An industrial hemp endophytic fungus producing flavonoid compounds and its application

Abstract

An industrial hemp endophytic fungus producing flavonoid compounds and its application relate to the field of microorganisms, and specifically to an industrial hemp endophytic fungus and its application. The purpose is to solve the problem that the existing method for obtaining flavonoid compounds wastes industrial hemp resources and the reaction conditions affect the environment. The industrial hemp endophytic fungus is Daldinia loculata HMX03, which has been deposited in the China Center for Type Culture Collection on May 26, 2022, and the deposit number is CCTCC NO: M2022722. The industrial hemp endophytic fungus of the present invention has good antibacterial activity and can ferment to produce flavonoid compounds. The microorganisms of the present invention are used for antibacterial and flavonoid production.

Description

Technical Field

[0001] The invention relates to the field of microorganisms, and in particular to an endophytic fungus of industrial hemp and applications thereof. Background Art

[0002] Flavonoids are an important class of plant secondary metabolites, which are widely present in plants in the form of glycosides and aglycones. Flavonoids have multiple pharmacological activities such as antioxidant, anti-inflammatory, analgesic, anti-tumor, hepatoprotective and antiviral, and have certain therapeutic effects on some common chronic diseases in humans, such as cancer, diabetes, Alzheimer's disease, cardiovascular and cerebrovascular diseases, etc., and have broad application prospects in medicine and functional foods.

[0003] Extracting flavonoids from plant raw materials is currently the main production method of flavonoids, but the operating process of this method is complicated and the products are often mixed systems. The purification process not only increases production costs and wastes industrial hemp resources, but also causes product loss and reduced activity.

[0004] In addition, flavonoids can also be synthesized chemically. Chemical synthesis can achieve the total synthesis of some flavonoids, but the reaction conditions have a great impact on the environment, such as high temperature, strong acid, strong base and other conditions, which hinder the large-scale and commercial application of chemical synthesis methods. In addition, the reaction conditions sometimes cause flavonoids to degrade or produce a mixture of two stereoisomers. Summary of the invention

[0005] The present invention aims to solve the problem that the existing method for obtaining flavonoid compounds wastes industrial hemp resources and the reaction conditions affect the environment, and provides an industrial hemp endophytic fungus producing flavonoid compounds and the application thereof.

[0006] The present invention provides an industrial hemp endophytic fungus producing flavonoid compounds, which is Daldinia loculata HMX03, which has been deposited in the China Center for Type Culture Collection, the deposit address is Wuhan University, Wuhan, the deposit date is May 26, 2022, and the deposit number is CCTCC NO: M2022722.

[0007] The colony of the industrial hemp endophytic fungus HMX03 of the present invention is white at the initial stage, gradually changes to black, and the hyphae are loose; the matrix is ​​white.

[0008] The ITS rDNA sequencing results of the industrial hemp endophytic fungus HMX03 of the present invention were submitted to the NCBI database, and BLAST analysis and comparison were performed. The phylogenetic tree of the industrial hemp endophytic fungus HMX03 was constructed using MEGA 7 software. The similarity between the industrial hemp endophytic fungus HMX03 and Daldinia loculata (KU683789.1) reached 100%. Based on the results of colony and spore morphology observations, the industrial hemp endophytic fungus HMX03 was identified as Daldinialoculata.

[0009] The present invention also provides the use of industrial hemp endophytic fungus HMX03 in the preparation of antibacterial drugs.

[0010] Furthermore, the bacteria are bacteria and fungi.

[0011] Furthermore, the bacteria are Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae and Acinetobacter baumannii, and the fungus is Candida albicans.

[0012] The present invention also provides application of industrial hemp endophytic fungus HMX03 in fermentation to produce flavonoid compounds.

[0013] Furthermore, the flavonoids are quercetin and luteolin.

[0014] Beneficial effects of the present invention:

[0015] The present invention separates and purifies an endophytic fungus HMX03 from industrial hemp, which is identified as Daldinia loculata. The strain has good antibacterial activity, and has a good inhibitory effect on Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae, Acinetobacter baumannii and Candida albicans.

[0016] The industrial hemp endophytic fungus HMX03 in the present invention contains two flavonoid compounds in its secondary metabolites, namely quercetin and luteolin. The industrial hemp endophytic fungus fermentation method is used to produce flavonoid compounds, which can save plant resources and also provide a new method for the production of flavonoid compounds. The fermentation method has mild reaction conditions and is conducive to large-scale production. Therefore, the industrial hemp endophytic fungus HMX03 has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the colony morphology of the endophytic fungus HMX03 of industrial hemp;

[0018] Figure 2 This is the microscopic morphology of the hyphae of the industrial hemp endophytic fungus HMX03;

[0019] Figure 3 The results of ITS rDNA PCR for the endophytic fungus HMX03 from industrial hemp;

[0020] Figure 4 This is the phylogenetic tree of the industrial hemp endophytic fungus HMX03;

[0021] Figure 5 These are the results of HPLC analysis of the fermentation broth of the industrial hemp endophytic fungus HMX03. DETAILED DESCRIPTION

[0022] The embodiments of the present invention are described in detail below. The following embodiments are implemented on the premise of the technical solution of the present invention, and detailed implementation schemes and specific operation processes are given, but the protection scope of the present invention is not limited to the following embodiments.

[0023] Embodiment 1:

[0024] The industrial hemp endophytic fungus producing flavonoid compounds in this embodiment is Daldinialoculata HMX03, which has been deposited in the China Center for Type Culture Collection, the deposit address is Wuhan University, Wuhan, the deposit date is May 26, 2022, and the deposit number is CCTCC NO: M2022722.

[0025] The method for obtaining the industrial hemp endophytic fungus HMX03 in this embodiment is:

[0026] Take industrial hemp (Cannabis sativa L.) leaves (Longma No. 5, collected from the Science and Technology Innovation Farm of Suihua Branch of Heilongjiang Academy of Agricultural Sciences), disinfect the surface, and the disinfection procedure is: 75% alcohol 30s-sterile water washing-NaClO 5min-sterile water washing-75% alcohol 30s-sterile water washing, cut the disinfected experimental materials with a sterile scalpel, cut them into small square pieces with a side length of 5mm, place them in PDA culture medium, and culture them at a constant temperature of 28℃ for 5-7d; remove the last water washing liquid of the disinfection procedure, and spread it inoculated in PDA culture medium. And place the experimental materials that are not cut into pieces after disinfection on PDA culture medium, roll them once, take them out, and co-culture them with endophytic fungus isolation culture medium as a control. Finally, the endophytic fungus HMX03 was isolated from the industrial hemp leaves. No bacteria grew in the negative control, and this was repeated many times, thus proving that the isolated strain is an endophytic fungus of industrial hemp.

[0027] Preparation of potato solid culture medium (PDA): Weigh 100 g of freshly peeled potato pieces and place them in boiling water, keep boiling for 30 minutes, filter, add 20 g of glucose and 16 g of agar powder in the formula to the filtrate, wait for them to dissolve completely, add water to make up the total volume of the culture medium to 1 L, set the pH to natural, package, sterilize (121°C, 0.1 MPa, 30 min), and cool for later use.

[0028] Example 2: Identification of industrial hemp endophytic fungus HMX03

[0029] The strains were identified by colony and spore morphology observation and ITS rDNA sequence analysis.

[0030] Colony morphology of industrial hemp endophytic fungus HMX03 Figure 1 As shown in Figure 2, the microscopic morphology of hyphae is as follows: Figure 2 As shown in the figure, the colony of industrial hemp endophytic fungus HMX03 was white at the beginning, gradually changed to black, and the hyphae were loose; the matrix was white.

[0031] The genomic DNA of industrial hemp endophyte HMX03 was extracted and PCR amplified to obtain an ITS rDNA sequence of 514 bp in length. Figure 3 As shown in the figure, 1 represents Marker, and 2 represents strain HMX03. Shanghai Shenggong Biotechnology Co., Ltd. was commissioned to sequence the ITS rDNA of strain HMX03, and the ITS rDNA sequence is shown in SEQ ID NO: 1 in the sequence table.

[0032] The ITS rDNA sequence of the industrial hemp endophytic fungus HMX03 of the present invention is:

[0033] CCTACCTAATCCGAGGTCAACCACTAGAAATATAGGGGTTTAACGGCAAGCCGCCAGGACAACTACAGAAGCGAGAAGAATATTACTACGCTTAGAGTATGCCCTAACTCCGCCGATCACTTTAAGGA ACTGCCCTATAAATACAGGGCAGATTCCCAACACTAAGCAACTAGGCTTAAGGGTTGAAATGACGCTCGAATAGGCATGCCCACTAGAATACTAATGGGCGCAATGTGCGTTCAAAGATTCGATGATTC ACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTTATTAAGTTGAAGCATTCAGAGATACAGTAGTAAAATA GAATTTAGTGGTCCACCGGCGGGCTTGGAGCGCACCTACCGGGTAGCTACAGGGTAGCTACAGGGTAAGTACAGCCCGCCGAGGCAACGACGGTAAGGTTCACAAAGGGGTTGGGAGTTTAGATTAACT.

[0034] The sequencing results were submitted to the NCBI database, analyzed and aligned using BLAST, and after alignment, the phylogenetic tree of industrial hemp endophytic fungus HMX03 was constructed using MEGA7 software, as shown in Figure 4 As shown. Figure 4 It can be seen that the similarity between industrial hemp endophytic fungus HMX03 and Daldinia loculata (KU683789.1) reached 100%. Based on the results of colony and spore morphology observation, the industrial hemp endophytic fungus HMX03 was identified as Daldinia loculata.

[0035] Example 3: Analysis of antibacterial activity of industrial hemp endophytic fungus HMX03:

[0036] 1. Activation of industrial hemp endophytic fungi HMX03:

[0037] Take the industrial hemp endophytic fungus HMX03, inoculate it on the test surface containing PDA culture medium under sterile conditions, and culture it at a constant temperature of 28℃ for 3 days for later use.

[0038] 2. Preparation of industrial hemp endophytic fungus HMX03 fermentation liquid:

[0039] Take the activated industrial hemp endophytic fungus HMX03, pick the mycelium under sterile conditions and inoculate it into 50mL PDB medium, and culture it in a shaking incubator at 28℃ and 120r / min for 3 days to make 1×10 7 CFU / mL of seed liquid; the seed liquid was transferred to 3L of sterilized PDB medium at a 20% (v / v) inoculation amount, cultured in a shaking incubator at 28°C and 120r / min for 14d, and the fermentation liquid was filtered.

[0040] 3. Preparation of test solution:

[0041] Take the fermentation liquid of industrial hemp endophytic fungus HMX03 and concentrate it to 50mL under reduced pressure at 50℃, add 50mL of methanol, and extract it by ultrasonic for 3 times to obtain the extract, which is concentrated to dryness under reduced pressure, and dissolved with 10mL of methanol, and then used as the test solution for later use. Take appropriate amounts of streptomycin and nystatin reference substances, add appropriate amounts of methanol to dissolve them, and prepare 200μg / mL positive control solution for later use.

[0042] 4. Preparation of plates containing test strains

[0043] Take the activated test bacteria: Staphylococcus aureus, Bacillus pumilus, Bacillus subtilis, Listeria monocytogenes, Enterococcus facalis, Enterococcus faecium, Escherichia coli, Klebsiella pneumoniae, Acinetobacter baummanii, Pseudomonas aeruginosa, inoculate them in NA slant medium, culture at 37℃ for 1 day; take the activated test fungus Candida albicans, inoculate it in PDA slant medium, culture at 28℃ for 3 days, and set aside. The above test strains were purchased from Heilongjiang Institute of Microbiology.

[0044] Take the activated test strains mentioned above, add appropriate amount of sterile water, shake and dilute each strain to 1×10 7 Pour the bacterial suspension of 0.1 CFU / mL into the corresponding culture medium and dispense it into sterile plates with Oxford cups. After it solidifies, take out the Oxford cups and set aside.

[0045] 5. Antibacterial activity analysis:

[0046] Accurately add 150 μL of the test solution, positive control solution, and negative control solution to the two wells of the prepared bacteria-containing plate. The plate containing bacteria was incubated at 37°C for 1 day, and then the diameter of the inhibition zone was measured (n=3); the plate containing fungi was incubated at 28°C for 3 days, and then the diameter of the inhibition zone was measured (n=3).

[0047] Experimental results:

[0048] The results of the antibacterial activity of the endophytic fungus HMX03 from industrial hemp are shown in Table 1.

[0049] Table 1 Antibacterial activity results of industrial hemp endophytic fungus HMX03 fermentation broth

[0050]

[0051] Note: A: Escherichia coli; B: Bacillus subtilis; C: Staphylococcus aureus; D: Bacillus pumilus; E: Pseudomonas aeruginosa; F: Listeria monocytogenes; G: Klebsiella pneumoniae; H: Acinetobacter baumannii; I: Enterococcus faecium; J: Enterococcus faecalis; K: Candida albicans; Str: Streptomycin; Nys: Nystatin.

[0052] From the results in Table 1, it can be seen that the endophytic fungus HMX03 of industrial hemp has a good inhibitory effect on Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae, Acinetobacter baumannii, and Candida albicans, indicating that the endophytic fungus HMX03 of industrial hemp has good antibacterial activity.

[0053] Example 4: HPLC analysis of industrial hemp endophytic fungus HMX03 fermentation broth:

[0054] 1. Preparation of test solution

[0055] Take the activated industrial hemp endophytic fungus HMX03, pick the mycelium under sterile conditions and inoculate it into 50mL PDB medium, and culture it in a shaking incubator at 28℃ and 120r / min for 3 days to make 1×10 7 CFU / mL of seed liquid; the seed liquid was transferred to 3L of sterilized PDB medium at a 20% (v / v) inoculation amount, cultured in a shaking incubator at 28°C and 120r / min for 14d, and the fermentation liquid was filtered.

[0056] The fermentation broth was concentrated under reduced pressure at 50°C, and the concentrated fermentation broth was extracted with ethyl acetate for 3 times (3×100 mL). The extracts were combined, concentrated to dryness at 50°C, and dissolved in 1 mL of methanol as the test solution for later use.

[0057] 2. Preparation of reference medicinal material solution

[0058] Weigh 5g of industrial hemp leaves accurately, crush them, add 95% ethanol at a solid-liquid ratio of 1:50, extract them 3 times (3×250mL) at 50℃ ultrasonically, filter, combine the extracts, concentrate to 100mL at 50℃, and extract with ethyl acetate 3 times (3×100mL) to obtain the extract. Combine the ethyl acetate extracts, concentrate to dryness under reduced pressure, dissolve in 1mL of chromatographic methanol, and set aside.

[0059] 3. Preparation of reference solution

[0060] Accurately weigh 0.5 mg of quercetin and luteolin reference substances, respectively, place them in 1 mL centrifuge tubes, add 1 mL of chromatographic methanol to dissolve, and prepare reference substance solutions for later use.

[0061] Take 300 mL of PDB culture medium and concentrate it under reduced pressure at 50°C. Extract the concentrated PDB culture medium with ethyl acetate three times (3×100 mL). Combine the extracts, concentrate to dryness at 50°C, dissolve them in 1 mL of methanol and use them as blank control solution for later use.

[0062] 4. HPLC conditions

[0063] Chromatographic column: Venusil XBP-C 18 Column (4.6 mm × 250 mm, 5 μm, USA) Mobile phase: methanol-0.1% formic acid (65:35) Flow rate: 1 mL·min -1 ; Column temperature: 25℃; Detection wavelength: 220nm; Injection volume: 10μL.

[0064] Experimental results:

[0065] The fermentation broth of endophytic fungus HMX03 was analyzed by HPLC, with quercetin and luteolin as reference substances. The HPLC results are as follows Figure 5 . Figure 5 A represents HMX03 fermentation broth, B represents quercetin reference substance, C represents luteolin reference substance, D represents reference medicinal material (leaves), and E represents PDB sample.

[0066] Depend on Figure 5 It can be seen that the endophytic fungus HMX03 fermentation broth test sample, reference medicinal material solution and quercetin and luteolin reference substances have the same chromatographic peak at the same retention time, and the blank control (PDB) has no interference. The standard addition method was used to add quercetin and luteolin reference substances to the endophytic fungus HMX03 test solution. After HPLC analysis, the result was still a single chromatographic peak at the same retention time position as the reference substances quercetin and luteolin. Therefore, it was preliminarily determined that quercetin and luteolin were contained in the endophytic fungus HMX03 fermentation broth. It was inferred that the endophytic fungus HMX03 was a fungus that produced flavonoid compounds quercetin and luteolin.

[0067] The endophytic fungus HMX03 of industrial hemp not only has good antibacterial activity, but also is a flavonoid producer. The above research has laid the foundation for the production of flavonoids by fermentation of endophytic fungus HMX03 of industrial hemp. The endophytic fungus HMX03 of industrial hemp is an endophytic fungus worthy of in-depth study.

Claims

1. An endophytic fungus of industrial hemp producing flavonoid compounds, characterized in that The endophytic fungus of industrial hemp is a carbon shell with a layer of interstices ( Daldinia loculata )HMX03, has been deposited in the China Center for Type Culture Collection, the deposit address is Wuhan University, Wuhan, the deposit date is May 26, 2022, and the deposit number is CCTCC NO: M2022722.

2. The use of endophytic fungi of industrial hemp in the preparation of antibacterial drugs according to claim 1; the antibacterial agent is the inhibition of bacteria and fungi, the bacteria are Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae and Acinetobacter baumannii, and the fungus is Candida albicans.

3. The use of endophytic fungi of industrial hemp in fermentation to produce flavonoids as claimed in claim 1; the flavonoids are quercetin and luteolin.

Images