A chalcone reductase mutant and its application

Abstract

The present invention provides a chalcone reductase mutant and its application. The mutant is obtained by the following single mutations at position 120 or 121 of the amino acid sequence of wild-type chalcone reductase: H120G / R / I / N, W121R / C / N / P / L / Q / A / F / Y. The present invention screens for chalcone reductase mutants with significantly higher selective catalytic reduction activity than the wild type by the activity of selectively catalytically reducing the carbon-carbon double bond of chalcone for the above mutants. The method of using the chalcone reductase described in the present invention as a biocatalyst for selectively reducing the carbon-carbon double bond of chalcone to synthesize dihydrochalcone has the advantages of simple reaction steps, mild reaction conditions, high catalytic efficiency, easy enzyme preparation, good thermal stability, etc., and mutants with catalytic performance significantly superior to the wild type are discovered. The present invention is of great significance for the industrial application of chalcone reductase and improves the application ability of chalcone reductase in selectively reducing the carbon-carbon double bond of chalcone.

Description

Technical Field

[0001] The present invention belongs to the fields of genetic engineering and enzyme engineering. Specifically, it relates to a chalcone reductase mutant and its application, especially the application of the chalcone reductase mutant in selectively reducing the carbon-carbon double bond of chalcone to synthesize dihydrochalcone. Background Art

[0002] Chalcone reductase (CHR) is a member of the aldo-keto reductase (AKR) protein superfamily, which can catalyze the selective reduction of the carbon-carbon double bond in chalcone and α,β-unsaturated carbonyl structural units to generate dihydrochalcone. Dihydrochalcone compounds have various pharmacological activities such as anti-inflammatory, anti-tumor, antibacterial, and hypoglycemic effects, and are a low-energy sweetener, having high application value in the fields of medicine and food manufacturing. Selective hydrogenation of the carbon-carbon double bond of chalcone and its derivatization are the main ways to synthesize dihydrochalcone compounds. Since the carbon-carbon double bond of chalcone compounds conjugates with the adjacent carbonyl group to form an α,β-unsaturated carbonyl structural unit, and the bond energies of the two functional groups are similar, it is difficult to use chemical methods for reduction, which requires expensive transition metals as catalysts and is prone to environmental pollution. Using chalcone reductase as a catalyst has advantages such as mild reaction conditions, environmental friendliness, and no chemical selectivity problems, and has good application prospects. However, the catalytic efficiency of wild-type chalcone reductase is low and cannot meet the requirements of industrial applications. Therefore, it is imperative to develop its highly efficient mutants. Compared with screening random mutants, the efficiency of obtaining beneficial mutants by rational design of enzymes based on three-dimensional structures is significantly improved. The crystal three-dimensional structure of the complex of chalcone reductase and cofactor NADPH has been resolved (Bomati EK, Austin MB, Bowman ME, Dixon RA, Noel JP. Structural elucidation of chalcone reductase andimplications for deoxychalcone biosynthesis. J Biol Chem 2005, 280, 30496-30503. PDB ID: 1ZGD). According to the CHR-NADPH three-dimensional structure and combined with computer simulation technology, mutating the key substrate-binding sites is an effective way to obtain beneficial mutants of CHR. Summary of the Invention

[0003] The object of the present invention is to provide a chalcone reductase mutant, which is obtained by the following single mutations at position 120 or 121 in the amino acid sequence of wild-type chalcone reductase: H120G / R / I / N, W121R / C / N / P / L / Q / A / F / Y, where " / " represents "or". Specifically, this mutant is one of the following mutations based on the amino acid sequence SEQ ID NO.1 (the DNA sequence thereof is SEQ NO.2) of wild-type chalcone reductase: H120G, H120R, H120I, H120N, W121R, W121C, W121N, W121P, W121L, W121Q, W121A, W121F, W121Y.

[0004] Any chalcone reductase mutant containing the above mutations, which has undergone deletion, insertion or substitution of one or several amino acids and still has the activity of the above chalcone reductase mutant, still belongs to the protection scope of the present invention.

[0005] Another object of the present invention is to provide a recombinant vector containing the encoding gene of the chalcone reductase mutant.

[0006] Another object of the present invention is to provide the application of the chalcone reductase mutant in selectively reducing the carbon-carbon double bond of chalcone. Specifically, in the reaction, the chalcone reductase mutant catalyzes the reduction reaction of the carbon-carbon double bond of chalcone. The synthesis reaction uses chalcone as the raw material and reduced nicotinamide adenine dinucleotide phosphate (NADPH) as the cofactor, and dihydrochalcone is generated through the catalysis of the chalcone reductase mutant, as shown in Reaction Formula 1:

[0007]

[0008] Furthermore, the present invention provides a method for selectively reducing the carbon-carbon double bond of chalcone. Using NADPH as the coenzyme, chalcone undergoes a carbon-carbon double bond reduction reaction under the catalysis of the CHR mutant in a buffer solution to generate dihydrochalcone, and NADPH is oxidized to form NADP after the reaction. + , the addition amount of chalcone is 0.1 - 45 mM, the addition amount of NADPH is 0.15 - 60 mM, the addition amount of the chalcone reductase mutant is 0.1 - 5 mg / mL, the pH value is 5 - 10, the reaction temperature is 20 - 45 °C, and the reaction time is 0.5 - 24 h.

[0009] The present invention also provides a method for regenerating the cofactor NADPH. Specifically, the cofactor regeneration system is: using glucose dehydrogenase as the cofactor regenerating enzyme and glucose as the cofactor regenerating substrate, containing NADPH and NADP. + .

[0010] The chalcone carbon-carbon double bond reduction system of the present invention includes a chalcone reductase mutant, glucose dehydrogenase, chalcone (substrate), glucose, and trace amounts of NADP. + , under the conditions of controlling pH and temperature, it can selectively reduce the carbon-carbon double bond of chalcone. The principle of the reduction reaction with glucose dehydrogenase as the NADPH regenerating enzyme in the chalcone reductase mutant catalytic system is as shown in reaction

[0011] Formula 2.

[0012]

[0013] Furthermore, the addition amount of chalcone is 0.1 - 60 mM, the addition amount of NADP + is 0.01 - 0.3 mM, the addition amount of glucose is 0.15 - 90 mM, the addition amounts of the chalcone reductase mutant and glucose dehydrogenase are both 0.1 - 5 mg / mL, the pH value is 6 - 9, the reaction temperature is 20 - 45 °C, and the reaction time is 0.5 - 24 h. Preferably, the temperature is 30 °C, the pH value is 7.0, and the time is 6 - 14 h.

[0014] Preferably, the glucose dehydrogenase is derived from Bacillus megaterium.

[0015] Specifically, the glucose dehydrogenase is the glucose dehydrogenase derived from Bacillus megaterium IAM1030, and the amino acid sequence of the glucose dehydrogenase is as shown in SEQ NO.3, and the nucleotide sequence is as shown in SEQ NO.4.

[0016] The present invention has the following beneficial effects: The present invention obtained a mutant with significantly enhanced activity for catalytically selectively reducing the carbon-carbon double bond of chalcone compounds through rational mutation based on the three-dimensional structure of the chalcone reductase and cofactor complex. For the catalytic reduction of trans-chalcone, the enzyme activities of the mutants H120G, H120I, H120N, H120R, W121R, W121C, W121N, W121P, W121L, W121A, W121F, and W121Y are 3.6 times, 4.0 times, 7.6 times, 10.0 times, 10.1 times, 4.6 times, 1.6 times, 7.0, 1.9 times, 1.9 times, 3.6 times, and 3.7 times that of the wild enzyme respectively. The present invention has certain significance for the industrial application of chalcone reductase, aiming to improve the activity of CHR in catalytically reducing the carbon-carbon double bond of chalcone, thereby improving the application potential of this enzyme in the food, pharmaceutical, and chemical industries and realizing its industrial application. Description of the Drawings

[0017] Figure 1 . HPLC diagram of the blank control: Using the reaction solution without the addition of NADPH as the blank, only the substrate chalcone.

[0018] Figure 2 . High-performance liquid chromatography diagram of the catalytic reaction solution of wild-type chalcone reductase.

[0019] Figure 3 . High-performance liquid chromatography diagram of the catalytic reaction solution of the 120th mutant of chalcone reductase.

[0020] Figure 4 . High-performance liquid chromatography diagram of the catalytic reaction solution of the 121st mutant of chalcone reductase. Detailed implementation manners

[0021] The following further illustrates the present invention in conjunction with specific embodiments. It should be understood that the following embodiments are only used to illustrate the present invention and not to limit the scope of the present invention.

[0022] Example 1 Preparation of wild-type chalcone reductase

[0023] After the gene sequence of chalcone reductase from Medicago sativa was codon-optimized (the sequence is as shown in SEQ ID NO.2), it was fully synthesized by Sangon Biotech (Shanghai) Co., Ltd. and then ligated into the pET-28a(+) vector to construct the CHR-pET-28a(+) plasmid. After sequencing and verifying the sequence, it was heat-shock transformed into E. coli BL21(DE3) competent cells to obtain the chalcone reductase expression engineering bacteria. Single colonies were picked from the LB plate medium containing 50 μg / ml kanamycin and inoculated into the LB liquid medium containing 50 μg / ml kanamycin. After culturing with shaking at 37 °C and 200 rpm for 12 h, it was transferred to a 3 L liquid TB medium for scale-up culture and continued to culture with shaking at 37 °C and 200 rpm for 12 h. When the optical density OD 600 reached 0.6, the temperature was reduced to 16 °C, and an IPTG solution with a final concentration of 1.0 mM was added for induction expression for 12 h. The culture solution was centrifuged at 4000 rpm for 25 min, and the supernatant culture solution was discarded. The cells were stored at -20 °C for later use.

[0024] For every 3 g of the collected cells, 20 mL of cell lysis buffer (20 mM imidazole, 50 mM NaH 2 PO 4 , 300 mM NaCl, pH 8.0) was added, and 1 mg / mL lysozyme was added immediately before use. The cells were ultrasonically disrupted at 4 °C for 20 min and centrifuged at 12,000 rpm for 25 min. The supernatant was the crude enzyme solution. 3 mL of Ni-NTA packing material was added to the glass chromatography column. After the packing material settled, it was equilibrated with 20 mL of lysis buffer, and the crude enzyme solution was loaded at a rate of 1 ml / min. 20 mL of cell lysis buffer was used to elute the miscellaneous proteins. The elution buffer (250 mM imidazole, 50 mM NaH 2PO 4 , 300 mM NaCl, pH 8.0) to elute the target protein, measure the protein concentration, and perform dialysis to remove imidazole, obtaining chalcone reductase with higher purity, which is stored at 4 °C for later use.

[0025] Example 2 Preparation of Chalcone Reductase Mutants

[0026] Using the three-dimensional structure of the CHR and cofactor NADPH complex as a template, through molecular docking and kinetic simulation of the binding of the substrate to CHR, the histidine at position 120 and tryptophan at position 121 of chalcone reductase were determined as the key substrate-binding sites. Using the plasmid CHR-pET-28a(+) linked with the DNA of wild-type chalcone reductase as a template, site-directed mutagenesis was performed on the above two sites.

[0027] Table 1. Primers Used for Chalcone Reductase Mutagenesis

[0028] Mutant Name Primer H120G For 5'-GGATCTGTACCTGATCGGATGGCCGCTGAGCAGCCA-3' Rev 5'-CTGCTCAGCGGCCATCCGATCAGGTACAGATCCA-3' H120R For 5'-GGATCTGTACCTGATCCGGTGGCCGCTGAGCAGCCA-3' Rev 5'-CTGCTCAGCGGCCACCGGATCAGGTACAGATCCA-3' H120I For 5'-GGATCTGTACCTGATCACTTGGCCGCTGAGCAGCCA-3' Rev 5'-CTGCTCAGCGGCCAGATGATCAGGTACAGATCCA-3' H120N For 5'-GGATCTGTACCTGATCAACTGGCCGCTGAGCAGCCA-3' Rev 5'-CTGCTCAGCGGCCAGTTGATCAGGTACAGATCCA-3' W121R For 5'-GGATCTGTACCTGATCCACCGTCCGCTGAGCAGCCA-3' Rev 5'-CTGCTCAGCGGACGGTGGATCAGGTACAGATCCA-3' W121C For 5'GATCTGTACCTGATCCACTGTCCGCTGAGCAG 3' Rev 5'CTGCTCAGCGGACAGTGGATCAGGTACAGATC 3' W121N For 5'-GGATCTGTACCTGATCCACAACCCGCTGAGCAGCCA-3' Rev 5'-CTGCTCAGCGGGTTGTGGATCAGGTACAGATCCA-3' W121P For 5'-GGATCTGTACCTGATCCACCCACCGCTGAGCAGCCA-3' Rev 5'-CTGCTCAGCGGTGGGTGGATCAGGTACAGATCCA-3' W121L For 5'-GGATCTGTACCTGATCCACCTACCGCTGAGCAGCCA-3' Rev 5'-CTGCTCAGCGGTAGGTGGATCAGGTACAGATCCA-3' W121Q For 5'GATCTGTACCTGATCCACCAACCGCTGAGCAG 3' Rev 5'CTGCTCAGCGGTTGGTGGATCAGGTACAGATC 3' W121A For 5'TCTGTACCTGATCCACGCACCGCTGAGCAGCCAG 3' Rev 3' GACATGGACTAGGTGCGTGGCGACTCGTCGGTCG 5' W121F For 5' GATCTGTACCTGATCCACTTCCCGCTGAGCAG 3' Rev 5' CTGCTCAGCGGAAGGTGGATCAGGTACAGATC 3' W121Y For 5' GATCTGTACCTGATCCACTATCCGCTGAGCAG 3' Rev 5' CTGCTCAGCGGATAGTGGATCAGGTACAGATC 3'

[0029] After each mutant product was verified by sequencing, it was transformed into competent E. coli M15 cells for expression, obtaining an engineered strain for expressing chalcone reductase mutants.

[0030] The expression and purification methods of chalcone reductase mutants are the same as those of the wild type.

[0031] Example 3 Preparation of Glucose Dehydrogenase

[0032] In previous research work, the applicant's laboratory has completed the construction of the plasmid of glucose dehydrogenase from Bacillus megaterium (A method for synthesizing chiral alcohols using Perakine reductase, Chinese Patent CN201811521466.0; Cai S, Shao N, Chen Y, Li A, Pan J, Zhu H, Zou H, Zeng S, Sun L, *Zhao J.* Enantioselective reduction of α,β-unsaturated ketones and aryl ketones by perakine reductase. Org. Lett. 2019, 21, 4411-4414.). The amino acid sequence is shown in SEQ ID NO. 3 of the sequence listing, and the nucleotide sequence is shown in SEQ ID NO. 4 of the sequence listing. It was heat-shock transformed into competent E. coli BL21(DE3) cells to obtain an engineered strain for expressing glucose dehydrogenase. The engineered strain for expressing glucose dehydrogenase was inoculated into LB medium containing 50 μg / ml kanamycin and cultured with shaking at 37 °C for 12 h. It was transferred to 1 L of LB medium containing the same concentration of kanamycin. When the optical density OD of the culture broth600 When it reached 0.6, IPTG with a final concentration of 0.1 mM was added, and induction was carried out at 20 °C for 16 h. Then, the culture solution was centrifuged at 8000 rpm for 10 min, the supernatant medium was discarded, and the bacterial cells were stored at -20 °C for later use.

[0033] The cells of the engineered strain expressing glucose dehydrogenase were resuspended in 20 ml of lysis buffer (10 mM imidazole, 50 mM NaH 2 PO 4 , 300 mM NaCl, pH 8.0). After shaking well, lysozyme at 1 - 2 mg / ml was added, and after ice-bathing for 40 min, it was subjected to ultrasonic disruption 3 times, 3 min each time, with a 15-min interval between each time. The disrupted solution was centrifuged at 22000×g for 50 min, and the obtained supernatant was the crude enzyme solution. Using Ni-NTA as the purification material, with a column volume of 3 ml, the Ni-NTA column was equilibrated with 15 ml of lysis buffer, and the crude enzyme solution was loaded at a rate of 1 ml / min. The unadsorbed proteins were eluted with washing buffer (20 mM imidazole, 50 mM NaH 2 PO 4 , 300 mM NaCl, pH 8.0), and finally the target protein was eluted and collected with elution buffer (250 mM imidazole, 50 mM NaH 2 PO 4 , 300 mM NaCl, pH 8.0). The target protein was dialyzed with 5 L of Kpi buffer (50 mM KH 2 PO 4 , 50 mM K 2 HPO 4 , 10 mM EDTA, pH 7.0) to remove salts and imidazole, and the obtained pure enzyme solution was stored at 4 °C for later use.

[0034] Example 4. Selective reduction of the carbon-carbon double bond of chalcone by wild-type and mutant chalcone reductases (taking chalcone as an example)

[0035] The wild-type or mutant chalcone reductase obtained in Examples 1 and 2 was added to the reaction system at an addition amount of 2 mg / ml, and the glucose dehydrogenase obtained in Example 3 was added at a concentration of 1 mg / ml. Using 50 mM pH 7.0 Kpi containing 10 mM EDTA as the buffer, and then the substrate chalcone with a final concentration of 0.8 mM, 1.2 mM glucose, and 0.02 mM NADP were added respectively. +React at a constant temperature of 30 °C with shaking (660 rpm) for 2 h, add an equal volume of methanol to terminate the reaction. After centrifuging the reaction solution at 12,000 rpm for 30 min, take the supernatant for injection into high performance liquid chromatography (HPLC) to analyze the amounts of the substrate and product. The HPLC analysis method is as follows: Agilent 1260 high performance liquid chromatograph; Agilent 5HC-C18 250 * 4.6 mm chromatographic column; column temperature 30 °C; flow rate 1 ml / min; detection wavelength 254 nm; mobile phase: 55% water and 45% acetonitrile. The reduction product of the chalcone carbon-carbon double bond is dihydrochalcone. Use the mixture of the enzyme without the cofactor NADPH and chalcone as the blank control ( Figure 1 ), use the dihydrochalcone standard as the control, analyze the catalytic reactions of the wild type and mutants of chalcone reductase, calculate the yield through the concentration curves of chalcone and dihydrochalcone standards, and compare the wild type of chalcone reductase ( Figure 2 ) with the mutant at position 120 ( Figure 3 ) and the mutant at position 121 ( Figure 4 ) for relative activity.

[0036] Table 2. Detection of the activity of chalcone reductase mutants using chalcone as the substrate

[0037]

[0038]

[0039] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A chalcone reductase mutant, characterized in that, the mutant has only one of the following mutations based on the amino acid sequence SEQ ID NO.1 of wild-type chalcone reductase: W121R, W121C, W121N, W121P, W121L, W121A, W121F, W121Y.

2. A coding gene, characterized in that, it encodes the chalcone reductase mutant described in claim 1.

3. A recombinant vector, characterized in that, it contains the coding gene described in claim 2.

4. Use of the chalcone reductase mutant described in claim 1 as a catalyst in the selective reduction of the carbon-carbon double bond of chalcone.

5. The use according to claim 4, characterized in that, the use in the selective reduction of the carbon-carbon double bond of chalcone is achieved by the following steps: using chalcone as a raw material, using reduced nicotinamide adenine dinucleotide phosphate (NADPH) as a cofactor, and generating dihydrochalcone through the catalysis of the chalcone reductase mutant. The reaction formula is as follows: During the reaction, NADPH is oxidized to NADP + , and NADP is regenerated to NADPH through the cofactor regeneration system. + ​ 6. The use according to claim 5, characterized in that, The cofactor regeneration system is: a glucose dehydrogenase cofactor regeneration enzyme, glucose as a cofactor regeneration substrate, and a glucose dehydrogenase cofactor regeneration system containing NADPH and NADP + +.

7. The use according to claim 5, characterized in that, in the catalytic reaction of the chalcone reductase mutant, the addition amount of chalcone is 0.1 - 45 mM, the addition amount of NADPH is 0.15 - 60 mM, the addition amount of the chalcone reductase mutant is 0.1 - 5 mg / mL, the pH value is 5 - 10, the reaction temperature is 20 - 45 °C, and the reaction time is 0.5 - 24 h.

Images