A monoclonal antibody hybridoma cell line 2A5 against PCV2b type Cap protein, monoclonal antibody and application
By constructing monoclonal antibody hybridoma cell line 2A5 against PCV2b type Cap protein, the problem of monoclonal antibodies lacking specificity and uniformity in the prior art was solved, and efficient quantitative determination of PCV2b and PCV1-2b viruses was achieved, supporting vaccine research and immune efficacy evaluation.
Patent Information
- Application Number
- CN202210953392.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-10
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2042-08-10
AI Technical Summary
There is a lack of monoclonal antibodies that can be specific, uniform and sensitive in the prior art for determining PCV2 or chimeric porcine cyclovirus TCID50, which leads to difficulties in vaccine development and evaluation of immune efficacy.
A monoclonal antibody hybridoma cell line 2A5 targeting the PCV2b type Cap protein was constructed. It was highly reactive with the PCV2b and PCV1-2b strains through direct or indirect immunofluorescence assays. A direct immunofluorescence method for FITC direct labeling antibodies was established for quantitative determination of viruses.
It provides sensitive, specific and uniform detection preparations that can accurately determine half of the infection amount of PCV2b and PCV1-2b viruses, supporting vaccine research and immune efficacy evaluation.
Smart Images

Figure CN115725510B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of monoclonal antibody, and particularly relates to a monoclonal antibody hybridoma cell line 2A5 against PCV2b type Cap protein, a monoclonal antibody and applications thereof. Background Art
[0002] Porcine circovirus-associated disease (PCVAD) is currently prevalent in many countries and regions around the world and has become a disease seriously endangering the global pig industry, causing serious economic losses to the pig industry. Porcine circovirus-associated disease is caused by the infection of porcine circovirus (PCV), mainly including postweaning multisystemic wasting syndrome (PMWS), porcine dermatitis and nephropathy syndrome (PDNS), porcine respiratory disease complex (PRDC), etc. In 2001, PCV2 was first discovered and isolated from pig herds in China.
[0003] Porcine circovirus is the smallest virus discovered so far, belonging to the family Circoviridae and the genus Circovirus. According to the genomic composition and antigenicity of PCV, it can be divided into four genotypes: PCV1, PCV2, PCV3 and PCV4, and the genomic size is between 1700 and 2000 bp. The genome of PCV contains 11 open reading frames (ORFs). ORF1 located on the positive strand of DNA encodes the Rep protein related to virus replication and is the largest open reading frame; while ORF2 located on the complementary strand encodes the major structural protein Cap protein of the virus. The amino terminus of this protein is an arginine-rich region with highly conserved sequences, which is speculated to be related to virus DNA binding and is also the main antigenic epitope aggregation region of the virus.
[0004] As the major structural protein of PCV, the Cap protein is the focus of research by scholars at home and abroad. Several institutions have developed monoclonal antibodies against PCV2 Cap protein and applied them to clinical diagnosis, but there is no report on the application of monoclonal antibodies to determine the TCID 50 of PCV2 or chimeric porcine circovirus (PCV1-2) strains. The development of monoclonal antibodies that can determine the TCID 50Monoclonal antibodies are very important because in the research and production of inactivated vaccines against the whole virus of porcine circovirus, (1) the quantification of the virus content in the vaccine is inseparable from the determination of TCID50; (2) when conducting an immunization challenge test to evaluate the immunogenicity of the vaccine, it is necessary to quantify the PCV2 strain used for challenge; (3) in the research and production of chimeric live and inactivated vaccines against porcine circovirus, it is also necessary to quantify the chimeric porcine circovirus (such as strain C1-233). All these quantification processes are inseparable from specific antibodies against PCV2 or chimeric porcine circovirus (PCV1-2). Existing antibodies mostly use polyclonal antibodies against PCV2 in pigs, and the latter has at least two inherent defects. One is that polyclonal antibodies are derived from immunized or infected pigs, and it is impossible to guarantee the antibody level and antibody homogeneity among different pig individuals. The other is that the antibodies are derived from immunized or infected pigs, and their sources are limited. Summary of the Invention
[0005] In view of this, the purpose of the present invention is to provide a monoclonal antibody hybridoma cell line 2A5 against the Cap protein of PCV2b type, a monoclonal antibody and its application. The produced monoclonal antibody has strong reactivity with PCV2b and PCV1-2b strains through direct or indirect immunofluorescence tests, and can be used for the TCID 50 quantitative determination, providing a sensitive, specific and homogeneous detection reagent for the research of PCV2 inactivated vaccines, chimeric porcine circovirus inactivated vaccines and live vaccines.
[0006] In order to achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:
[0007] The present invention provides a monoclonal antibody hybridoma cell line 2A5 against the Cap protein of porcine circovirus type 2b. The monoclonal antibody hybridoma cell line 2A5 has been preserved, and the preservation number is CGMCC N O .45231.
[0008] Preferably, the antigenic epitope targeted by the monoclonal antibody hybridoma cell line 2A5 is the amino acids at positions 225-229 of the Cap protein of porcine circovirus type 2b.
[0009] The present invention also provides a method for constructing the above-mentioned monoclonal antibody hybridoma cell line 2A5, including the following steps: cloning the orf2 fragment with the nuclear localization signal peptide of PCV2d 0728 strain removed into a prokaryotic expression vector to construct a prokaryotic expression plasmid;
[0010] The prokaryotic expression plasmid was transformed into Escherichia coli for induced expression to obtain a recombinantly expressed protein in soluble form; after purification, mice were immunized three times, and the enzyme-linked immunosorbent assay antibody titer against the PCV2 Cap protein in the sera of the immunized mice was measured. After booster immunization, splenocytes from the mice were fused with myeloma cells SP2 / 0 to prepare hybridoma cells. After screening for positive cells, subcloning was performed to obtain the monoclonal antibody hybridoma cell line 2A5.
[0011] Preferably, the 124 - 702 bp of the sequence shown in SEQ ID NO.1 was cloned onto the prokaryotic expression vector pET-28a.
[0012] The present invention also provides a Cap monoclonal antibody produced by the above-mentioned monoclonal antibody hybridoma cell line 2A5.
[0013] The present invention also provides the use of the above-mentioned monoclonal antibody hybridoma cell line 2A5 or the above-mentioned Cap monoclonal antibody in the preparation of reagents for quantifying PCV2b and PCV1-2b viruses.
[0014] Preferably, the reagents include those involved in immunofluorescence assay or Western blotting detection.
[0015] Preferably, the reagents include those involved in direct immunofluorescence detection.
[0016] The present invention also provides a FITC-labeled monoclonal antibody for direct immunofluorescence detection, and the monoclonal antibody is the Cap monoclonal antibody produced by the above-mentioned monoclonal antibody hybridoma cell line 2A5 or the above-mentioned Cap monoclonal antibody.
[0017] The present invention also provides a kit for determining the median infectious dose of porcine circovirus type 2b PCV2b strain and PCV1-2b strain viruses, and the kit includes the above-mentioned FITC-labeled monoclonal antibody.
[0018] Beneficial effects: The present invention provides a monoclonal antibody hybridoma cell line 2A5 against the Cap protein of porcine circovirus type 2b and the Cap monoclonal antibody produced by using the monoclonal antibody hybridoma cell line 2A5. The antigenic epitope targeted by the monoclonal antibody hybridoma cell line 2A5 225 NLKDP 229 has not been reported so far. This epitope ensures the binding of the monoclonal antibody hybridoma cell line 2A5 to PCV2b or PCV1-2b viruses. At the same time, this monoclonal antibody is suitable for direct labeling with FITC. The present invention also established a kit for direct immunofluorescence method based on directly labeled FITC antibody, which can be applied to the quantification of PCV2b and PCV1-2b viruses, especially for the median infectious dose (TCID50 ) for providing sensitive, specific and uniform detection agents for the research of inactivated PCV2 vaccines, chimeric inactivated porcine circovirus vaccines and live vaccines.
[0019] Biological preservation information
[0020] The hybridoma cell line 2A5 of porcine circovirus type 2b fluorescent reactive monoclonal antibody was deposited at the General Microbiology Center (CGMCC) of the China Committee for Culture Collection of Microorganisms on July 4, 2022. The specific deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is CGMCC N O .45231. Description of the drawings
[0021] Figure 1 It is the amplification electrophoresis diagram of the orf2 fragment of PCV2d in Example 1 of the present invention; among them, M is the DNA molecular weight standard DL5000, 1: the orf2 fragment of PCV2d removing the nuclear localization signal peptide;
[0022] Figure 2 It is the Coomassie brilliant blue staining diagram for identifying the expression form of the recombinant Cap protein in Example 2 of the present invention; among them, M is the protein molecular weight standard; 1: lysed whole bacteria His-rCap; 2: pET28a-induced lysed whole bacteria; 3: lysed precipitate His-rCap; 4: pET28a-induced lysed precipitate; 5: lysed supernatant His-rCap; 6: pET28a-induced lysed supernatant;
[0023] Figure 3 It is the Western blotting diagram for detecting the expression of the recombinant protein His-rCap with porcine PCV2-infected positive serum and His-tag antibody in Example 2 of the present invention; among them, M is the protein molecular weight standard; 1: reaction of porcine PCV2 positive serum with His-rCap protein; 2: reaction of porcine PCV2 positive serum with pET-28a protein; 3: reaction of His antibody with His-rCap protein; 4: reaction of His antibody with pET-28a protein;
[0024] Figure 4 It is the Coomassie brilliant blue staining diagram after optimizing the expression conditions of the recombinant Cap protein in Example 2 of the present invention; among them, M is the protein molecular weight standard; 1: 8h-induced lysed supernatant; 2: 10h-induced lysed supernatant; 3: 12h-induced lysed supernatant; 4: 14h-induced lysed supernatant; 5: 16h-induced lysed supernatant;
[0025] Figure 5It is the Coomassie brilliant blue staining pattern of the recombinant Cap protein after washing with imidazole at different concentrations in Example 2 of the present invention; wherein, M is the protein molecular weight standard; 1: before purification of the recombinant protein; 2: washing with 100 mM imidazole washing buffer; 3: elution with 250 mM imidazole elution buffer;
[0026] Figure 6 It is the Western blotting reaction pattern of the cell supernatant of monoclonal antibody 2A5 strain diluted 10-fold and recombinant protein His-rCap in Example 5 of the present invention; M is the protein molecular weight standard; 1: recombinant protein His-rCap;
[0027] Figure 7 It is the Western blotting pattern of the Cap protein in PK15 B6 cells infected with PCV2b 0233 strain, PCV2d 0728 strain, and PCV1-2b(C1-233) strain detected by monoclonal antibody in Example 5 of the present invention; M is the protein molecular weight standard; 1: PK15 B6 cells infected with PCV2b 0233 strain; 2: PK15 B6 cells infected with PCV1-2b C1-233 strain; 3: PK15 B6 cells infected with PCV2d0728 strain;
[0028] Figure 8 It is the IFA pattern of the Cap protein in PK15 B6 cells infected with PCV2b 0233 strain, PCV2d 0728 strain, PCV1-2bC1-233 strain, and PCV1 strain detected by monoclonal antibody in Example 5 of the present invention; A: PK15 B6 cells infected with PCV2b 0233 strain; B: PK15 B6 cells infected with PCV2d 0728 strain; C: PK15 B6 cells infected with PCV1-2b C1-233 strain; D: PK15 B6 cells infected with PCV1 strain; E: healthy PK15 B6 cells;
[0029] Figure 9 It is the ELISA OD 450 value for detecting the cross-reaction of the monoclonal antibody with other proteins in Example 5 of the present invention;
[0030] Figure 10It is the Western blotting identification diagram of the antigen epitope of monoclonal antibody 2A5 strain in Example 6 of the present invention; among them, M is the protein molecular weight standard; 1: truncated protein N1; 2: truncated protein N2; 3: truncated protein N3; 4: truncated protein N4; 5: truncated protein N5; 6: truncated protein N6; 7: truncated protein N7; 8: truncated protein N8; 9: truncated protein N9; 10: truncated protein N10; 11: truncated protein N11; 12: truncated protein N12; 13: truncated protein N13; 14: truncated protein N14; monoclonal antibody 2A5 strain recognizes 225NLKDP229 (only reacts with N4-N14, does not react with N1-N3);
[0031] Figure 11 It is the direct immunofluorescent assay (DFA) diagram of FITC directly labeled antibody for detecting PK15 B6 infected with PCV2b 0233 strain in Example 8 of the present invention; among them, A: directly labeled antibody diluted 1:200; B: directly labeled antibody diluted 1:400; C: directly labeled antibody diluted 1:800; D: directly labeled antibody diluted 1:1600; E: directly labeled antibody diluted 1:3200; F: directly labeled antibody diluted 1:6400; G: directly labeled antibody diluted 1:1600, incubated for 30 min; H: directly labeled antibody diluted 1:1600, incubated for 60 min; I: directly labeled antibody diluted 1:1600, incubated for 90 min. For the fluorescence detection of PCV2b 0233 strain, the optimal working concentration of directly labeled monoclonal antibody 2A5 strain is 1:1600, and the optimal incubation time is 60 min;
[0032] Figure 12 It is the DFA diagram of FITC directly labeled antibody for detecting PK15B6 infected with PCV1-2b C1-233 strain in Example 8 of the present invention; among them, A: directly labeled antibody diluted 1:200; B: directly labeled antibody diluted 1:400; C: directly labeled antibody diluted 1:800; D: directly labeled antibody diluted 1:1600; E: directly labeled antibody diluted 1:3200; F: directly labeled antibody diluted 1:6400; G: directly labeled antibody diluted 1:1600, incubated for 30 min; H: directly labeled antibody diluted 1:1600, incubated for 60 min; I: directly labeled antibody diluted 1:1600, incubated for 90 min. For the fluorescence detection of PCV1-2b C1-233 strain, the optimal working concentration of directly labeled monoclonal antibody is 1:1600, and the optimal incubation time is 60 min;
[0033] Figure 13This is a comparative diagram of the effect of the positive serum of pigs in Example 9 of the present invention and the directly FITC-labeled monoclonal antibody of strain 2A5 on determining the median infectious dose of PCV2b strain 0233 and PCV1-2b C1-233 strain; wherein, A: The directly labeled monoclonal antibody 2A5 detects PCV2b strain 0233, the dilution factor of the monoclonal antibody is 1:1600, the incubation time is 60 min; the exposure time is 500 ms; B: The positive serum of pigs detects PCV2b strain 0233, the antibody dilution is 1:1000, the incubation time is 60 min; the exposure time is 300 ms; C: The directly labeled monoclonal antibody 2A5 detects PCV1-2b C1-233 strain, the dilution factor of the monoclonal antibody is 1:1600, the incubation time is 60 min; the exposure time is 500 ms; D: The positive serum of pigs detects PCV1-2b C1-233 strain, the antibody dilution is 1:1000, the incubation time is 60 min; the exposure time is 300 ms. Detailed implementation mode
[0034] The present invention provides a monoclonal antibody hybridoma cell line 2A5 against the Cap protein of porcine circovirus type 2b, and the monoclonal antibody hybridoma cell line 2A5 has been deposited, and the deposit number is CGMCC N O .45231.
[0035] The antigenic epitope targeted by the monoclonal antibody hybridoma cell line 2A5 of the present invention is the amino acids at positions 225-229 of the Cap protein of porcine circovirus type 2b, and the specific sequence is 225 NLKDP 229 .
[0036] The present invention also provides a construction method of the above-mentioned monoclonal antibody hybridoma cell line 2A5, including the following steps: cloning the orf2 fragment removing the nuclear localization signal peptide of PCV2d strain 0728 onto a prokaryotic expression vector to construct a prokaryotic expression plasmid;
[0037] Transforming the prokaryotic expression plasmid into Escherichia coli for induced expression to obtain a soluble recombinant protein; immunizing mice 3 times after purification, measuring the enzyme-linked immunosorbent assay antibody titer against PCV2 Cap protein in the serum of immunized mice, taking mouse spleen cells and myeloma cells SP2 / 0 for fusion to prepare hybridoma cells after booster immunization, and subcloning after screening positive cells to obtain the monoclonal antibody hybridoma cell line 2A5.
[0038] When constructing the monoclonal antibody hybridoma cell line 2A5 of the present invention, it is first necessary to construct a recombinant protein prokaryotic expression vector. ORF2, as the main reading frame of PCV2, encodes the nucleocapsid Cap protein. The first 41 amino acids in the amino-terminal region of the Cap protein play a role in nuclear localization and are called nuclear localization signal peptides. The hydrophobic amino acid sequence therein is difficult to express prokaryotically. Therefore, the present invention preferably truncates the expression of the Cap protein and only expresses the 42nd to 233rd amino acids, that is, clones the 124-702bp of the sequence shown in SEQ ID NO.1 onto the prokaryotic expression vector pET-28a to construct the prokaryotic expression plasmid pET28a-orf2-His. The cloning in the present invention preferably includes inserting the gene between the BamHI and HindIII restriction enzyme sites of pET-28a. The present invention does not particularly limit the method of the cloning, and the conventional cloning methods in the art can be used. The sequence of SEQ ID NO.1 in the present invention is shown as follows, and the underlined part is the expressed sequence: ATGACGTATCCAAGGAGGCGTTTCCGCAGACGAAGACACCGCCCCCGCAGCCATCTTGGCCAGATCCTCCGCCGCCGCCCCTGGCTAGTCCACCCCCGCCACCGTTACCGCTGGAGAAGGAAA AATGGCATCTTCAACACCCGCCTCTCCCGCACCATCGGTTATACTGTCAAGAAA ACCACAGTCAGAACGCCCTCCTGGAATGTGGACATGATGAGATTTAATATTAATGATTTTCTTCCCCCAGGAGGGG GCTCAAACCCCCTCACTGTGCCCTTTGAATACTACAGAATAAGGAAGGTTAAGGTTGAATTCTGGCCCTGCTCCCC AATCACCCAGGGTGACAGGGGAGTGGGCTCCACTGCTGTTATTCTAGATGATAACTTTGTAACAAAGGCCAATGCC CTAACCTATGACCCCTATGTAAACTACTCCTCCCGCCATACCATAACCCAGCCCTTCTCCTACCACTCCCGGTACT TTACCCCGAAACCTGTCCTTGATAGGACACTCGATTACTTCCAACCCAATAACAAAAGAAATCAACTCTGGCTGAG ACTACAAACTACTGGAAATGTAGACCATGTAGGCCTCGGCACTGCGTTCGAAAACAGTATATACGACCAGGACTAC AATATCCGTATAACCATGTATGTACAATTCAGAGAATTTAATCTTAAAGACCCCCCACTTAACCCTTAA 。
[0039] After obtaining the prokaryotic expression plasmid pET28a-orf2-His, the present invention preferably induces the expression and purification of the prokaryotic expression plasmid pET28a-orf2-His. In the embodiment of the present invention, the prokaryotic expression plasmid pET28a-orf2-His is preferably transformed into Escherichia coli BL21(DE3) for IPTG-induced expression to obtain a recombinantly expressed protein with soluble expression. The purification in the present invention preferably includes purification using a Ni-NTA affinity column.
[0040] The present invention preferably uses purified recombinant protein to immunize 7-week-old BALB / c mice. After three immunizations, the ELISA antibody titer against PCV2 Cap protein in the serum of immunized mice is preferably measured. After booster immunization, spleen cells of the mice are fused with myeloma cells SP2 / 0 to prepare hybridoma cells. The positive wells are preferably screened by indirect fluorescent assay (IFA) and subcloned to obtain the monoclonal antibody hybridoma cell line 2A5.
[0041] The present invention also provides a Cap monoclonal antibody produced by the above-mentioned monoclonal antibody hybridoma cell line 2A5.
[0042] The Cap monoclonal antibody of the present invention can be used for IFA and Western blotting detection; the heavy chain of the monoclonal antibody is IgG2a and the light chain is Kappa chain; the antigen epitope targeted is 225 NLKDP 229 。
[0043] The present invention also provides the use of the above-mentioned monoclonal antibody hybridoma cell line 2A5 or the above-mentioned Cap monoclonal antibody in the preparation of reagents for quantifying PCV2b and PCV1-2b viruses.
[0044] The reagent of the present invention preferably includes reagents involved in immunofluorescence assay or Western blotting detection, and more preferably includes reagents involved in direct immunofluorescence detection.
[0045] The present invention also provides a FITC-labeled monoclonal antibody for direct immunofluorescence detection, and the monoclonal antibody is the Cap monoclonal antibody produced by the above-mentioned monoclonal antibody hybridoma cell line 2A5 or the above-mentioned Cap monoclonal antibody.
[0046] The present invention preferably labels the purified monoclonal antibody with FITC. The labeling method is not particularly limited. After purification by the ammonium sulfate-octanoic acid method, it is preferably labeled with FITC fluorescein to obtain a directly FITC-labeled antibody.
[0047] The present invention also provides a kit for measuring the median infectious dose of porcine circovirus type 2b PCV2b strain and PCV1-2b strain viruses, and the kit includes the above-mentioned FITC-labeled monoclonal antibody.
[0048] The present invention establishes a direct immunofluorescence method based on the FITC-labeled monoclonal antibody, preferably including setting the dilution degrees and incubation times of different FITC directly-labeled monoclonal antibodies to determine the optimal working conditions of the fluorescent antibody. In the embodiments of the present invention, the optimal working conditions of the FITC directly-labeled antibody are confirmed as: the labeled antibody is diluted at 1:1600 and incubated at 37 °C for 60 min. Under this condition: specific fluorescence appears in PK15 B6 cells infected with PCV2b0233 strain and PCV1-2b C1-233 strain, and no fluorescence appears in the negative control. In the embodiments of the present invention, the FITC directly-labeled monoclonal antibody is used for the determination of the 50% tissue culture infective dose (TCID 50 ) of PCV2b 0233 strain and PCV1-2b C1-233 strain viruses.
[0049] The following is a detailed description of a monoclonal antibody hybridoma cell line 2A5, a monoclonal antibody and their applications against PCV2b type Cap protein provided by the present invention in combination with embodiments, but they should not be construed as limiting the protection scope of the present invention.
[0050] Example 1
[0051] Construction of the prokaryotic expression vector pET28a-orf2-His of the recombinant protein
[0052] The orf2 sequence of porcine circovirus type 2d (PCV2d / Changzhou / JS / 20150728CZ, hereinafter referred to as the 0728 strain, which has been publicly reported in: Yang Mengshi. Research and epitope identification of monoclonal antibodies against Cap protein of porcine circovirus type 2d. Master's thesis of Yangzhou University, 2020) is shown in SEQ ID NO.1, and the amino acids at positions 42 to 233 are inserted into pET-28a.
[0053] Using the genome of PCV2d 0728 strain as a template for PCR amplification to obtain a truncated fragment of the orf2 gene, which is cloned into BamHI and HindIII of the prokaryotic expression vector pET-28a to obtain the pET-orf2-His prokaryotic expression plasmid.
[0054] Cloning primers:
[0055] PCV2d-F (SEQ ID NO.2): ACGAGGATCCAATGGCATCTTCAACACCC;
[0056] PCV2d-R (SEQ ID NO.3): ACGTAAGCTTTTAAGGGTTAAGTGGGG.
[0057] Reaction system (50 μL): 25 μL of 2×Phanta Max Buffer, 1 μL of dNTP Mix (10 mM), 2 μL of forward primer (10 mM), 2 μL of reverse primer (10 mM), 2 μL of genomic DNA, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, and 17 μL of ddH2O.
[0058] PCR reaction conditions: Pre-denaturation at 94°C for 4 min; denaturation at 94°C for 1 min, annealing at 55°C for 30 s, extension at 72°C for 1 min, for a total of 30 cycles; extension at 72°C for 10 min, and preservation at 12°C.
[0059] The recombinant plasmid was identified by PCR using the designed primers. The results were as Figure 1 shown, and a 579-bp fragment was amplified, which was consistent with the expected size.
[0060] Example 2
[0061] Induced expression and purification of recombinant expression plasmid pET28a-orf2-His
[0062] The recombinant expression plasmid pET28a-orf2-His was transformed into Escherichia coli BL21(DE)3. Colonies were picked and cultured at 37°C. When the OD 600 value reached 0.4 - 0.6, 1 mM IPTG was added, and induced expression was carried out at 16°C and 120 rpm for 14 hours.
[0063] The bacterial liquid precipitate after the above-induced expression and centrifugation was resuspended in 0.01 M PBS and then ultrasonically disrupted. After centrifugation at 10000 r / min for 10 minutes, the supernatant and precipitate were obtained, and SDS-PAGE was performed respectively. The results were as Figure 2 shown. The recombinant protein could be expressed in the supernatant. The recombinant Cap protein was purified using NI-NTA affinity medium. The main process was as follows: The bacterial liquid induced under the above conditions was collected, washed twice with 0.01 M PBS, ultrasonically disrupted and then centrifuged at 10000 r / min. The supernatant was collected. The pretreated nickel column was assembled, the flow rate was adjusted to 1 Ml / min, the harvested supernatant was added, and the miscellaneous proteins were washed away with the washing buffer containing 100 mM imidazole. The target protein was eluted with the elution buffer containing 250 mM imidazole. 15 μL of the eluate was mixed with 5 μL of 4×loading buffer and incubated in a metal bath at 96°C for 10 min. 5 μL of the sample was taken for SDS-PAGE electrophoresis and Western blotting analysis.
[0064] The Western blotting graph showing the expression of recombinant protein His-rCap detected by porcine positive serum infected with PCV2 and His-tag antibody is as Figure 3 shown; the recombinant protein can react with both porcine positive serum and His antibody, and the band size is correct, while the empty vector does not react with positive serum and his antibody, indicating that the obtained recombinant protein has high specificity.
[0065] The Coomassie brilliant blue staining graph after induced expression is as Figure 4 shown; the protein expression level is the highest after 14 hours of induction.
[0066] The Coomassie brilliant blue staining graph of recombinant Cap protein after washing with different concentrations of imidazole is as Figure 5 shown; the eluted protein band is single, proving good purification effect.
[0067] Example 3
[0068] Mouse immunization
[0069] Mix the purified protein in Example 2 with an equal volume of Freund's complete adjuvant and fully emulsify it, then immunize 6-week-old BALB / c mice by subcutaneous injection, with an immunization dose of 100 μg / mouse. Two weeks later, take the purified protein and mix it with an equal volume of Freund's incomplete adjuvant and fully emulsify it, then immunize subcutaneously, with the same dose as the first time. Immunize again two weeks after the second immunization, with the same immunization dose and method as the second time. One week after the third immunization, collect blood from the eye socket, separate the serum, and measure the antibody titer in the serum by indirect ELISA. Select the mice with higher titers for cell fusion. Three days before cell fusion, take 100 μg of protein, dilute it to 100 μL with 0.01 M PBS, and then inject it intraperitoneally for booster immunization.
[0070] The specific steps of the indirect ELISA method are as follows:
[0071] (1) Coat the enzyme-labeled strip with the purified recombinant Cap protein. Determine the optimal coating concentration to be 0.29 μg / mL through a checkerboard test, add 100 μL per well, incubate overnight at 4°C. On the second day, wash it 3 times with PBST, 5 minutes each time, and pat dry.
[0072] (2) Add 5% skim milk for blocking, 100 μL per well, block at 37°C for 90 minutes, wash it 3 times with PBST, 5 minutes each time, and pat dry.
[0073] (3) Add the diluted mouse serum, incubate at 37°C for 1 hour, wash it 3 times with PBST, 5 minutes each time, and pat dry.
[0074] (4) Add the HRP enzyme-labeled secondary antibody diluted 1:5000, incubate at 37°C for 1 hour, wash it 3 times with PBST, 5 minutes each time, and pat dry.
[0075] (5) Add TMB chromogenic solution, 100 μL per well, and incubate in the dark at 37 °C for 15 min.
[0076] (6) Add stop solution, 50 μL per well.
[0077] (7) Read the OD 450 value with an enzyme-linked immunosorbent assay (ELISA) reader.
[0078] Example 4
[0079] Preparation of monoclonal antibody hybridoma cell line 2A5
[0080] (1) Preparation of SP2 / 0 cells
[0081] Gently blow down the SP2 / 0 cells in good growth condition and in the logarithmic growth phase with antibiotic-free medium and count them.
[0082] (2) Preparation of feeder cells
[0083] One day before cell fusion, healthy ICR mice were bled from the eyeballs to prepare negative serum, and then the mice were used to prepare feeder cells. The specific steps were as follows: Take healthy 6-week-old ICR mice, bleed them from the eyeballs and then decapitate them after bleeding. Immerse the mice in 75% alcohol for 10 min. Fix the limbs of the mice on a foam board, cut open the abdominal skin with sterile scissors and forceps to expose the peritoneum. Aspirate 10 mL of pre-cooled HAT medium with a 20 mL syringe and inject it intraperitoneally into the mice. Massage both sides of the abdomen with an alcohol cotton ball and aspirate repeatedly until the liquid turns yellow. Mix the aspirated liquid with 50 mL of HAT medium and drop 2 drops into each well of a 96-well plate. Add one more drop to the edge wells. Incubate in a 37 °C, CO2 incubator.
[0084] (3) Preparation of spleen cells
[0085] Three days after boosting immunization of mice with high titer, bleed them to death from the eyeballs, collect the eyeball blood and separate the serum as positive control serum. Immerse the mice in 75% alcohol for 10 min and then fix them on a foam board. Remove the spleen with sterile surgery, wash the spleen clean in a petri dish containing DMEM medium, and carefully remove the connective tissue. Transfer the spleen to a new petri dish containing DMEM medium, gently squeeze and grind it with a grinding rod on a sieve. After sufficient grinding, transfer the grinding liquid to a 50 mL centrifuge tube, centrifuge at 1000 rpm for 10 min, resuspend with 10 mL of DMEM medium, and count for later use.
[0086] (4) Cell fusion
[0087] Preheat 100 mL of serum - free and antibiotic - free DMEM medium, 50 mL of HAT medium, and 1 mL of PEG - 1500 (Sigma, catalog number 10783641001) to 37°C. Blow down the well - conditioned SP2 / 0 cells in six 75 - mL square flasks with DMEM medium, transfer them to a new cell flask, and count. Mix splenocytes and SP2 / 0 cells at a ratio of 5:1 in a 50 - mL centrifuge tube, centrifuge at 1000 rpm for 10 min, discard the supernatant, gently tap the bottom of the tube with the palm of the hand to make the cell pellet disperse evenly into a paste, and place the centrifuge tube in a beaker containing water at 40°C. While shaking, add 1 mL of PEG - 1500 drop by drop, and finish adding it within 1 min; continue to shake the centrifuge tube and add the pre - heated serum - free and antibiotic - free DMEM drop by drop, and add 30 mL of medium within 90 s to terminate the fusion. Let it stand at 37°C for 10 min, then centrifuge at 1000 rpm for 10 min, discard the supernatant, resuspend the pellet with HAT, and add two drops per well to a 96 - well plate pre - seeded with feeder cells, and place it in a 37°C, CO2 incubator for continuous observation and culture. Half - change the medium after 5 days, completely change the medium after 10 days, and continue to culture until the cell supernatant turns yellow, then aspirate for detection.
[0088] (5) Screening of positive cells
[0089] When the hybridoma cells grow to half of the field of view or the cell supernatant turns yellow, use the indirect immunofluorescence assay to detect and screen positive wells. Use the hybridoma cell supernatant as the primary antibody, FITC - labeled goat anti - mouse IgG as the secondary antibody, the fused mouse serum as the positive control, and the SP2 / 0 cell supernatant as the negative control. The specific operation steps are as follows:
[0090] Inoculate the separately isolated, constructed, and preserved PCV 2b 0233 strain and PCV1 - 2b C1 - 233 strain (both are publicly available at doi: 10.3389 / fmicb.2018.00455) into PK15 B6 cells (MOI = 0.2) respectively, passage 2 to 3 times. When the cells grow to 80%, digest and disperse the cells, then seed them in a 96 - well plate, 100 μL per well, and place them in a cell culture incubator for culture. After growing to confluence, take them out, discard the medium, wash 3 times with 0.01 M PBS, fix with methanol pre - cooled at - 20°C at 4°C for 15 min. Discard the fixative, wash 3 times with 0.01 M PBS, add 100 μL of cell supernatant to each well, incubate at 37°C for 1 h; discard the cell supernatant, wash 3 times with 0.01 M PBS, then add 30 μL of FITC - labeled goat anti - mouse IgG diluted 1:200 to each well, incubate at 37°C for 45 min; discard the secondary antibody, wash 3 times with 0.01 M PBS, and then observe under a fluorescence microscope. Select the wells with strong specific fluorescence for sub - cloning. After 3 times of sub - cloning and screening in the same way, the hybridoma cell line 2A5 that can stably secrete antibodies against the Cap protein was obtained, and after large - scale culture, ascites was prepared.
[0091] (6) Preparation of ascites
[0092] Select female BALB / c mice at 10 - 12 weeks old after parturition. Each mouse was sensitized by intraperitoneal injection of 500 μL paraffin oil. One week later, 1×10 5 - 1×10 6 hybridoma cells in the logarithmic growth phase were injected into the peritoneal cavity of the mice, 200 μL for each mouse. Four days later, observe the abdomen of the mice. When the abdomen of the mice bulges, collect the ascites, centrifuge at 3000 rpm for 10 min, collect the supernatant to measure the titer, and store it at -70 °C.
[0093] Example 5
[0094] Subclass and specificity identification of monoclonal antibody
[0095] According to the instruction manual of the monoclonal antibody subclass identification kit of Bioron Company, the subclass of monoclonal antibody 2A5 strain was identified by ELISA method. The light chain was Kappa and the heavy chain was IgG2a.
[0096] To verify the specificity of the monoclonal antibody, PK15 B6 cells were infected with PCV2b 0233 strain, PCV2d 0728 strain and chimeric porcine circovirus PCV1-2b C1-233 strain, and indirect immunofluorescence assay and Western blotting analysis were carried out. The results are as Figure 6 and Figure 7 shown. The monoclonal antibody of 2A5 strain can specifically recognize PCV2 0233 strain and chimeric virus PCV1-2b C1-233 strain, and has no reaction with PCV2d 0728 strain.
[0097] IFA detection was carried out with healthy PK15 B6 cells and PK15 cells infected with PCV1. The results are as Figure 8 shown, without specific fluorescence. ELISA plates were coated with the expressed PCV3-Rep protein, ASFV-P30 protein, and pET-28a empty vector protein. The results are as Figure 9 shown, and there is no reaction with the monoclonal antibody of 2A5 strain.
[0098] Example 6
[0099] Antigen epitope identification
[0100] Truncate the Cap protein (42-233aa, SEQ ID NO.4: MTYPRRRFRRRRHRPRSHLGQILRRRPWLVHPRHRYRWRRKNGIFNTRLSRTIGYTVKKTTVRTPSWNVDMMRFNINDFLPPGGGSNPLTVPFEYYRIRKVKVEFWPCSPITQGDRGVGSTAVILDDNFVTKANALTYDPYVNYSSRHTITQPFSYHSRYFTPKPVLDRTLDYFQPNNKRNQLWLRLQTTGNVDHVGLGTAFENSIYDQDYNIRITMYVQFREFNLKDPPLNP) into 14 peptides (N1: 42-116aa; N2: 42-130aa; N3: 42-224aa; N4: 42-229aa; N5: 50-233aa; N6: 56-233aa; N7: 64-233aa; N8: 69-233aa; N9: 75-233aa; N10: 79-233aa; N11: 90-233aa; N12: 96-233aa; N13: 109-233aa; N14: 137-233aa);
[0101] The PCR method is shown in Example 1. The specific methods for recombinant plasmid transformation and recombinant protein expression are shown in Example 2. According to the Western blotting results ( Figure 10 ), the antigenic epitope sequence of the Cap protein targeted by the monoclonal antibody 2A5 strain is 225 NLKDP 229 .
[0102] Table 1 Primer information for the PCR method
[0103]
[0104]
[0105] Example 7
[0106] Purification of monoclonal antibody ascites and FITC labeling
[0107] Use the ammonium sulfate-octanoic acid method for the preliminary purification of ascites. The specific operation steps are as follows:
[0108] (1) Take 5 mL of ascites, add 10 mL of acetate buffer (mix 59 mL of 0.06 M NaAc and 41 mL of 0.06 M HAc, adjust the pH to 4.8) for dilution, and add octanoic acid (33 μL per mL of ascites) while stirring at room temperature. Let it stand at 4°C for 2 h to fully precipitate.
[0109] (2) Centrifuge at 13,000 rpm for 30 min, discard the precipitate, filter the supernatant through a bacterial filter, resuspend it with 0.1 M PBS at 10% of the volume, and adjust the pH to 7.4 with sodium hydroxide. While stirring, add an equal volume of saturated ammonium sulfate precooled at 4°C, and incubate overnight at 4°C.
[0110] (3) Centrifuge at 10,000 rpm for 10 min, discard the supernatant, resuspend the precipitate with 1 mL of 0.01 M PBS, and dialyze overnight to obtain the purified antibody.
[0111] Fluorescein isothiocyanate (FITC) labeling of the purified ascites was performed as follows:
[0112] (1) First, determine the protein concentration of the purified ascites using a BCA kit to be 1.7 mg / mL.
[0113] (2) Load the purified ascites into a pre-treated dialysis bag, and dialyze it with carbonate buffer (8.6 g of anhydrous sodium carbonate, 17.2 g of sodium bicarbonate, 1 L of distilled water, pH adjusted to 9.5) for 12 h, changing the solution several times during the period.
[0114] (3) Transfer the antibody to a 10 mL brown vial, add a rotor, place it on a magnetic stirrer, and stir at low speed to avoid generating foam. Weigh FITC in the dark, dissolve it with DMSO at 5% of the antibody volume, and add the FITC-DMSO solution drop by drop at a ratio of 50 μg of FITC corresponding to 1 mL of ascites, and finish adding it within 10 min. Stir overnight at 4°C in the dark.
[0115] (4) Dialyze with 0.01 M PBS for 24 h, changing the solution several times during the period, and the labeled antibody is obtained when the dialysis solution is clear and transparent.
[0116] Example 8
[0117] Establishment of direct immunofluorescence method
[0118] Set different dilution degrees and incubation times of FITC directly labeled monoclonal antibodies to determine the optimal working conditions of the fluorescent antibody. The specific operation steps are as follows:
[0119] (1) Fix the cell plate inoculated with the virus according to the method in Example 4(5), add the FITC directly labeled antibody diluted with 0.01 M PBS in gradients. The first well is diluted at 1:200, the second well is diluted at 1:400, and so on, 100 μL per well. Set 3 time points for the incubation time of the antibody, which are 30 min, 60 min, and 90 min respectively.
[0120] (2) Wash with 0.01 M PBS 3 times, 200 μL each time, 30 s each time. After patting dry, observe under a fluorescence microscope.
[0121] The results are asFigures 11 - 12 As shown, it was confirmed that the optimal working conditions for directly labeling antibodies with FITC were a 1:1600 dilution of the labeled antibody and incubation at 37 °C for 60 min. Under these conditions: Specific fluorescence appeared in PK15 B6 cells infected with PCV2b strain 0233 and PCV1-2b strain C1-233, and no fluorescence was observed in the negative control.
[0122] Example 9
[0123] Determination of the 50% tissue culture infective dose (TCID 50 ) of FITC directly labeled monoclonal antibodies against PCV2b strain 0233 and PCV1-2b strain C1-233
[0124] The 50% tissue culture infective doses of PCV2b strain 0233 and PCV1-2b strain C1-233 were compared using porcine PCV2b positive serum and FITC directly labeled monoclonal antibodies to verify the feasibility of using the FITC-labeled monoclonal antibody strain 2A5 instead of porcine anti-PCV2 positive serum for the quantification of PCV2b strain 0233 and PCV1-2b strain C1-233.
[0125] The results are as Figure 13 shown. The TCID 50 of PCV2b strain 0233 measured with directly labeled monoclonal antibodies was 10 -6.25 / 0.1 mL, and the TCID 50 of PCV1-2b strain C1-233 was 10 -3.5 / 0.1 mL; the TCID 50 of PCV2b strain 0233 measured with porcine anti-PCV2 positive serum was 10 -6.375 / 0.1 mL, and the TCID 50 of PCV1-2b strain C1-233 was 10 -3.7 / 0.1 mL. At an exposure time of 500 ms, the fluorescence intensities of the two methods were comparable, indicating that the FITC-labeled monoclonal antibody strain 2A5 can replace porcine anti-PCV2 positive serum for the quantification of PCV2b strain 0233 and PCV1-2b strain C1-233.
[0126] The specific operation steps are as follows:
[0127] (1) Seed a 96-well plate. Digest the PK15 B6 cells grown to 90% confluence in a 75 mL Erlenmeyer flask with trypsin, resuspend them in 5 mL of DMEM medium, and take 2 mL of the cell suspension and add it to DMEM medium containing 4% fetal bovine serum to make 10 mL. Gently pipette to mix well and then seed the 96-well plate, adding two drops to each well. Incubate the 96-well plate in a 37 °C, 5% CO2 incubator for 24 h.
[0128] (2)Virus inoculation on 96-well plates Take out the 96-well plates, discard the culture medium, wash 3 times with 0.01M PBS buffer, add virus solution diluted by 10-fold serial dilution, add 8 wells for each dilution, and reserve 4 wells respectively as virus positive control and DMEM culture medium negative control. Subsequently, place the 96-well plates inoculated with virus solution in an incubator at 37°C and 5% CO2 for 1.5 h.
[0129] (3)Replace with maintenance medium After 1.5 h of incubation, take out the 96-well plates from the incubator at 37°C and 5% CO2, discard the virus solution, and add 100 μL of DMEM culture medium containing 2% fetal bovine serum to each well. Place the 96-well plates in an incubator at 37°C and 5% CO2 for 72 h, and then perform immunofluorescence assay and calculate the virus titer (TCID 50 ).
[0130] (4)Cell fixation The specific steps are the same as those in Example 4(5).
[0131] (5)Antibody incubation Perform direct immunofluorescence assay according to the method established in Example 8. At the same time, perform indirect immunofluorescence assay using porcine anti-PCV2 positive serum as the primary antibody and FITC-labeled rabbit anti-pig IgG as the secondary antibody. The specific operation is as follows. Add 100 μL of PCV2 positive serum diluted 1:1000 to each well and incubate at 37°C for 1 h. Discard the primary antibody, wash 3 times with 0.01M PBS, and then add 30 μL of FITC-labeled rabbit anti-pig IgG diluted 1:200 to each well and incubate at 37°C for 45 min. Discard the secondary antibody, wash 3 times with 0.01M PBS, and then observe under a microscope.
[0132] (6)Microscopic observation and TCID 50 Calculation Observe under a fluorescence microscope according to the conventional method, and calculate the TCID using the Reed-Muench method. 50 .
[0133] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.
Claims
1. A kit for determining the 50% infectious dose of porcine circovirus type 2b PCV2b strain and PCV1-2b strain viruses, characterized in that, The kit includes a monoclonal antibody, which is a monoclonal antibody against a specific epitope of PCV2b Cap protein produced by the monoclonal antibody hybridoma cell line 2A5; the monoclonal antibody is labeled with FITC; The monoclonal antibody hybridoma cell line 2A5 has been deposited, and the deposit number is CGMCC N O .45231; and the antigen epitope targeted by the monoclonal antibody hybridoma cell line 2A5 is the amino acids at positions 225-229 of the Cap protein of porcine circovirus type 2b.
Citation Information
Patent Citations
Hybridoma cell strain secreting porcine circovirus type 2 Cap protein monoclonal antibody
CN103695376A
Monoclonal antibody for African swine fever virus gene II type strain as well as preparation method and application thereof
CN104497136A