 hour. Thereafter, the reaction mixture was stirred at room temperature for 20 hours. The reaction mixture was diluted with saturated NH4Cl (20 mL), extracted with MTBE (2 x 20 mL), dried over anhydrous Na2SO4, filtered, and concentrated to obtain a crude product. The crude product was purified by column chromatography using 0 - 20% EtOAc / hexane to obtain Compound 1 (0.005 g, 20%) as a colorless liquid. ESI MS m / z 306 C 17 H 23 NO4 + H] + 。
[0554] Manufacture of Compound 2
[0555] To a stirred solution of Compound 1 (0.05 g, 0.163 mmol) dissolved in EtOH (5.0 mL) and H2O (2.0 mL) was added Fe (0.036 g, 0.655 mmol), followed by the addition of NH4Cl (0.034 g, 0.655 mmol), and the mixture was stirred at 90 °C for 4 h. The reaction mixture was filtered through diatomaceous earth, diluted with water (40 mL), and extracted with CH2Cl2 (50 mL × 2). The organic layer was washed with brine (10 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give Compound 2 [0.055 g (crude product)] as a brown liquid. The crude product was used in the next step without purification.
[0556] Preparation of Compound ALB-210365 (B2-2A)
[0557] To a stirred solution of Compound 2 (0.045 g, 0.163 mmol) dissolved in MeOH (5.0 mL) and then in AcOH (0.02 mL) was added formaldehyde (1.0 mL) at room temperature, and the mixture was stirred at room temperature for 16 h. NaCNBH3 (0.030 g, 0.490 mmol) was added to the reaction mixture at 0 °C. Thereafter, the reaction mixture was stirred at room temperature for 4 h. The reaction mixture was diluted with saturated NaHCO3 (40 mL) and extracted with CH2Cl2 (50 mL × 2). The combined organic layers were dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give a crude product. The crude product was purified by preparative HPLC column chromatography, and the preparative fractions were evaporated by freeze-drying to give Compound ALB-210365 (B2-2A) (0.02 g, 40%) as a colorless viscous liquid. 1 1H NMR (400 MHz, CDCl3) δ 7.09 (d, J = 8.8 Hz, 2H), 6.80 (d, J = 8.7 Hz, 2H), 4.58 (d, J = 15.2 Hz, 2H), 3.78 (s, 3H), 3.15 - 3.02 (m, 1H), 2.86 - 2.74 (m, 1H), 2.73 (s, 6H), 2.72 - 2.62 (m, 1H), 2.45 - 2.35 (m, 1H), 2.12 - 1.98 (m, 3H), 1.71 - 1.61 (m, 1H), 1.55 (s, 3H), 1.48 - 1.35 (m, 3H); ESI MS m / z 304C 19 H 29 NO2 + H] + 。
[0558] Conditions for preparative HPLC:
[0559] Column: Gemini NX-C18 10 μm; 150 × 30 mm
[0560] Mobile phase A: Acetonitrile
[0561] Mobile phase B: 10 mM ammonium formate aqueous solution
[0562] Gradient (min / %A): 0 / 10, 2 / 20, 10 / 40, 15 / 60, 15.5 / 98, 18 / 98, 18.2 / 10, 20 / 10
[0563] Diluent: MeOH + THF
[0564] Preparation of compound ALB-210797 (B2-3A)
[0565] To a stirred solution of compound Int-2 (compound 2 of Scheme 26) (0.01 g, 0.036 mmol) dissolved in CH2Cl2 (5.0 mL) was added triethylamine (0.007 g, 0.072 mmol) at 0 °C, and then methanesulfonyl chloride (0.004 g, 0.036) was added. The reaction mixture was then stirred at 0 °C for 2 hours. The reaction mixture was diluted with water (20 mL) and extracted with CH2Cl2 (30 mL × 2). The combined organic layers were dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give a crude product. The crude product was purified by preparative HPLC column chromatography, and the preparative fractions were evaporated by freeze-drying to give compound ALB-210797 (B2-3A) (0.004 g, 31%) as an off-white solid. 1 1H NMR (400 MHz, CDCl3) δ 7.04 (d, J = 8.8 Hz, 2H), 6.79 (d, J = 8.4 Hz, 2H), 4.74 (t, J = 6.4 Hz, 1H), 4.56 (d, J = 8.4 Hz, 2H), 3.76 (s, 3H), 3.15 - 3.02 (m, 2H), 2.97 (s, 3H), 2.96 - 2.84 (m, 1H), 2.32 - 2.20 (m, 1H), 1.98 (brs, 1H), 1.92 - 1.83 (m, 3H), 1.72 - 1.65 (m, 1H), 1.52 (s, 3H), 1.51 - 1.38 (m, 2H); ESI MS m / z 352C 18 H 27 NO4 S-H] + 。
[0566] Preparative HPLC conditions:
[0567] Column: Gemini NX-C18 10 μm; 150 × 30 mm
[0568] Mobile phase A: Acetonitrile;
[0569] Mobile phase B: 0.05% aqueous formic acid solution
[0570] Gradient (min / % A): 0 / 10, 2 / 30, 10 / 60, 15 / 80, 15.2 / 98, 18 / 98, 18.2 / 10, 20 / 10
[0571] Diluent: MeOH + THF
[0572] Example 2: Evaluation of TLR7 activation inhibition of each derivative
[0573] Using mouse TLR7-expressing reporter cells (Ba / F3 cells), the TLR7 activation inhibition of each derivative and CB-7 was evaluated. These cells were provided by Prof. Kensuke Miyake (Department of Infectious Genetics, Institute of Medical Science, The University of Tokyo). A reporter gene in which a GFP gene was linked downstream of the promoter region of NF-κB was introduced into these cells. Therefore, the addition of a ligand for TLR7 expressed by the cells enhanced the expression of GFP. The fluorescence intensity of this GFP was weakened by the addition of each derivative, and the TLR7 activation inhibition of each derivative was evaluated using this as an index.
[0574] Loxoribine (manufactured by Alexis Biochemicals) was used as the ligand for mouse TLR7. Gardiquimod (manufactured by Invivogen) was used as the ligand for human TLR7.
[0575] Ba / F3 cells cultured in RPMI1640 medium containing 10% (v / v) fetal bovine serum (FCS), 50 U / mL penicillin, 50 μg / mL streptomycin, 2 mM L-glutamine, 50 μM 2-mercaptoethanol, and 1 ng / mL interleukin-3 were dispensed into a 96-well plate at a cell number of 1.0×10 5 cells / 100 μL per well. 50 μL of the derivative or CB-7 prepared at a final concentration of 1, 5, 10, 25, 50, and 100 μM was added to each well. The 96-well plate was incubated at 37°C for 30 minutes in the presence of 5% CO2. Then, 250 μg / mL of loxoribine was added to each well and cultured for 18 hours. After the culture, the cells were washed with PBS (FACS buffer) containing 2.5% (v / v) FCS, and each cell was suspended in 200 μL of FACS buffer containing 25 μg / mL of 7-actinomycin D. The GFP fluorescence intensity of the cells was analyzed using a flow cytometer. The measurement of the flow cytometer was performed using FACSCanto TMII (manufactured by Becton Dickinson) and the data was analyzed using FlowJo software (manufactured by Tree Star). The MFI when stimulated with lobucavir alone was set as 100%, and the MFI (%) when stimulated with lobucavir in the presence of 1 - 100 μM derivatives or CB-7 was calculated. Then, the IC 50 (compound concentration that inhibits 50% of the activity) was calculated by logistic regression analysis.
[0576] The IC 50 of each derivative is shown in Table 3. It should be noted that the IC 50 of CB-7 is 3.12 μM.
[0577]
Table 3
[0578]
[0579]
[0580] As shown in Table 3, the derivatives with higher TLR7 activation inhibitory activity than CB-7 are B2-5A, B2-13, B2-22, B2-24, B2-26, B2-28, B2-29, B2-24-1, B2-24-2, B2-24-3, B2-24-4·HCl, B2-5A-4, B2-5A-6, B2-5A-7, and B2-5A-9. Among them, the derivatives with more than 2-fold higher TLR7 activation inhibitory activity than CB-7 are B2-13, B2-22, B2-24, B2-26, B2-24-1, B2-24-2, B2-24-3, B2-24-4·HCl, B2-5A-6, and B2-5A-9. B2-24-4·HCl has the highest TLR7 activation inhibitory activity compared with other derivatives.
[0581] In addition, it was revealed that the introduction of an N atom into region b is important for the expression of high activity. Even if region a is substituted with a lactone ring, it has no effect on the TLR7 activation inhibitory activity.
[0582] Example 3: Analysis of the metabolic stability of B2-24 and B2-5A using mouse liver microsomes (cytochrome P450 (CYP)) CB-7, B2-24, and B2-5A were in 10 mg / mL DMSO solution. Each compound was diluted with acetonitrile to prepare 0.1 mg / mL as the analytical standard. Mouse liver microsomes were rapidly thawed in a 37 °C water bath and kept on ice. The reaction buffer containing CYP coenzymes was prepared on ice and mixed with the microsome components. After incubating the reaction solution at 37 °C for 5 minutes, the test substance solution was added and mixed by pipetting. The volume of the reaction solution was 200 μL, and the final concentration of the test substance was 0.1 mg / mL. The reaction solution was incubated at 37 °C for 30 minutes or 2 hours, and 3 volumes of acetonitrile were added to stop the reaction by vortexing. The sample after the reaction was stopped was centrifuged, and the supernatant was removed and dried using an evaporator. 50 μL of 50% aqueous acetonitrile solution was added to the dried sample, and it was vortexed for 5 minutes to redissolve. The redissolved solution was centrifuged, and the supernatant was analyzed by HPLC. The HPLC system used HITACHI Lachrom ELITE (manufactured by HITACHI), and the column used was COSMOSIL 5C 18 -MS-II, 4.6 mm I.D. × 150 mm (manufactured by nacalai tesque). The results are shown in Table 4.
[0583]
Table 4
[0584]
[0585] The number of peaks of CB-7 detected by HPLC was 7. On the other hand, the number of peaks of B2-24 and B2-5A detected by HPLC was 4, which was less than that of CB-7. Therefore, compared with CB-7, the drug metabolism of B2-24 and B2-5A was mainly improved based on CYP. From this result, it can be speculated that the TLR7 inhibitory activity of the mixed derivative of B2-24 and B2-5A is high, and the metabolic stability can be improved.
[0586] Example 4: Synthesis of the mixed derivative (B2-24-4-5A) of B2-24-4·HCl and B2-5A
[0587] Albany Molecular Research Inc. (USA) was commissioned to prepare the mixed derivative (B2-24-4-5A) of B2-24-4·HCl (a derivative with a structure similar to B2-24 and the highest TLR7 inhibitory activity) and B2-5A shown below. The structure of B2-24-4-5A is represented by the following formula (X).
[0588]
Chemical Formula 72
[0589]
[0590]
Chemical formula 73
[0591] The structure of B2-24-4-5A·HCOOH is represented by the following formula (XIV).
[0592]
[0593] Synthesis Example 26: Synthesis of Compound B2-24-4-5A and B2-24-4-5A·HCOOH
[0594] The production method of Compound B2-24-4-5A and B2-24-4-5A·HCOOH (also known as Scheme 27) is as follows.
[0595]
Chemical formula 74
[0596]
[0597] Production of Compound 2
[0598] To a solution of (-)-β-pinene (100.0 g, 0.735 mol) dissolved in CH2Cl2 (1.0 L), CH3CN (1.0 L) and water (1.50 L) at 0 °C was added NaIO4 (626.4 g, 2.94 mol) and RuCl3·nH2O (4.56 g, 22.0 mmol). The reaction mixture was stirred at room temperature for 5 hours. The reaction mixture was diluted with EtOAc (1.0 L) and washed with water (1.0 L) and brine (500 mL). The resulting mixture was dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to obtain Compound 2 [96.0 g (crude product), quantitative] as a brown liquid. 1 1H NMR (400 MHz, CDCl3) δ 2.58 - 2.51 (m, 3H), 2.38 - 2.30 (m, 1H), 2.25 - 2.21 (m, 1H), 2.08 - 2.01 (m, 1H), 1.98 - 1.90 (m, 1H), 1.57 (s, 1H), 1.35 (s, 3H), 0.84 (s, 3H).
[0599] Production of Compound 3
[0600] A mixture of Compound 2 (96.0 g, 695.0 mmol) dissolved in methanol (1.0 L), (PhSe)2 (108.0 g, 347.0 mmol), SeO2 (91.2 g, 834.0 mmol), and H2SO4 (25.9 mL, 486.0 mmol) was stirred at room temperature for 5 hours. The reaction mixture was quenched with water (1.0 L) and extracted with EtOAc (1.0 L × 2). The organic extract was washed with brine (500 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica gel (60 - 120 mesh) column chromatography using 5% EtOAc / hexane to give Compound 3 (80.0 g, 39%) as a greenish-brown liquid. 1 1H NMR (400 MHz, CDCl3) δ 7.61 - 7.58 (m, 2H), 7.32 - 7.25 (m, 1H), 3.87 (dd, J = 1.6 Hz, 8.0 Hz, 1H), 2.71 - 2.68 (m, 1H), 2.61 - 2.52 (m, 2H), 2.24 - 2.20 (m, 2H), 1.88 (s, 1H), 1.35 (s, 3H), 0.84 (m, 3H).
[0601] Preparation of Compound 4
[0602] To a solution of Compound 3 (80.0 g, 272.0 mmol) dissolved in CH2Cl2 (800 mL) was added 7% H2O2 (140.0 mL, 408.0 mmol) at 0 °C, followed by pyridine (43.8 mL, 544.0 mmol), and the mixture was stirred at room temperature for 12 hours. The reaction mixture was diluted with CH2Cl2 (1.0 L) and washed with water (1.0 L) and brine (500 mL). The resulting mixture was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The crude product was purified by silica gel (60 - 120 mesh) column chromatography using 0 - 5% EtOAc / hexane to give Compound 4 (30.0 g, 81%) as an oily liquid. 1 1H NMR (400 MHz, CDCl3) δ 7.54 - 7.50 (m, 1H), 5.95 (d, J = 8.8 Hz, 3H), 2.86 - 2.83 (m, 1H), 2.73 - 2.57 (m, 2H), 2.13 (s, 1H), 1.51 (s, 3H), 1.04 (m, 3H).
[0603] Preparation of Compound 5
[0604] To a solution of compound 4 (10.0 g, 73.5 mmol) dissolved in 1,4-dioxane (100 mL) and water (20.0 mL) was added compound 4a (compound 1 of Scheme 4) (14.5 g, 95.5 mmol), KOH (8.20 g, 147.0 mmol), and the mixture was degassed for 15 minutes. The [Rh(COD)Cl]2 complex (2.17 g, 4.40 mmol) was added to the reaction mixture, which was then stirred and heated at 80 °C for 12 hours. The residual solvent was evaporated under reduced pressure. The crude product was dissolved in CH2Cl2 (500 mL) and filtered through a bed of Celite. The filtrate was washed with water (500 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica gel combiflash chromatography using eluent 0 - 40% EtOAc / hexane to give compound 5 (6.15 g, 34%) as a colorless oil. ESI MS m / z 227 [M - NH4] + 。
[0605] Preparation of Compound 6
[0606] To a solution of compound 5 (6.15 g, 25.0 mmol) dissolved in Ac2O (60 mL) was added Zn(OAc)2 (5.07 g, 27.7 mmol), BF3·OEt2 (3.42 mL, 27.7 mmol), and the mixture was stirred at room temperature for 12 hours. The reaction mixture was neutralized with saturated NaHCO3 (500 mL). The resulting mixture was extracted with EtOAc (2 × 250 mL). The combined organic layers were washed with brine (250 mL), dried over anhydrous MgSO4, and concentrated under reduced pressure to give a residual oil. It was purified by silica gel combiflash chromatography using eluent 0 - 30% EtOAc / hexane to give compound 6 (5.00 g, 69%) as an off-white solid. ESI MS m / z 269 [M - NH4] + 。
[0607] Preparation of Compound 7
[0608] To a solution of compound 6 (5.00 g, 17.4 mmol) dissolved in methanol (50 mL) was added portionwise NaH (0.70 g, 60% in mineral oil, 17.4 mmol) at 0 °C over 30 minutes. The reaction mixture was stirred at room temperature for 30 minutes. The reaction mixture was quenched with saturated aqueous NH4Cl (25 mL) at 0 °C. The methanol was evaporated under reduced pressure. The residual suspension was filtered and washed successively with water (100 mL) and hexane (100 mL) to give compound 7 (4.50 g, crude product) as an off-white solid. ESI MS m / z 227 [M - NH4] + 。
[0609] Preparation of Compound 8
[0610] To a cold solution of tosylmethyl isocyanide (1.59 g, 8.2 mmol) and t-BuOK (1.83 g, 16.3 mmol) dissolved in THF (15 mL) was added Compound 7 (1.00 g, 4.00 mmol) dissolved in THF (15.0 mL). After stirring at 0 °C for 10 minutes, methanol (25 mL) was added. The resulting mixture was stirred under reflux for 1 hour and concentrated under reduced pressure. The residue was purified by combiflash chromatography on silica gel using eluent 0 - 50% EtOAc / hexane to give Compound 8 (0.80 g, 77%) as a pale yellow liquid. This step was repeated several times to obtain Compound 8 in a 77% yield.
[0611] Preparation of Compound 9
[0612] To a solution of Compound 8 (4.00 g, 15.0 mmol) dissolved in 2-propanol (40 mL) was added KOH (8.70 g, 156.0 mmol) at room temperature. The reaction mixture was heated to 100 °C and stirred under reflux for 48 hours. The residual solvent was evaporated under reduced pressure. The crude product was dissolved in EtOAc (100 mL) and washed with water (50 mL). The aqueous layer was neutralized by adding 2N HCl solution and extracted with EtOAc (2 × 100 mL). The combined organic layers were washed with brine (50 mL), dried over MgSO4, and concentrated under reduced pressure to give Compound 9 (2.50 g, crude product) as a brown viscous substance. ESI MS m / z 273 [M - H] + 。
[0613] Preparation of Compound 10
[0614] To a solution of Compound 9 (2.50 g, 9.12 mmol) dissolved in acetonitrile:methanol (15:5 mL) was added dropwise K2CO3 (3.80 g, 27.3 mmol) and MeI (3.84 mL, 27.3 mmol) at 0 °C. The reaction mixture was heated to room temperature and stirred for 16 hours. The reaction mixture was diluted with water (100 mL) and extracted with EtOAc (2 × 50 mL). The combined organic layers were washed with brine (50 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by combiflash chromatography on silica gel using eluent 0 - 30% EtOAc / hexane to give Compound 10 (1.25 g, 48%) as an oily viscous substance. ESI MS m / z 271 [M - NH4] + 。
[0615] Preparation of Compound 11
[0616] To a stirred solution of Compound 10 (1.25 g, 4.30 mmol) dissolved in CH2Cl2 (15 mL) was added imidazole (0.63 g, 10.8 mmol) portionwise at 0 °C, followed by the addition of TBDMSCl (0.78 g, 5.20 mmol) portionwise. The reaction mixture was stirred at room temperature for 16 h, diluted with CH2Cl2 (100 mL), and washed with saturated aqueous NaHCO3 (50 mL). The resulting reaction mixture was dried over anhydrous Na2SO4 and concentrated under reduced pressure. The residue was purified by combiflash chromatography on silica gel using eluent 0 - 10% EtOAc / hexane to give Compound 11 (1.25 g, 72%) as a pale yellow oil.
[0617] Preparation of Compound 12
[0618] To a solution of lithium diisopropylamide (5.78 mL, 2.0 M in THF, 11.5 mmol) dissolved in THF (8.0 mL) was added dropwise a solution of Compound 11 (1.55 g, 3.80 mmol) dissolved in THF (8.0 mL) at -78 °C. The solution was stirred at -78 °C for 30 min, and tert-butyl 2-bromoacetate (1.60 mL, 7.70 mmol) was added to the reaction mixture. The reaction mixture was stirred at -78 °C for 30 min, and the reaction was quenched with saturated aqueous NH4Cl (15 mL). The resulting mixture was extracted with EtOAc (2 × 50 mL). The combined organic layers were washed with brine (25 mL), dried over anhydrous Na2SO4, and concentrated under reduced pressure. The residue was purified by combiflash chromatography on silica gel using eluent 0 - 10% EtOAc / hexane to give Compound 12 (2.1 g, crude product) as a pale yellow oil.
[0619] Preparation of Compound 13
[0620] To a cold solution of Compound 12 (2.10 g, 4.06 mmol) dissolved in THF (20 mL) was added TBAF (8.10 mL, 1 M in THF, 8.13 mmol) at 0 °C. The reaction mixture was stirred at room temperature for 8 h and diluted with water (50 mL). The resulting mixture was extracted with EtOAc (2 × 50 mL). The combined organic layers were washed with brine (25 mL), dried over MgSO4, and concentrated under reduced pressure to give a residual oil. It was purified by combiflash chromatography on silica gel using eluent 0 - 30% EtOAc / hexane to give Compound 13 (1.48 g, 90%) as a colorless viscous substance.
[0621] Preparation of Compound 14
[0622] To a cold solution of compound 13 (1.48 g, 3.60 mmol) dissolved in CH2Cl2 (15 mL) was added Dess-Martin periodinane (3.12 g, 7.36 mmol) at 0 °C. The reaction mixture was stirred at room temperature for 2 h. The reaction mixture was quenched at 0 °C with saturated aqueous Na2S2O3 (20 mL) and saturated aqueous NaHCO3 (20 mL), filtered through a Celite bed, and extracted with CH2Cl2 (2 × 50 mL). The combined organic layers were washed with brine (50 mL), dried over MgSO4, and concentrated under reduced pressure to give compound 14 [1.50 g (crude product)] as a colorless oil. ESI MS m / z 401 [M+H] + 。
[0623] Preparation of Compound 15
[0624] To a solution of compound 14 (1.50 g, 3.75 mmol) dissolved in methanol (5.0 mL) and a small amount of AcOH (0.06 mL, 1.10 mmol) was added compound 14a (1.39 g, 7.50 mmol) at room temperature, followed by NaCNBH3 (0.71 g, 11.20 mmol). The reaction mixture was stirred at room temperature for 16 h. The methanol was evaporated and the residue was diluted with water (50 mL). The resulting mixture was extracted with EtOAc (2 × 50 mL). The combined organic layers were washed with brine (25 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by combiflash chromatography on silica gel using eluent 0 - 40% EtOAc / hexane to give compound 15 (1.60 g, 75%) as a colorless viscous substance. ESI MS m / z 571 [M+H] + 。
[0625] Preparation of Compound 16
[0626] To a cold solution of compound 15 (0.10 g, 0.17 mmol) dissolved in THF (10.0 mL) was added LiAlH4 (2.0 M in THF, 0.87 mL, 1.70 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 3 min and quenched with saturated aqueous NH4Cl (5.0 mL). The resulting mixture was extracted with EtOAc (2 × 10 mL). The combined organic layers were washed with brine (5 mL), dried over MgSO4, and concentrated under reduced pressure. The residue was purified by combiflash chromatography on silica gel using eluent 0 - 60% EtOAc / hexane to give compound 16 (0.034 g) as a colorless oil. This procedure was repeated several times to give compound 16 in 36% yield. ESI MS m / z 543 [M+H] + 。
[0627] Preparation of Compound B2-24-4-5A·HCOOH
[0628] To a solution of Compound 16 (0.53 g, 0.97 mmol) dissolved in CH2Cl2 (10.0 mL) was added p-toluenesulfonic acid (0.74 g, 3.90 mmol) at room temperature, and the mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with saturated aqueous NaHCO3 solution (10 mL) and extracted with CH2Cl2 (2 × 25 mL). The combined organic layers were washed with brine (25 mL), dried over MgSO4, and concentrated. The residue was purified by mass-triggered preparative HPLC to give Compound B2-24-4-5A·HCOOH (0.208 g, 51%) as an off-white solid. 1 1H NMR (400 MHz, CDCl3) δ 8.46 (s, 1H), 7.18 (d, J = 8.0 Hz, 2H), 7.06 (d, J = 8.0 Hz, 2H), 4.55 (s, 2H), 4.28 (s, 2H), 3.49 (s, 2H), 3.09 - 3.03 (m, 4H), 2.60 - 2.50 (m, 5H), 2.39 - 2.25 (m, 3H), 1.92 - 1.88 (m, 2H), 1.82 - 1.78 (m, 1H), 1.68 - 1.52 (m, 3H) 1.46 (s, 3H). ESI MS m / z 369 [M + H] + .
[0629] Preparation of Compound B2-24-4-5A
[0630] Compound B2-24-4-5A·HCOOH (100 mg) dissolved in water (5 mL) was dissolved in CH2Cl2 and extracted with 10% methanol (10 mL × 8). The combined organic layers were dried over anhydrous MgSO4, filtered, and concentrated under reduced pressure to give Compound B2-24-4-5A (45 mg). 1 1H NMR (400 MHz, CDCl3) δ 7.19 (d, J = 8.0 Hz, 2H), 7.04 (d, J = 8.0 Hz, 2H), 4.55 (s, 2H), 4.28 (s, 2H), 3.45 (s, 2H), 2.94 (t, 4H), 2.57 - 2.42 (m, 5H), 2.35 - 2.25 (m, 3H), 1.92 - 1.75 (m, 3H), 1.68 - 1.52 (m, 4H) 1.48 (s, 3H). ESI MS m / z 369 [M + H] + .
[0631] Example 5: Evaluation of the Inhibition of TLR7 Activation by B2-24-4-5A·HCOOH
[0632] The evaluation of the TLR7 activation inhibition of B2-24-4-5A·HCOOH was carried out by the method of Example 2. CB-7 and B2-24-4·HCl were used as controls. The IC 50 is shown in Table 5.
[0633]
Table 5
[0634] <![CDATA[IC 50 (μM)]]> CB-7 7.6600 B2-24-4·HCl 0.1669 B2-24-4-5A·HCOOH 0.1673
[0635] As shown in Table 5, for the TLR7 inhibitory effect on mice, B2-24-4-5A·HCOOH was almost the same as B2-24-4·HCl.
[0636] Example 6: Confirmation of the TLR7 inhibitory effect of B2-24-4-5A·HCOOH in mouse bone marrow-derived macrophages (BMDM)
[0637] The TLR7 inhibitory effect of B2-24-4-5A·HCOOH in mouse BMDM was confirmed. Mouse bone marrow cells were cultured in RPMI1640 medium containing 10 μg / ml M-CSF, 10% (v / v) fetal bovine serum (FCS), penicillin, streptomycin, L-glutamic acid, and 2-mercaptoethanol at 37 °C in the presence of 5% (v / v) CO2 for 7 days. The mouse BMDM induced and differentiated by the culture were inoculated into each well of a 96-well plate at a density of 1.0×10 5 / 100 μL. 50 μL of CB-7 or B2-24-4-5A·HCOOH was added to each well at a final concentration of 1 nM, 3 nM, 10 nM, 30 nM, 100 nM, 300 nM, 1 μM, 3 μM, 10 μM, or 30 μM and incubated for 30 minutes. It should be noted that B2-24-4-5A·HCOOH or CB-7 was used as a 10 mg / mL physiological saline or DMSO solution, respectively. Then, R848 (manufactured by Invivogen), which is a TLR7 ligand, was added at a final concentration of 10 ng / mL and cultured for 24 hours. After the culture, all the culture supernatants were collected, and the concentration of IL-6 in the culture supernatants was quantified by ELISA (using the kit: Mouse IL-6 DuoSet ELISA (trade name), manufactured by R&D Systems). The results are shown in Figure 2 .
[0638] The IL-6 induced by R848 stimulation was attenuated by the pretreatment of B2-24-4-5A·HCOOH. The TLR7 inhibitory activity effect of B2-24-4-5A·HCOOH was about 100 times stronger than that of CB-7.
[0639] Example 7: Confirmation of TLR7 selectivity of B2-24-4-5A·HCOOH in mouse BMDM
[0640] The TLR7 selectivity of B2-24-4-5A·HCOOH in mouse BMDM was confirmed. Mouse bone marrow cells were cultured in RPMI1640 medium containing 10 μg / ml M-CSF, 10% (v / v) fetal bovine serum (FCS), penicillin, streptomycin, L-glutamic acid, and 2-mercaptoethanol at 37 °C in the presence of 5% (v / v) CO2 for 7 days. The mouse BMDM induced and differentiated by the culture were inoculated into each well of a 96-well plate at a density of 1.0×10 5 / 100 μL. 50 μL of B2-24-4-5A·HCOOH was added to each well at a final concentration of 1 nM, 10 nM, or 100 nM and incubated for 30 minutes. The TLR ligands Pam2CSK4 (manufactured by Invivogen), Poly(I:C) (manufactured by Invivogen), Lipid A (manufactured by Sigma-Aldrich), R848 (manufactured by Invivogen), or CpG-B (manufactured by Invivogen) were added to each well and cultured for 24 hours. After the culture, all the culture supernatants were collected, and the concentration of IL-6 in the culture supernatants was quantified by ELISA (using a kit: Mouse IL-6 DuoSet ELISA (trade name), manufactured by R&D Systems). The results are shown in Figure 3 .
[0641] B2-24-4-5A·HCOOH inhibited the production of IL-6 induced by the stimulation of the TLR7 ligand R848, but did not inhibit the production of IL-6 induced by the stimulation of other TLR ligands. Therefore, it was demonstrated that B2-24-4-5A·HCOOH is a selective inhibitor against TLR7.
[0642] Example 8: Confirmation of the TLR7 inhibitory effect of B2-24-4-5A·HCOOH using peripheral blood mononuclear cells (PBMC) derived from patients with systemic lupus erythematosus
[0643] The TLR7 inhibitory effect of B2-24-4-5A·HCOOH in PBMC derived from patients with systemic lupus erythematosus was confirmed. PBMC were isolated from 7 mL of blood collected from patients with systemic lupus erythematosus. The isolated PBMC were adjusted to a density of 0.5×10 5Inoculate in each well of a 96-well plate containing RPMI1640 medium with 10% (v / v) fetal bovine serum (FCS), penicillin, streptomycin, L-glutamic acid, and 2-mercaptoethanol at a rate of 100 μL, and culture at 37°C in the presence of 5% (v / v) CO2. Add 50 μL of B2-24-4-5A·HCOOH, B2-24-4·HCl, or hydroxychloroquine sulfate (HCQ) as a comparative agent to each well at a final concentration of 0.1 μM, 0.5 μM, 1 μM, 5 μM, 10 μM, or 50 μM and incubate for 30 minutes. Add Gardiquimod (manufactured by Invivogen), which is a TLR7 ligand, at a final concentration of 3 μg / mL and culture for 24 hours. After culture, collect all the culture media, and quantify the concentration of IL-6 in the culture media by ELISA method (using a kit: human IL-6 DuoSet ELISA (trade name), manufactured by R&D Systems). The results are shown in Figure 4 。
[0644] IL-6 induced by Gardiquimod stimulation was attenuated by pretreatment with all the compounds, and the effects were in descending order as B2-24-4·HCl, B2-24-4-5A·HCOOH, and HCQ.
[0645] Example 9: Metabolic stability (CYP) analysis of CB-7 and B2-24-4-5A·HCOOH using mouse liver microsomes The metabolic stability analysis of CB-7 and B2-24-4-5A·HCOOH was carried out by the method of Example 5. The results of CB-7 are shown in Table 6, and the results of B2-24-4-5A·HCOOH are shown in Table 7.
[0646]
Table 6
[0647]
[0648] N.D.: Not detected under LC-UV (220 nm)
[0649]
Table 7
[0650]
[0651] N.D.: Not detected under LC-UV (220 nm)
[0652] The number of peaks detected by HPLC in CB-7 was 9 (7 of the 9 peaks are shown in Table 6). On the other hand, the number of peaks detected by HPLC in B2-24-4-5A·HCOOH was 6, which was less than that of CB-7. The peak area of CB-7 after 2 hours was 41.6%, while the peak area of B2-24-4-5A·HCOOH after 2 hours was 88.4%. Therefore, B2-24-4-5A·HCOOH significantly improved CYP-based drug metabolism compared with CB-7.
[0653] Example 10: Plasma Concentrations after Oral Administration of CB-7 or B2-24-4-5A·HCOOH to Mice
[0654] Normal mice (C57BL / 6N, 11 weeks old, female) were used to determine the plasma concentrations after oral administration of CB-7 or B2-24-4-5A·HCOOH. Mice C57BL / 6N were orally administered 1 mg of CB-7 or B2-24-4-5A·HCOOH. Blood was collected from mice C57BL / 6N at 0.5 hour, 1 hour, 2 hours, 4 hours, or 8 hours later to prepare plasma. The concentrations of CB-7 or B2-24-4-5A·HCOOH in the plasma were determined by LC / MS / MS. The results are shown in Figure 5 .
[0655] CB-7 was not detected in the plasma after 8 hours, while there was approximately 500 ng / ml of B2-24-4-5A·HCOOH in the plasma after 8 hours. It can be seen that B2-24-4-5A·HCOOH had a longer residence time in the plasma compared with CB-7.
[0656] Example 11: Plasma Concentrations after Oral Administration of B2-24-4-5A·HCOOH to Mice
[0657] Systemic lupus erythematosus model mice (NZBWF1, 20 weeks old, female) were used to determine the plasma concentrations after oral administration of B2-24-4-5A·HCOOH. NZBWF1 mice were orally administered 5 mg / kg of B2-24-4-5A·HCOOH. Blood was collected from NZBWF1 mice at 0.5 hour, 1 hour, 2 hours, 4 hours, 8 hours, 16 hours, or 24 hours later to prepare plasma. The concentrations of B2-24-4-5A·HCOOH in the plasma were determined by LC / MS / MS. The results are shown in Figure 6 .
[0658] There was 88.1 ng / ml of B2-24-4-5A·HCOOH in the plasma after 0.5 hour. It gradually disappeared thereafter and almost reached the bottom value after 8 hours.
[0659] Example 12: Confirmation of the TLR7 inhibitory effect of B2-24-4-5A·HCOOH by intraperitoneal administration in mice
[0660] Using normal mice (C57BL / 6N, 11 weeks old, female), B2-24-4-5A·HCOOH (1, 5, 10, 100, and 1000 μg) or hydroxychloroquine sulfate (HCQ, 1000 μg) as a control agent was administered intraperitoneally. 30 minutes later, 5 μg of R848 was administered intraperitoneally. Normal saline was used as the solvent. Blood was collected 1 hour after the administration of R848, and the concentration of IFN-α contained in the serum was quantified by ELISA (using a kit: Mouse IFN alpha Platinum ELISA (trade name), manufactured by eBioscience). The results are shown in Figure 7 . Figure 7 The scatter points represent the data of each individual, each thick line represents the average value of the data of each group, and each error bar represents the standard error of the data of each group.
[0661] The IFN-α induced by R848 was attenuated by the pretreatment of B2-24-4-5A·HCOOH, and its effect was stronger than that of HCQ. Intraperitoneal administration of 10 μg of B2-24-4-5A·HCOOH showed an effect of almost completely inhibiting the induction of IFN-α. In this result, if the body weight of the mouse is set to 20 g, the drug effect is expressed as 0.5 mg / kg. That is, the TLR7 inhibitory effect in vivo is more than 100 times that of HCQ.
[0662] Example 13: Confirmation of the TLR7 inhibitory effect of B2-24-4·HCl, B2-24-4-5A, or B2-24-4-5A·HCOOH by intraperitoneal administration in mice The TLR7 inhibitory effect of B2-24-4·HCl, B2-24-4-5A, or B2-24-4-5A·HCOOH was confirmed by the same method as in Example 13. The dosage of B2-24-4·HCl, B2-24-4-5A, and B2-24-4-5A·HCOOH was 10 μg. The results are shown in Figure 8 . Figure 8 The scatter points represent the data of each individual, each thick line represents the average value of the data of each group, and each error bar represents the standard error of the data of each group.
[0663] The IFN-α induced by R848 was attenuated by the pretreatment of B2-24-4·HCl, B2-24-4-5A, or B2-24-4-5A·HCOOH, and their effects from strong to weak were B2-24-4-5A·HCOOH, B2-24-4-5A, and B2-24-4·HCl.
[0664] Example 14: Confirmation of the therapeutic effect of B2-24-4-5A·HCOOH in a mouse model of drug-induced systemic lupus erythematosus
[0665] Beselna Cream (trade name) was applied to the right ears of normal mice (BALB / c, 7 weeks old, female, n = 10) three times a week for 8 weeks to induce systemic lupus erythematosus-like symptoms. Thereafter, these mice were divided into a saline administration group (control, n = 5) and a B2-24-4-5A·HCOOH administration group (n = 5). The saline administration group continued to apply Beselna Cream (trade name) in the same manner and was orally administered saline (100 μl) once a day continuously. The B2-24-4-5A·HCOOH administration group continued to apply Beselna Cream in the same manner and was orally administered 5 mg / kg of B2-24-4-5A·HCOOH (100 μl) once a day continuously. The mice were sacrificed 6 weeks after the start of administration. After sacrifice, blood was collected from the abdominal aorta of the mice, and the spleen and kidneys were removed. The removed spleen was photographed and weighed.
[0666] The removed spleen was ground with a glass slide to prepare splenocytes, which were stained with an anti-CD3 antibody labeled with FITC and an anti-CD69 antibody labeled with PE. After 20 minutes, the cells were washed with FACS buffer, and each cell was suspended in 200 μL of FACS buffer containing 25 μg / mL of 7-aminoactinomycin D. The fluorescence intensity of the cells was analyzed using a flow cytometer. The measurement of the flow cytometer was performed using FACSCanto TM II (manufactured by Becton Dickinson), and the data was analyzed using FlowJo software (manufactured by Tree Star) to calculate the proportion of CD69-positive cells (activated T cells) among CD3-positive T cells.
[0667] The removed kidneys were fixed with 4% (w / v) paraformaldehyde and entrusted to Morphotechnology Co., Ltd. for immunohistochemical staining. The blood collected from the abdominal aorta was centrifuged to prepare serum. Oriental Yeast Co., Ltd. was entrusted to quantify the blood urea nitrogen value and creatinine value in the serum. The results are shown in Figures 9A to 9D .
[0668] Figure 9A is a photograph of the removed spleen. Figure 9B Indicates the spleen weight. Figure 9C Indicates the proportion of activated T cells among spleen T cells. Figure 9D is a photograph showing IgG deposition in glomeruli. Figure 9B , 9CThe scatter points represent the data of each individual, the thick lines represent the average values of each group of data, and the error bars represent the standard errors of each group of data. Figure 9D The scale bar represents 100 μm.
[0669] From Figures 9A to 9D it can be seen that compared with the control saline administration group, the splenomegaly was inhibited in the B2-24-4-5A·HCOOH administration group, the proportion of activated T cells in splenic T cells decreased, and the deposition of IgG in glomeruli was inhibited.
[0670] Example 15: Synthesis of formate of compound B2-24-4
[0671] Albany Molecular Research Inc. (USA) was commissioned to manufacture compound B2-24-4·HCOOH. The structure of B2-24-4·HCOOH is represented by the following formula (XV).
[0672]
Chemical 75
[0673]
[0674] Synthesis Example 27: Synthesis of compound B2-24-4·HCOOH
[0675] The manufacturing method (also known as Scheme 28) of compound B2-24-4·HCOOH (also known as ALB-210796) is as follows.
[0676]
Chemical 76
[0677]
[0678] Manufacture of compound 2
[0679] To a stirred solution of (-)-β-pinene (100.0 g, 0.73 mol) in CH2Cl2 (1.0 L), acetonitrile (1.0 L) and water (1.0 L) was added portionwise NaIO4 (626.4 g, 2.94 mol) at 0 °C, and the reaction mixture was stirred at the same temperature for 10 minutes. To the reaction mixture was added portionwise RuCl3-nH2O (4.56 g, 22.0 mmol) at 0 °C, and after stirring at room temperature for 5 hours, diatomaceous earth was added to the reaction mixture and filtered through a diatomaceous earth pad, and washed with CH2Cl2 (500 mL). The filtrate was diluted with H2O (1.0 L) and extracted with CH2Cl2 (2 × 500 mL). After mixing the organic layers, they were washed with brine (500 mL), dried over anhydrous Na2SO4, and concentrated under reduced pressure to obtain compound 2 (100.0 g, crude product) as a brown liquid. 11H NMR (400 MHz, CDCl3) δ 2.58 - 2.51 (m, 3H), 2.38 - 2.30 (m, 1H), 2.25 - 2.21 (m, 1H), 2.08 - 2.01 (m, 1H), 1.98 - 1.90 (m, 1H), 1.57 (s, 1H), 1.35 (s, 3H), 0.84 (s, 3H).
[0680] Preparation of Compound 3
[0681] To a stirred solution of Compound 2 (50.0 g, 0.362 mol) in methanol (500 mL) was added (PhSe)2 (56.5 g, 0.181 mol) and SeO2 (48.2 g, 0.434 mol), and then H2SO4 (13.5 mL, 0.253 mol) was added dropwise at 0 °C. The reaction mixture was stirred at room temperature for 10 h, quenched with ice-cold water (1.0 L), and extracted with EtOAc (1.0 L) through a diatomaceous earth pad. The organic layer was separated, washed with brine (500 mL), dried over anhydrous Na2SO4, and concentrated under reduced pressure. The crude compound was purified by silica gel (60 - 120 mesh) column chromatography using 5 - 10% EtOAc / hexane as the eluent to give Compound 3 (50.0 g, 47%) as a wine-red liquid. 1 1H NMR (400 MHz, CDCl3) δ 7.61 - 7.58 (m, 2H), 7.32 - 7.25 (m, 3H), 3.87 (dd, J = 1.6 Hz, 8.0 Hz, 1H), 2.71 - 2.68 (m, 1H), 2.61 - 2.52 (m, 2H), 2.24 - 2.20 (m, 2H), 1.88 (d, J = 8.00 Hz, 1H), 1.35 (s, 3H), 0.84 (m, 3H).
[0682] Preparation of Compound 4
[0683] To a stirred solution of compound 3 (45.0 g, 0.153 mol) in CH2Cl2 (450 mL) at 0 °C was added dropwise 30% aq. H2O2 (26.0 mL, 0.229 mol), and then pyridine (43.8 mL, 0.544 mol) was added dropwise over 10 minutes. The reaction mixture was stirred at below 5 °C for 3 hours. The reaction mixture was quenched with sodium thiosulfate (250 mL) and extracted with CH2Cl2 (2 × 250 mL). After combining the organic layers, they were washed with 0.5 N hydrochloric acid (2 × 250 mL), water (200 mL), and brine (200 mL), dried over anhydrous Na2SO4, and concentrated under reduced pressure at below 25 °C. The crude compound was purified by silica gel (60 - 120 mesh) column chromatography using 5 - 10% EtOAc / hexane as the eluent to give compound 4 (15.0 g, 72%) as a pale yellow oil. 1 1H NMR (400 MHz, CDCl3) δ 7.54 - 7.50 (m, 1H), 5.95 (d, J = 8.8 Hz, 1H), 2.86 - 2.83 (m, 1H), 2.76 - 2.70 (m, 1H), 2.64 - 2.56 (m, 1H), 2.15 (d, J = 8 Hz, 1H), 1.51 (s, 3H), 1.04 (m, 3H).
[0684] Preparation of compound 5
[0685] To a stirred solution of compound 4 (15.0 g, 110.29 mmol) in 1,4 - dioxane (160 mL) and water (40.0 mL) were added compound 4a (compound 1 of Scheme 4) (25.14 g, 165.43 mmol) and KOH (12.37 g, 220.58 mmol). The reaction mixture was degassed under argon for 15 minutes. [Rh(COD)Cl]2 complex (1.63 g, 3.30 mmol) was added, and then the mixture was degassed under argon for another 5 minutes. The resulting reaction mixture was stirred at 100 °C for 16 hours. The reaction mixture was cooled to room temperature, diluted with CH2Cl2 (500 mL), and filtered through a diatomaceous earth bed. The filtrate was washed with H2O (500 mL). After combining the organic layers, they were dried over anhydrous Na2SO4 and concentrated under reduced pressure. The crude compound was purified by silica gel (60 - 120 mesh) column chromatography using 20 - 40% EtOAc / hexane as the eluent to give compound 5 (20 g, 74%) as a wine - red oil. ESI MS m / z 245 [M + H] + 。
[0686] Preparation of compound 6
[0687] To a stirred solution of compound 5 (20 g, 81.91 mmol) in Ac2O (200 mL) was added Zn(OAc)2 (18 g, 98.29 mmol) and BF3·OEt2 (12.1 mL, 98.29 mmol) below 10 °C, and the mixture was stirred at room temperature for 16 h. The reaction mixture was neutralized with saturated NaHCO3 (500 mL) and extracted with EtOAc (2 × 250 mL). The combined organic layers were washed with brine (250 mL), dried over anhydrous Na2SO4, and concentrated under reduced pressure. The crude compound was purified by silica gel (60 - 120 mesh) column chromatography using 30 - 40% EtOAc / hexane as the eluent to give compound 6 (18.5 g, 68%) as an off-white solid. 1 1H-NMR (400 MHz, CDCl3): δ 7.25 (d, J = 8.40 Hz, 2H), 7.18 (d, J = 8.00 Hz, 2H), 5.47 - 5.46 (m, 1H), 5.06 (s, 2H), 4.68 (s, 1H), 4.61 (s, 1H), 3.03 - 3.00 (m, 1H), 2.75 - 2.69 (m, 1H), 2.43 - 2.29 (m, 4H), 2.09 (s, 6H), 1.50 (s, 3H).
[0688] Preparation of Compound 7
[0689] To a solution of compound 6 (18.5 g, 56.40 mmol) in methanol (185 mL) was added portionwise NaH (2.26 g, 60% in mineral oil, 56.40 mmol) at 0 °C. After the reaction mixture was stirred at room temperature for 1 h, the reaction was quenched with saturated aq. NH4Cl solution (100 mL) at 0 °C, diluted with water (100 mL), and extracted with EtOAc (2 × 250 mL). The combined organic layers were washed with brine (200 mL), dried over anhydrous Na2SO4, and concentrated under reduced pressure. The crude compound was washed with hexane (2 × 50 mL) and dried to give compound 7 (13.5 g, crude product) as an off-white solid. 1 1H-NMR (400 MHz, CDCl3): δ 7.30 (d, J = 8.00 Hz, 2H), 7.16 (d, J = 8.00 Hz, 2H), 4.66 (s, 3H), 4.62 (s, 1H), 3.03 - 2.98 (m, 1H), 2.81 - 2.74 (m, 1H), 2.55 - 2.51 (m, 4H), 2.15 - 2.08 (m, 1H), 1.93 - 1.82 (m, 1H), 1.73 - 1.70 (m, 1H), 1.52 (s, 3H).
[0690] Preparation of Compound 8
[0691] To a cold solution of tosylmethyl isocyanide (6.40 g, 32.78 mmol) in THF (80 mL) was added dropwise a solution of 1 M tert-BuOK in THF (65.56 mL, 65.56 mmol) at 0 °C, and the mixture was stirred at the same temperature for 10 minutes. Compound 7 (4 g, 16.39 mmol) in THF (10 mL) was added to the reaction mixture at 5 °C, and the mixture was stirred for 15 minutes. Methanol (40 mL) was added to the reactant, and the mixture was stirred under reflux for 1 hour. The residual solvent was evaporated under reduced pressure. H2O (100 mL) was added to the resulting residue, and the mixture was extracted with EtOAc (2 × 100 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous Na2SO4, and concentrated under reduced pressure. The crude compound was purified by combiflash chromatography using 30-40% EtOAc / hexane as the eluent to give compound 8 (1.53 g, 36%) as a pale yellow viscous substance. It was used directly in the next reaction without further purification.
[0692] Preparation of Compound 9
[0693] To a stirred solution of compound 8 (2.0 g, 7.83 mmol) in 2-propanol (20 mL) was added KOH (4.4 g, 78.38 mmol) at room temperature. The reaction mixture was stirred under reflux for 48 hours. The residual solvent was evaporated under reduced pressure, and the resulting crude product was dissolved in EtOAc (100 mL) and washed with water (50 mL). The aqueous layer was neutralized with 2 M hydrochloric acid and extracted with EtOAc (2 × 100 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous Na2SO4, and concentrated under reduced pressure to give compound 9 (1.0 g, crude product) as a gray solid. ESI MS m / z 273 [M-H] + 。
[0694] Preparation of Compound 10
[0695] To a stirred solution of Compound 9 (13.0 g, 47.44 mmol) in acetonitrile (150 mL) and methanol (30 mL) was added K2CO3 (19.78 g, 142.32 mmol), and then MeI (8.8 mL, 142.32 mmol) was added dropwise below 5 °C. The reaction mixture was stirred at room temperature for 16 h. The residual solvent was evaporated under reduced pressure, water (100 mL) was added to the residue, and the mixture was extracted with EtOAc (2 × 100 mL). The combined organic layers were washed with water (50 mL) and brine (50 mL), dried over anhydrous Na2SO4, and concentrated under reduced pressure. The crude compound was purified by combiflash chromatography using 10 - 20% EtOAc / hexane as the eluent to give Compound 10 (8.20 g, 60%) as a colorless oil. 1 1H-NMR (400 MHz, CDCl3): δ 7.26 (d, J = 8.0 Hz, 2H), 7.13 (d, J = 8.0 Hz, 2H), 4.64 (d, J = 4.80 Hz, 2H), 4.56 - 4.53 (m, 2H), 3.65 (s, 3H), 2.59 - 2.46 (m, 2H), 2.36 - 2.30 (m, 1H), 2.12 - 2.08 (m, 2H), 1.91 - 1.86 (m, 1H), 1.67 - 1.60 (m, 3H), 1.52 - 1.49 (m, 4H).
[0696] Preparation of Compound 11
[0697] To a stirred solution of Compound 10 (8.20 g, 28.45 mmol) in CH2Cl2 (160 mL) was added imidazole (4.8 g, 71.12 mmol) and TBDMSCl (5.14 g, 34.14 mmol) portionwise at 0 °C. After the reaction mixture was stirred at room temperature for 16 h, the reaction was quenched with saturated aq. NaHCO3 (200 mL), and the mixture was extracted with CH2Cl2 (2 × 100 mL). The combined organic layers were washed with water (50 mL) and brine (50 mL), dried over anhydrous Na2SO4, and concentrated under reduced pressure. The crude compound was purified by combiflash chromatography using 10 - 20% EtOAc / hexane as the eluent to give Compound 11 (10.0 g, 87%) as a colorless oil. 11H-NMR (400 MHz, CDCl3): δ 7.20 (d, J = 8.0 Hz, 2H), 7.09 (d, J = 8.0 Hz, 2H), 4.70 (s, 2H), 4.55 (s, 1H), 4.53 (s, 1H), 3.65 (s, 3H), 2.47 - 2.45 (m, 2H), 2.35 - 2.28 (m, 1H), 2.11 - 2.08 (m, 2H), 1.90 - 1.86 (m, 1H), 1.67 - 1.59 (m, 2H), 1.51 (s, 1H), 1.49 (s, 3H), 0.93 (s, 9H), 0.08 (s, 6H).
[0698] Preparation of Compound 12
[0699] To a stirred solution of Compound 11 (1.20 g, 2.98 mmol) in THF (60 mL) was added dropwise a 2 M solution of lithium diisopropylamide in THF (4.47 mL, 8.94 mmol) at -78 °C. After the reaction mixture was stirred at -78 °C for 30 minutes, it was cooled to -105 °C (using MeOH, liquid N2), and phenyl vinyl sulfoxide (0.6 mL, 4.47 mmol) was added. The reaction mixture was stirred at -105 °C for 30 minutes. The reaction was quenched with a saturated aqueous NH4Cl solution (25 mL), and the mixture was extracted with EtOAc (2 × 50 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous Na2SO4, and concentrated under reduced pressure. The crude compound was purified by combiflash chromatography using 30 - 40% EtOAc / hexane as the eluent to give Compound 12 (0.47 g, 28%) as a pale yellow oil. ESI MS m / z 555 [M + H] + 。
[0700] Preparation of Compound 13
[0701] To a stirred solution of Compound 12 (3.40 g, 6.128 mmol) in xylene (51 mL) was added NaHCO3 (5.1 g, 61.28 mmol) at room temperature, and the reaction mixture was stirred under reflux for 16 hours. The reaction mixture was cooled to room temperature, diluted with H2O (50 mL), and extracted with EtOAc (3 × 50 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous Na2SO4, and concentrated under reduced pressure. The crude compound was purified by combiflash chromatography using 10 - 30% EtOAc / hexane as the eluent to give 13 (2.0 g, 76%) as a colorless viscous substance. 11H-NMR (400 MHz, CDCl3): δ 7.21 (d, J = 8.0 Hz, 2H), 7.11 (d, J = 8.0 Hz, 2H), 5.87 - 5.78 (m, 1H), 5.09 - 5.04 (m, 1H), 4.70 (s, 2H), 4.54 - 4.52 (m, 2H), 3.77 (s, 3H), 2.69 - 2.61 (m, 1H), 2.43 - 2.41 (m, 2H), 2.33 - 2.27 (m, 1H), 1.80 - 1.75 (m, 1H), 1.58 (s, 1H), 1.51 - 1.39 (m, 6H), 0.93 (s, 9H), 0.08 (s, 6H).
[0702] Preparation of Compound 14
[0703] To a stirred solution of Compound 13 (2.0 g, 4.66 mmol) in THF (40.0 mL) was added 1 M TBAF in THF (9.32 mL, 9.32 mmol) at 0 °C. After the reaction mixture was stirred at room temperature for 3 hours, the reaction was quenched with H2O (50 mL) and extracted with EtOAc (2 × 50 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous Na2SO4, and concentrated under reduced pressure. The crude compound was purified by combiflash chromatography using 20 - 40% EtOAc / hexane as the eluent to give Compound 14 (1.20 g, 82%) as a pale yellow viscous substance. ESI MS m / z 332 [M + H2O] + 。
[0704] Preparation of Compound 15
[0705] To a stirred solution of Compound 14 (1.20 g, 3.81 mmol) in CH2Cl2 (25.0 mL) was added Dess - Martin reagent (3.23 g, 7.63 mmol) at 0 °C. The reaction mixture was stirred at room temperature for 2 hours, the reaction was quenched with saturated Na2S2O3 (25.0 mL), and after stirring for 10 minutes, it was extracted with CH2Cl2 (2 × 50 mL). The organic layer was washed with saturated aqueous NaHCO3 (25.0 mL) and brine (50 mL), dried over anhydrous Na2SO4, and concentrated under reduced pressure. The crude compound was purified by combiflash chromatography using 10 - 20% EtOAc / hexane as the eluent to give Compound 15 (1.0 g, 84%) as a pale yellow viscous substance. ESI MS m / z 313 [M + H] + 。
[0706] Preparation of Compound 16
[0707] To a stirred solution of compound 15 (1.0 g, 3.20 mmol) in MeOH (20.0 mL) was added AcOH (0.1 mL, 1.6 mmol), followed by tert-butyl piperazine-1-carboxylate (1.2 g, 6.40 mmol). The reaction mixture was stirred at room temperature for 2 h. NaCNBH3 (0.60 g, 9.6 mmol) was added portionwise to the reaction mixture at 0 °C and the mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with H2O (25 mL) and extracted with CH2Cl2 (2 × 50 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous Na2SO4 and concentrated under reduced pressure. The crude product was purified by combiflash chromatography using 30-40% EtOAc / hexane as eluent to give compound 15 (1.25 g, 81%) as a colorless viscous substance. ESI MS m / z 483 [M+H] + 。
[0708] Preparation of Compound 17
[0709] To a stirred solution of compound 16 (1.0 g, 2.07 mmol) in THF (50 mL) was added dropwise 2 M LiAlH4 in THF (3.1 mL, 6.2 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 30 min, quenched with saturated aqueous NH4Cl solution (25.0 mL) and extracted with EtOAc (2 × 50.0 mL). The combined organic layers were washed with brine (25.0 mL), dried over anhydrous Na2SO4 and concentrated under reduced pressure. The crude compound was purified by combiflash chromatography using 30-50% EtOAc / hexane as eluent to give compound 17 (1.0 g, 88%) as a colorless viscous substance. ESI MS m / z 455 [M+H] + 。
[0710] Preparation of Compound ALB-210796 (B2-24-4·HCOOH) To a stirred solution of compound 17 (1.0 g, 2.21 mmol) in CH2Cl2 (25 mL) was added dropwise 4 M hydrochloric acid in 1,4-dioxane (10 mL) at 0 °C. The reaction mixture was stirred at room temperature for 4 h and the residual solvent was evaporated under reduced pressure. The crude product was washed with hexane (2 × 20 mL) and purified by preparative HPLC using ammonium formate as buffer and eluting with CH3CN in H2O. The purified fraction was concentrated under reduced pressure and lyophilized to give the formate of ALB-210796 (B2-24-4·HCOOH) (420 mg, 47%) as an off-white solid. 11H-NMR (400 MHz, DMSO-d6): δ 8.30 (s, 1H), 7.15 - 7.10 (m, 4H), 5.89 - 5.81 (m, 1H), 4.94 - 4.89 (m, 2H), 4.54 (d, J = 1.60 Hz, 1H), 4.45 - 4.44 (m, 1H), 3.54 (s, 2H), 3.98 (s, 2H), 2.84 - 2.67 (m, 5H), 2.36 - 2.26 (m, 5H), 1.77 - 1.58 (m, 5H), 1.48 (s, 3H), 1.40 - 1.31 (m, 2H).
[0711] Example 16: Confirmation of the Therapeutic Effect of B2-24-4-5A·HCOOH in a Naturally Occurring Systemic Lupus Erythematosus Model Mouse
[0712] Systemic lupus erythematosus model mice (NZBWF1, 20 weeks old, female, n = 55) were divided into a saline administration group (control, n = 25), a B2-24-4-5A·HCOOH administration group (n = 10), a B2-24-4·HCOOH administration group (n = 5), and an HCQ administration group (n = 15). The saline administration group was orally administered saline (100 μl) once a day continuously. The B2-24-4-5A·HCOOH administration group was orally administered 10 mg / kg of B2-24-4-5A·HCOOH (100 μl) once a day continuously. The B2-24-4·HCOOH administration group was orally administered 10 mg / kg of B2-24-4·HCOOH (100 μl) once a day continuously. The HCQ administration group was orally administered 10 mg / kg of HCQ (100 μl) once a day continuously. After 15 weeks of starting the administration, urine was collected from the surviving mice in the saline administration group (control, n = 17), the B2-24-4-5A·HCOOH administration group (n = 10), the B2-24-4·HCOOH administration group (n = 5), and the HCQ administration group (n = 12), and the mice were sacrificed. After sacrifice, blood was collected from the abdominal aorta of the mice, and the kidneys and spleens were excised.
[0713] Mice that died naturally within 15 weeks after the start of administration were counted as death cases, and survival rate analysis was performed using the Kaplan Meier method. Blood collected from the abdominal aorta of each mouse except for the death cases was centrifuged to prepare serum. Oriental Yeast Co., Ltd. was commissioned to quantify the blood urea nitrogen value and creatinine value in the serum. The albumin concentration in urine was quantified by ELISA method (using the kit: Lbis urinary albumin - mouse (S type) (trade name) (manufactured by FUJIFILM Wako Shibayagi Corporation)). The excised kidneys were fixed with 4% (w / v) paraformaldehyde, and Morphotechnology Co., Ltd. was commissioned for immunohistochemical staining. In the renal tissue sections stained with PAS, the histological observation results of 100 glomeruli were evaluated. Among them, for the increase in cells and matrix in the mesangial region, endothelial cell swelling and cell infiltration (intratubular hyperplasia) in the capillary lumen, and glomeruli with inflammatory crescents (extratubular hyperplasia), 100 glomeruli were classified into grades 0 to 2 according to the severity and scored out of 6 points. The results are shown in Figures 10A to 10H and Table 8.
[0714] Figure 10A shows the survival rate curve during the administration period. Figure 10B shows the serum blood urea nitrogen value. Figure 10C shows the serum creatinine value. Figure 10D shows the urinary albumin amount. Figure 10E is a photograph showing IgG deposition in the glomeruli of mice in the saline administration group (#1), B2-24-4-5A·HCOOH administration group (#10), B2-24-4·HCOOH administration group (#4), and HCQ administration group (#14). Figure 10F is a photograph showing C3 deposition in the glomeruli of mice in the saline administration group (#1), B2-24-4-5A·HCOOH administration group (#10), B2-24-4·HCOOH administration group (#4), and HCQ administration group (#14). Figure 10G shows a stained photograph of a renal tissue section of a mouse in the saline administration group (#1). In the renal tissue section of the mouse in the saline administration group (#1), manifestations of active glomerulonephritis such as diffuse mesangial hyperplasia and intratubular hyperplasia were observed. Figure 10H shows a stained photograph of a renal tissue section of a mouse in the B2-24-4-5A·HCOOH administration group (#1). In the renal tissue section of the mouse in the B2-24-4-5A·HCOOH administration group (#1), only local increase in mesangial cells and matrix was observed. Figure 10B 、 10CThe scatter plot of 0 and 10D represents the data of each individual, each thick line represents the average value of each group of data, and each error bar represents the standard error of each group of data. Figure 10E and Figure 10F The scale bar represents 100 μm.
[0715] As Figures 10A to 10H can be seen, compared with the control saline administration group or HCQ administration group, the survival rate was prolonged, the increase in serum urea nitrogen value was inhibited, the increase in serum creatinine value was inhibited, the increase in urinary albumin value was inhibited, the deposition of IgG in glomeruli was inhibited, the deposition of C3 in glomeruli was inhibited, and the activity of lupus nephritis was significantly reduced in the B2-24-4-5A·HCOOH administration group or B2-24-4·HCOOH administration group.
[0716]
Table 8
[0717]
[0718]
[0719]
[0720] Mes: Increase in cells and matrix in the mesangial area
[0721] Intratubular: Swelling of endothelial cells and cell infiltration in the lumen of capillaries
[0722] Extratubular: Glomeruli with crescents
[0723] Grade 0: None
[0724] Grade 1: Below moderate
[0725] Grade 2: Above moderate
[0726] Saline: Normal saline
[0727] In the control saline administration group, there were individual differences in the activity of nephritis, while in most of the B2-24-4-5A·HCOOH administration groups, not only glomerulonephritis was improved, but also tubulointerstitial nephritis was improved.
[0728] Example 17: Analysis of spleen tissue in NZBWF1 mice administered with B2-24-4-5A·HCOOH
[0729] Analyze the spleen weight and the number of splenocytes obtained in Example 16. The spleen weight is shown in Figure 11A , and the number of splenocytes is shown in Figure 11B .
[0730] The spleen weight of the B2-24-4-5A·HCOOH administration group was significantly lower compared to that of the saline administration group and the HCQ administration group. The number of splenocytes in the B2-24-4-5A·HCOOH administration group was significantly reduced compared to that of the saline administration group and the HCQ administration group. From Figure 11A and 11B it can be seen that spleen enlargement in the B2-24-4-5A·HCOOH administration group was inhibited compared to the control saline administration group and the HCQ administration group.
[0731] Example 18: Analysis of the spleen of NZBWF1 mice administered with B2-24-4-5A·HCOOH
[0732] The spleen obtained in Example 16 was ground with a glass slide to prepare splenocytes, which were stained with labeled antibodies. The labeled antibodies used were FITC-labeled anti-CD11b antibody, FITC-labeled anti-CD3 antibody, FITC-labeled anti-CD62L antibody, FITC-labeled anti-B220 antibody, FITC-labeled anti-CD71 antibody, PE-labeled anti-CD11c antibody, PE-labeled anti-Gr-1 antibody, PE-labeled anti-CD8 antibody, PE-labeled anti-CD44 antibody, PE-labeled anti-CD69 antibody, PE-labeled anti-CD21 antibody, PE-labeled anti-CD86 antibody, PE-labeled anti-Ter-119 antibody, PE-Cy7-labeled anti-CD23 antibody, APC-labeled anti-F4 / 80 antibody, APC-labeled anti-Ly-6G antibody, APC-labeled anti-CD4 antibody, APC-labeled anti-B220 antibody, APC-labeled anti-CD19 antibody, APC-labeled anti-CD11c antibody, or APC-labeled anti-PDCA-1 antibody. After 20 minutes, the cells were washed with FACS buffer, and each cell was resuspended in 200 μL of FACS buffer containing 25 μg / mL of 7-actinomycin D. The fluorescence intensity of the cells was analyzed using a flow cytometer. The flow cytometer was measured using FACSCanto TM II (manufactured by Becton Dickinson), and the data was analyzed using FlowJo software (manufactured by Tree Star) to calculate the proportions of various cells in the spleen. The results are shown in Figure 12 (A)-(E), Figure 13 (A)-(E) and Figure 14 (A)-(E).
[0733] In the B2-24-4-5A·HCOOH administration group as compared with the saline administration group and the HCQ administration group, an increase was observed in the proportions of plasmacytoid dendritic cells, helper T cells, cytotoxic T cells, and naive T cells, and a decrease was observed in the proportions of neutrophils, erythroblasts, activated T cells, memory T cells, and CD69-positive activated B cells. Therefore, through the administration of B2-24-4-5A·HCOOH, the inflammatory symptoms accompanying the onset of systemic lupus erythematosus were improved.
[0734] Example 19: Analysis of IFN-α production induced by microRNA stimulation
[0735] The inhibitory effect of B2-24-4-5A·HCOOH on TLR7-stimulatory microRNA in mouse Flt-3 ligand-induced dendritic cells (FLDC) was investigated. Mouse bone marrow cells were cultured in RPMI1640 medium containing 100 ng / ml Flt-3 ligand, 10% (v / v) fetal bovine serum (FCS), penicillin, streptomycin, L-glutamic acid, and 2-mercaptoethanol at 37°C in the presence of 5% (v / v) CO2 for 8 days. The mouse FLDC induced and differentiated by the culture were inoculated in such a manner as to become 1.0×10 5 cells / 100 μL. Thereafter, 0.1, 0.3, or 1 μM of B2-24-4-5A·HCOOH was added. 30 minutes after the addition of B2-24-4-5A·HCOOH, a microRNA-cationic liposome carrier (DOTAP) complex containing a vector or containing 0.5 or 2 μg / ml of microRNA was added. The sequences of the microRNAs used are shown in Table 9.
[0736] [Table 9]
[0737] Name Sequence (5'-3') Sequence No. miR21 UAGCUUAUCAGACUGAUGUUGA Sequence No.: 1 miR574 UGAGUGUGUGUGUGUGAGUGUGU Sequence No.: 2 let-7b UGAGGUAGUAGGUUGUGUGGUU Sequence No.: 3 RNA40 GCCCGUCUGUUGUGUGACUC Sequence No.: 4
[0738] 24 hours after the addition of the microRNA-DOTAP complex, the concentration of IFN-α contained in the culture medium was quantified by ELISA (using a kit: Mouse IFNalpha Platinum ELISA (trade name), manufactured by eBioscience). The results are shown in Figure 15 . As Figure 15 shown, B2-24-4-5A·HCOOH inhibited the production of IFN-α induced by microRNA stimulation in a concentration-dependent manner. Sequence Listing <110> The University of Toyama, a National University Corporation Tokuiwa Pharmaceutical Co., Ltd. National Institute of Advanced Industrial Science and Technology <120> Novel compound used as an activator inhibitor of Toll-like receptor 7 <130> FP223583JP <150> JP2020-099708 <151> 2020-06-08 <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 22 <212> RNA <213> artificial <220> <223> microRNA <400> 1 uagcuuauca gacugauguu ga 22 <210> 2 <211> 23 <212> RNA <213> artificial <220> <223> microRNA <400> 2 ugagugugug ugugugagug ugu 23 <210> 3 <211> 22 <212> RNA <213> artificial <220> <223> microRNA <400> 3 ugagguagua gguugugugg uu 22 <210> 4 <211> 20 <212> RNA <213> artificial <220> <223> microRNA <400> 4 gcccgucugu ugugugacuc 20
Claims
1. A compound represented by the following formula (I) or (II) or a pharmaceutically acceptable salt thereof, [Chemical Formula 1] (I) [Chemical Formula 2] (II) In formula (I) and (II), R1 is the following group: a group represented by the following formula: [Chemical Formula 11] ; a group represented by the following formula, [Chemical Formula 12] ; a group represented by the following formula, [Chemical Formula 3] ; In this formula, R2 and R3 are each independently an alkyl group having 1 to 3 carbon atoms; a group represented by the following formula, [Chemical Formula 4] ; In this formula, ring C is a 3- to 7-membered nitrogen-containing heterocycle, and R4 is a group represented by -NH-, -O- or -CF2-; or a group represented by the following formula, [Chemical Formula 7] 。 2. The compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein, R1 is the following group: [Chemical Formula 5] ; [Chemical Formula 6] ; [Chemical Formula 8] ; [Chemical Formula 9] ; or [Chemical Formula 10] 。 3. The compound or a pharmaceutically acceptable salt thereof according to claim 1, wherein the compound is represented by any one of the following formulas (III) to (XIII), [Chemical Formula 13] (III) [Chemical Formula 14] (IV) [Chemical Formula 15] (V) [Chemical Formula 16] (VI) [Chemical Formula 17] (VII) [Chemical Formula 18] (XIII) [Chemical Formula 19] (IX) [Chemical Formula 20] (X) [Chemical Formula 21] (XI) [Chemical Formula 22] (XII) [Chemical Formula 23] (XIII).
4. The compound or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 3, wherein the pharmaceutically acceptable salt is a hydrochloride or a formate.
5. An inhibitor of Toll-like receptor 7 (TLR7) activation, which contains the compound or a pharmaceutically acceptable salt thereof according to claim 1.
6. The TLR7 activation inhibitor according to claim 5, which has an effect of inhibiting the production of NF-κB, IL-6, TNF-α or IFN-α caused by TLR7 activation.
7. A prophylactic or therapeutic agent for a disease accompanied by TLR7 activation, which contains the TLR7 activation inhibitor according to claim 5.
8. The prophylactic or therapeutic agent according to claim 7, wherein the disease accompanied by TLR7 activation is an autoimmune disease, an autoinflammatory syndrome, autoimmune pancreatitis, arteriosclerosis, sepsis, a neurodegenerative disease, graft-versus-host disease, periodontal disease, viral immunodeficiency, IgA nephropathy, primary nephrotic syndrome, Langerhans cell histiocytosis, hemophagocytic lymphohistiocytosis, Rosai-Dorfman disease, obesity, type 2 diabetes or ulcerative colitis.
9. The prophylactic or therapeutic agent according to claim 8, wherein the disease accompanied by TLR7 activation is an autoimmune disease.
10. The prophylactic or therapeutic agent according to claim 9, wherein The autoimmune diseases are systemic lupus erythematosus, Sjogren's syndrome, scleroderma, polymyositis / dermatomyositis, mixed connective tissue disease, overlap syndrome, antiphospholipid antibody syndrome, Behcet's disease, adult Still's disease, rheumatic fever, rheumatoid arthritis, HLA-B27 related rheumatic diseases, IgG4 related syndrome, ANCA related vasculitis, vasculitis syndrome, multiple sclerosis, psoriasis vulgaris, inflammatory bowel disease, autoimmune thyroid disease, autoimmune hemolytic anemia, idiopathic thrombocytopenic purpura, primary biliary cirrhosis, primary biliary cholangitis, myasthenia gravis, Goodpasture's syndrome, Guillain-Barre syndrome, chronic atrophic gastritis, rapidly progressive glomerulonephritis, anti-glomerular basement membrane nephritis, Addison's disease, type I diabetes, vitiligo vulgaris, pemphigus vulgaris, pemphigoid, autoimmune neutropenia, autoimmune hepatitis, autoimmune pancreatitis, graft rejection, primary membranoproliferative glomerulonephritis, purpuric nephritis.
11. The prophylactic or therapeutic agent according to claim 10, wherein, The autoimmune disease is the systemic lupus erythematosus.
Citation Information
Patent Citations
Re-usable card value altering apparatus
JP1988000792A
Components for medical circuits
JP2020099708A
Activation inhibitor for toll-like receptor 7 or toll-like receptor 9
WO2017047769A1