Taq DNA polymerase mutant and use thereof

Abstract

Disclosed is a Taq DNA polymerase mutant. Compared to a wild-type Taq DNA polymerase, the Taq DNA polymerase mutant has a mutation at one or more of amino acid positions 116, 439, and 468, wherein the amino acid sequence of the wild-type Taq DNA polymerase is set forth in SEQ ID NO: 1. Compared to the wild-type Taq DNA polymerase, the Taq DNA polymerase mutant of the present invention has higher enzyme activity than the wild-type enzyme; both single-site mutants and multi-site mutants show improved tolerance to corn leaf supernatant, mouse serum, and / or heparin sodium, and thus can be used for direct rapid amplification of samples.

Description

Taq DNA polymerase mutants and their applications Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a Taq DNA polymerase mutant and its applications. Background Technology

[0002] Taq DNA polymerase, the first thermostable DNA polymerase discovered, was successfully extracted by Saiki et al. from *Thermus aquaticus*, a bacterium that lives in hot springs. Due to its excellent thermostability, this enzyme can withstand the high temperatures of polymerase chain reaction (PCR), eliminating the need to add fresh enzyme in each PCR cycle. This freed PCR technology from the inconvenience of needing to replenish enzymes for each cycle, greatly improving the efficiency and convenience of PCR reactions and promoting its rapid development into a new stage. Taq DNA polymerase has thus become an indispensable key component of PCR technology, widely used in DNA sequencing and in vitro amplification of specific fragments. PCR-based detection technologies have been widely applied in many fields, such as disease diagnosis, species identification, and environmental monitoring. Especially in the diagnosis of genetic diseases, microbial and viral infections, blood typing and blood bank testing, and human DNA identification in environmental monitoring and forensic medicine, PCR technology has demonstrated unique advantages.

[0003] However, natural Taq DNA polymerase has low activity, weak stability, and poor tolerance, making it susceptible to inhibitors in the amplification template. For example, hemoglobin in blood samples may inactivate or inhibit Taq DNA polymerase; sodium heparin in animal samples can bind to the active site of Taq DNA polymerase, thereby inhibiting PCR; and abundant sugars and phenolic compounds in plant samples can also inhibit Taq DNA polymerase activity. Therefore, to address this issue, DNA is usually purified from the sample before PCR testing using various procedures and DNA extraction kits to remove potential inhibitors. While this step helps improve the efficiency and accuracy of PCR, it makes the entire nucleic acid analysis process more complex, costly, requires larger sample volumes, and is prone to cross-contamination. More importantly, these purification steps may not completely remove all inhibitors or may result in partial loss of the target DNA during extraction.

[0004] While PCR technology is widely and effectively used in the detection of blood, plant, and soil samples, optimizing sample pretreatment procedures, reducing time and cost, and ensuring detection accuracy remain critical challenges. Therefore, there is an urgent need to develop a Taq DNA polymerase mutant with high enzyme activity and resistance to inhibitor interference, and to establish a novel direct and rapid PCR method using this enzyme to meet the demands of efficient molecular identification. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention discloses a Taq DNA polymerase mutant and its application in nucleotide polymerization, nucleic acid amplification, or nucleic acid sequencing.

[0006] One aspect of this disclosure provides a Taq DNA polymerase mutant, relative to wild-type Taq DNA polymerase, wherein the Taq DNA polymerase mutant has a mutation at one or more of the amino acids at positions 116, 439, and 468, wherein the amino acid sequence of the wild-type Taq DNA polymerase is shown in SEQ ID NO:1.

[0007] In some embodiments, the Taq DNA polymerase mutant includes one or more mutations of Y116F, A439R, and A468R.

[0008] In some embodiments, the Taq DNA polymerase mutant includes mutations in Y116F and A439R. In some embodiments, the Taq DNA polymerase mutant includes mutations in Y116F and A468R. In some embodiments, the Taq DNA polymerase mutant includes mutations in A439R and A468R. In some embodiments, the Taq DNA polymerase mutant includes mutations in Y116F, A439R, and A468R.

[0009] In this disclosure, the mutant amino acid site “Y116F” indicates that the tyrosine (Y) at the 116th amino acid position of the Taq DNA polymerase shown in SEQ ID NO:1 is mutated to phenylalanine (F); the mutant amino acid site “A439R” indicates that the alanine (A) at the 439th amino acid position of the Taq DNA polymerase shown in SEQ ID NO:1 is mutated to arginine (R); and the mutant amino acid site “A468R” indicates that the alanine (A) at the 468th amino acid position of the Taq DNA polymerase shown in SEQ ID NO:1 is mutated to arginine (R).

[0010] In some embodiments, the Taq DNA polymerase mutant has one or more of the amino acid sequences shown in SEQ ID NO:3-9, or an amino acid sequence shown in one or more of SEQ ID NO:3-9 with one or more amino acid sequences added, deleted, substituted or modified.

[0011] Another aspect of this disclosure provides a nucleic acid molecule encoding the Taq DNA polymerase mutant described herein.

[0012] In some embodiments, the nucleic acid molecule has one or more nucleotide sequences shown in SEQ ID NO:10-16, or a sequence complementary to one or more nucleotide sequences shown in SEQ ID NO:10-16, or a sequence having 65%, 70%, 75%, 80%, 85%, 90%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 99.8%, or 99.9% or more homology with one or more nucleotide sequences shown in SEQ ID NO:10-16.

[0013] In some specific embodiments, the Taq DNA polymerase mutant is a Y116F single-point mutant Taq DNA polymerase, which has the amino acid sequence shown in SEQ ID NO:3, or is encoded by the nucleotide sequence shown in SEQ ID NO:10.

[0014] In some specific embodiments, the Taq DNA polymerase mutant is an A439R single-point mutant Taq DNA polymerase having the amino acid sequence shown in SEQ ID NO:4, or encoded by the nucleotide sequence shown in SEQ ID NO:11.

[0015] In some specific embodiments, the Taq DNA polymerase mutant is an A468R single-point mutant Taq DNA polymerase having the amino acid sequence shown in SEQ ID NO:5, or encoded by the nucleotide sequence shown in SEQ ID NO:12.

[0016] In some specific embodiments, the Taq DNA polymerase mutant is a Y116F-A439R two-site mutant Taq DNA polymerase, which has the amino acid sequence shown in SEQ ID NO:6, or is encoded by the nucleotide sequence shown in SEQ ID NO:13.

[0017] In some specific embodiments, the Taq DNA polymerase mutant is a Y116F-A468R two-site mutant Taq DNA polymerase, which has the amino acid sequence shown in SEQ ID NO:7 or is encoded by the nucleotide sequence shown in SEQ ID NO:14.

[0018] In some specific embodiments, the Taq DNA polymerase mutant is a Y468R-A439R two-site mutant Taq DNA polymerase, which has the amino acid sequence shown in SEQ ID NO:8, or is encoded by the nucleotide sequence shown in SEQ ID NO:15.

[0019] In some specific embodiments, the Taq DNA polymerase mutant is a Y116F-A439R-A468R three-point mutant Taq DNA polymerase, which has the amino acid sequence shown in SEQ ID NO:9, or is encoded by the nucleotide sequence shown in SEQ ID NO:16.

[0020] Another aspect of this disclosure provides a recombinant expression vector containing the nucleic acid molecules described herein.

[0021] In some embodiments, the recombinant expression vector may be selected from viral or bacterial vectors, such as, but not limited to, African swine fever virus vectors, lentiviral vectors, avian poxvirus vectors, canine measles virus vectors, herpesvirus vectors, varicella virus vectors, adenovirus vectors, adeno-associated virus vectors, etc.

[0022] Another aspect of this disclosure provides a host cell containing the Taq DNA polymerase mutant, the nucleic acid molecule, or the recombinant expression vector described herein.

[0023] In some embodiments, the host cell is a prokaryotic cell or a eukaryotic cell.

[0024] In some embodiments, the prokaryotic cells may be selected from Escherichia coli or Bacillus subtilis, such as Escherichia coli BL21, T7E, C41, Arctic, etc. In some specific embodiments, the host cell is Escherichia coli BL21(DE3) strain.

[0025] In some embodiments, the eukaryotic cells may be selected from yeast cells, insect cells, plant cells, animal cells, etc., such as yeast cells, CHO cells, 293 cells, Vero cells, or NSO cells.

[0026] Another aspect of this disclosure provides a composition comprising (i) the Taq DNA polymerase mutant described herein, and (ii) one or more reagents selected from the group consisting of buffers, primers, probes, dyes, detection agents, target nucleic acids, and cell lysis agents.

[0027] In some embodiments, the composition is provided in the form of a kit.

[0028] Another aspect of this disclosure provides a method for preparing the Taq DNA polymerase mutant described herein, wherein the method includes the following steps:

[0029] Cultivating the host cells described in this disclosure; and

[0030] Optionally, the Taq DNA polymerase mutant can be isolated from the host cell or from the growth medium or supernatant.

[0031] Another aspect of this disclosure provides the application of the Taq DNA polymerase mutant, the nucleic acid molecule, the recombinant expression vector, the host cell, or the composition described herein in nucleotide polymerization, nucleic acid amplification, or nucleic acid sequencing.

[0032] Another aspect of this disclosure provides a method for generating DNA molecules, including the step of using a Taq DNA polymerase mutant as described in this disclosure.

[0033] In some embodiments, the Taq DNA polymerase mutant is incubated together with template DNA and primers.

[0034] In some embodiments, the method is carried out by polymerase chain reaction or isothermal nucleic acid amplification reaction.

[0035] Compared with wild-type Taq DNA polymerase, the Taq DNA polymerase mutants disclosed herein have higher enzyme activity. The single-site mutants and multi-site mutants have improved tolerance to maize leaf supernatant, mouse serum and / or heparin sodium, and can be used for direct and rapid amplification of samples. Attached Figure Description

[0036] Figure 1 shows the results of wild-type and various mutant Taq DNA polymerase PCR amplification according to some embodiments of the present disclosure.

[0037] Figure 2 shows the PCR amplification results of wild-type Taq DNA polymerase in the presence of three inhibitors according to some embodiments of the present disclosure.

[0038] Figure 3 shows the PCR amplification results of wild-type and mutant Taq DNA polymerases according to some embodiments of the present disclosure in the presence of three inhibitors.

[0039] Figure 4 shows the results of direct rapid fluorescent PCR amplification of wild-type and mutant Taq DNA polymerase according to some embodiments of the present disclosure. Detailed Implementation

[0040] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention in any way. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concepts of this disclosure. Such structures and techniques have also been described in many publications.

[0041] definition

[0042] Unless otherwise defined, all technical and scientific terms used in this disclosure have the same meaning as commonly used in the field to which this disclosure pertains. For purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0043] Unless the context clearly indicates otherwise, the terms “a” and “an” as used herein include plural references. For example, reference to “a cell” includes multiple such cells and equivalents known to those skilled in the art, etc.

[0044] As used herein, the term "about" indicates a range of ±20% of the following value. In some embodiments, the term "about" indicates a range of ±10% of the following value. In some embodiments, the term "about" indicates a range of ±5% of the following value.

[0045] The term "substitution" as used herein for amino acids refers to the replacement of at least one amino acid residue in an amino acid sequence with another different "substituted" amino acid residue. The term "insertion" as used herein for amino acids refers to the incorporation of at least one additional amino acid into an amino acid sequence. While inserts typically consist of one or two inserted amino acid residues, larger "peptide inserts" can also be prepared, for example, inserts of about three to five or even up to about ten, fifteen, or twenty amino acid residues. As disclosed above, the inserted residues can be naturally occurring or non-naturally occurring. The term "deletion" as used herein for amino acids refers to the removal of at least one amino acid residue from an amino acid sequence.

[0046] The mutants or fragments thereof disclosed herein may contain conserved amino acid substitutions at one or more amino acid residues, such as essential or non-essential amino acid residues. A “conserved amino acid substitution” is the replacement of an amino acid residue with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains are defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, in this document, essential or non-essential amino acid residues in the mutants are preferably replaced with another amino acid residue from the same side chain family.

[0047] The "sequence identity percentage" or "identity percentage" between two polynucleotide or polypeptide sequences refers to the number of identical matching positions shared by sequences within a comparison window, taking into account additions or deletions (i.e., vacancies) that must be introduced for optimal alignment of the two sequences. A matching position is any location where the same nucleotide or amino acid is present in both the target and reference sequences. Vacancies are not nucleotides or amino acids and are not counted in the target sequence. Similarly, vacancies in the reference sequence are not counted because nucleotides or amino acids from the target sequence are included, but those from the reference sequence are excluded.

[0048] The percentage of sequence identity can be calculated as follows: determine the number of positions in both sequences where the same amino acid residue or nucleic acid base appears (the number of matching positions), divide the number of matching positions by the total number of positions in the comparison window, and multiply the result by 100 to obtain the percentage of sequence identity. Sequence comparison and determination of the percentage of sequence identity between two sequences can be accomplished using software that is readily available online and downloadable. Suitable software programs are available from various sources for protein and nucleotide sequence alignment. A suitable program for determining the percentage of sequence identity is bl2seq, which is part of the BLAST program suite available from the National Center for Biotechnology Information (NCBI) website (blast.ncbi.nlm.nih.gov). Bl2seq uses either the BLASTN or BLASTP algorithm for comparing two sequences. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water, or Matcher, which are part of the EMBOSS suite of bioinformatics programs and are also available from the European Institute of Bioinformatics (EBI) at www.ebi.ac.uk / Tools / psa.

[0049] The following embodiments are provided to aid in understanding this disclosure. However, it should be understood that these embodiments are for illustrative purposes only and do not constitute any limitation. The actual scope of protection of this disclosure is set forth in the claims. It should be understood that any modifications and changes may be made without departing from the spirit of this disclosure.

[0050] This invention obtains mutant Taq DNA polymerase through a method comprising the following steps:

[0051] (1) Construct wild-type and mutant expression vectors for Taq DNA polymerase; (2) Prepare wild-type and mutant Taq DNA polymerases; (3) Determine the enzymatic properties of wild-type and mutant Taq DNA polymerases; (4) Conduct inhibitor tolerance tests on wild-type and mutant Taq DNA polymerases. The test results showed that, compared with wild-type Taq DNA polymerase, the mutant Taq DNA polymerase of this invention had higher enzyme activity than wild-type. The single-site mutant and multi-site mutant showed improved tolerance to maize leaf supernatant, mouse serum, and heparin sodium, and can be used for direct and rapid amplification of samples.

[0052] Example

[0053] Example 1. Construction of Taq DNA polymerase expression vector

[0054] The amino acid sequence of wild-type Taq DNA polymerase of Thermus aquaticus is shown in SEQ ID NO:1. The gene sequence (SEQ ID NO:2) was synthesized by Sangon Biotech Co., Ltd. and inserted into the pET30a vector using the T5 exonuclease-mediated vector construction method. The recombinant plasmid was named pET30a-Taq.

[0055] The single-point mutant Taq DNA polymerase is a mutant obtained by making a single-point mutation of any one of the amino acids Y116F, A439R, or A468R in the amino acid sequence shown in SEQ ID NO:1. The amino acid sequences are shown in SEQ ID NO:3-5, and the gene sequences are shown in SEQ ID NO:10-12, respectively. Based on the single-point mutation, multi-site mutants Y116F-A439R, Y116F-A468R, Y468R-A439R, and Y116F-A439R-A468R were also obtained. The amino acid sequences are shown in SEQ ID NO:6-9, and the gene sequences are shown in SEQ ID NO:13-16, respectively. The single-site mutant “Y116F” indicates that the tyrosine (Y) at amino acid position 116 of the Taq DNA polymerase shown in SEQ ID NO:1 has been mutated to phenylalanine (F). The multi-site mutant Y116F-A439R indicates that the tyrosine (Y) at amino acid position 116 of the Taq DNA polymerase shown in SEQ ID NO:1 has been mutated to phenylalanine (F), and the alanine (A) at amino acid position 439 has been mutated to arginine (R). The descriptions of other single-site or multi-site mutations follow the same logic.

[0056] Example 2. Preparation of wild-type Taq DNA polymerase and its mutants

[0057] The recombinant plasmids of wild-type and mutant Taq DNA polymerase obtained in Example 1 were transformed into *E. coli* BL21(DE3)plyss competent cells. Transformants were picked and inoculated into LB liquid medium containing 50 mg / mL kanamycin and cultured in shake flasks at 37°C and 220 rpm. When the OD600 of the culture medium reached 0.6-0.8, IPTG was added to a final concentration of 1 mM, and the cells were induced to grow at 18°C ​​and 220 rpm for 16-18 h. Subsequently, the cells were collected by centrifugation at 6000 rpm for 10 min, washed with buffer A (40 mM Tris–HCl pH 8.0, 200 mM KCl, 0.1 mM EDTA) to remove the culture medium, and then resuspended in buffer A. Cells were disrupted using an ultrasonic cell disruptor, followed by centrifugation at 18,000 rpm for 10 min. The supernatant was collected and incubated in a 75°C water bath for 30 min, with mixing every 5 min. The cells were then centrifuged at 10,000 rpm for 10 min, and the supernatant was collected again. An equal volume of glycerol was added, and the mixture was stored at -20°C. This yielded wild-type Taq DNA polymerase and its mutants.

[0058] Example 3. Enzymatic performance determination of Taq DNA polymerase and its mutants

[0059] Using pET30a-Taq plasmid as a template, PCR was performed using wild-type and mutant Taq DNA polymerases prepared in Example 2. The enzyme activities of wild-type and mutant Taq DNA polymerases were measured. The reaction system is shown in Table 1, and the reaction conditions are shown in Table 2.

[0060] Table 1. Taq enzyme activity assay reaction system

[0061] Table 2. Reaction conditions for Taq enzyme activity assay

[0062] The reaction buffer consisted of: 200 mM Tris-HCl, 100 mM (NH4)2SO4, 100 mM KCl, 20 mM MgSO4, 10 mM BSA, and 0.1% Triton X-100 (pH 8.8, 25°C).

[0063] Primer-F: atgcgtggtatgctgccgctg (SEQ ID NO:17)

[0064] Primer-R: ggtctttcgccagcagaccac (SEQ ID NO:18)

[0065] The PCR products were detected by agarose gel electrophoresis, and the results are shown in Figure 1. The results indicate that the yields of single-site mutants and multi-site mutants were significantly increased compared to wild-type Taq DNA polymerase, indicating that the enzyme activity of the mutants was higher than that of the wild type, enabling rapid PCR amplification.

[0066] Example 4. Tolerance test of Taq DNA polymerase and its mutant inhibitors

[0067] Using pET30a-Taq plasmid as a template, PCR was performed using wild-type Taq DNA polymerase. Different concentrations of corn leaf supernatant, mouse serum, and heparin sodium were added to the PCR system as inhibitors. The reaction system is shown in Table 3. PCR amplification was performed under the reaction conditions in Table 2, and the reaction products were detected by agarose gel electrophoresis.

[0068] The method for preparing corn leaf supernatant is as follows: Select 1 cm 2 Place fresh corn leaves in a 1.5 mL centrifuge tube, add 500 μL of 1 M KOH solution, and crush the leaves into a green solution using a grinding rod. Collect the supernatant for later use.

[0069] Mouse serum: C57BL / 6 mice were purchased from Hubei Provincial Center for Disease Control and Prevention. Blood was collected, allowed to stand at room temperature for 1 hour, centrifuged at 4°C for 10 minutes, the supernatant was removed, and the serum was flash-frozen in liquid nitrogen and stored at -80°C for use.

[0070] Heparin sodium: Purchased from Shanghai Yuanye Biotechnology Co., Ltd., product number S23144, the stock solution is 150U / mg, diluted with water to the concentration used.

[0071] Table 3. Taq enzyme inhibitor tolerance response system

[0072] According to the agarose gel electrophoresis results (Figure 2), the presence of 20% maize leaf supernatant in the PCR amplification system significantly inhibited the activity of wild-type Taq enzyme, while 15% mouse serum and 12.5 μg / mL heparin sodium completely inhibited the activity of wild-type Taq enzyme.

[0073] Using pET30a-Taq plasmid as a template, PCR was performed using wild-type and several mutant Taq DNA polymerases. 35% corn leaf supernatant, 20% mouse serum, and 10 μg / mL heparin sodium were added to the PCR system as inhibitors. The reaction system is shown in Table 3. PCR amplification was performed under the reaction conditions in Table 2, and the reaction products were detected by agarose gel electrophoresis.

[0074] According to the agarose gel electrophoresis results (Figure 3), wild-type Taq DNA polymerase could not amplify at all after the addition of 35% maize leaf supernatant, 10 μg / mL heparin sodium, and 20% mouse serum. Multi-site mutant Taq DNA polymerase could amplify effectively, while single-point mutant enzyme amplification was somewhat interfered with but still allowed for PCR amplification. The results indicate that both single-point and multi-site mutant Taq DNA polymerases showed improved tolerance to maize leaf supernatant, mouse serum, and heparin sodium.

[0075] Example 5. Taq DNA polymerase mutants for rapid identification of transgenic plants

[0076] In this embodiment, maize leaves were used as the model analyte to study the tolerance and amplification efficiency of plant leaf crude extract in real-time fluorescent PCR amplification using mutant Taq DNA polymerase.

[0077] Sample pretreatment: Select 1cm 2 Fresh maize leaves were placed in 1.5 mL centrifuge tubes, and 500 μL of 1 M KOH solution was added. The leaves were then crushed using a grinder until a green solution was obtained, and the supernatant was collected for later use. In this example, a specific method for transgenic maize MON87427 transformants and a standard maize gene method were used for duplex PCR amplification. Wild-type enzymes were used as controls. The PCR system configuration (20 μL) is shown in Table 4, and the reaction conditions are shown in Table 5.

[0078] Table 4. Detection System for Genetically Modified Crops

[0079] Table 5. Rapid PCR reaction conditions

[0080] Among the methods specific to the transgenic maize MON87427 transformant:

[0081] Forward primer F1: ACGGAAACGGTCGGGTCAAATG (SEQ ID NO:19);

[0082] Reverse primer R1: CCATGTAGATTTCCCGGTTTTCTC (SEQ ID NO:20);

[0083] Probe P1: HEX-TCGGGACAATATGGAGAAAAAGAAAGAG (SEQ ID NO:21);

[0084] In the zSSIIb method for maize internal standard gene:

[0085] Forward primer F2: CGGTGGATGCTAAGGCTGATG (SEQ ID NO:22);

[0086] Reverse primer R2: AAAGGGCCAGGTTCATTATCCTC (SEQ ID NO:23);

[0087] Probe P2: ROX-TAAGGAGCACTCGCCGCCGCATCTG (SEQ ID NO:24).

[0088] According to the real-time quantitative PCR results (Figure 4), the Ct of the Y116F-A439R mutant used for amplification of the MON87427 transformant in this invention was 28.02, which can effectively perform duplex real-time PCR amplification and complete 40 cycles within 30 min. In contrast, wild-type enzyme amplification was inhibited by the plant supernatant template. This demonstrates that the Taq DNA polymerase in this invention is superior in amplifying plant-derived samples and can perform direct and rapid nucleic acid analysis of plant samples.

[0089] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

1. A mutant of Taq DNA polymerase, characterized in that, The Taq DNA polymerase mutant, relative to the wild-type Taq DNA polymerase, has a mutation at one or more of the amino acids at positions 116, 439, and 468, wherein the amino acid sequence of the wild-type Taq DNA polymerase is shown in SEQ ID NO:

1.

2. The mutant Taq DNA polymerase of claim 1, wherein, The Taq DNA polymerase mutants include one or more mutations of Y116F, A439R, and A468R. Preferably, the Taq DNA polymerase mutant includes the Y116F and A439R mutations; Preferably, the Taq DNA polymerase mutant includes the Y116F and A468R mutations; Preferably, the Taq DNA polymerase mutant includes A439R and A468R mutations; Preferably, the Taq DNA polymerase mutants include Y116F, A439R, and A468R mutations; Preferably, the Taq DNA polymerase mutant has one or more of the amino acid sequences shown in SEQ ID NO:3-9, or an amino acid sequence showing one or more of the amino acid sequences shown in SEQ ID NO:3-9 after one or more amino acid additions, deletions, substitutions or modifications.

3. A nucleic acid molecule encoding the Taq DNA polymerase mutant of claim 1 or 2.

4. The nucleic acid molecule of claim 3, wherein, The nucleic acid molecule has one or more of the nucleotide sequences shown in SEQ ID NO:10-16, or a sequence complementary to one or more of the nucleotide sequences shown in SEQ ID NO:10-16, or a sequence having more than 65% homology to one or more of the nucleotide sequences shown in SEQ ID NO:10-16.

5. A recombinant expression vector containing the nucleic acid molecule of claim 3 or 4.

6. A host cell, characterized in that, The host cell contains the Taq DNA polymerase mutant of claim 1 or 2, the nucleic acid molecule of claim 3 or 4, or the recombinant expression vector of claim 5.

7. A composition comprising (i) the Taq DNA polymerase mutant of claim 1 or 2, and (ii) one or more reagents selected from the group consisting of buffers, primers, probes, dyes, detection agents, target nucleic acids, and cell lysis agents.

8. A method for preparing the Taq DNA polymerase mutant according to claim 1 or 2, wherein, The method includes the following steps: Cultivating the host cells as described in claim 6; and Optionally, the Taq DNA polymerase mutant can be isolated from the host cell or from the growth medium or supernatant.

9. The use of the Taq DNA polymerase mutant of claim 1 or 2, the nucleic acid molecule of claim 3 or 4, the recombinant expression vector of claim 5, the host cell of claim 6, or the composition of claim 7 in nucleotide polymerization, nucleic acid amplification, or nucleic acid sequencing.

10. A method for producing DNA molecules, comprising the step of using the Taq DNA polymerase mutant of claim 1 or 2; Preferably, the Taq DNA polymerase mutant is incubated together with template DNA and primers; Preferably, the method is carried out by polymerase chain reaction or isothermal nucleic acid amplification reaction.

Images