A circRNA marker for diagnosing and treating liver cancer and application thereof
By using hsa_circ_0005524 circular RNA as a diagnostic marker and therapeutic target for liver cancer, the difficulties in early diagnosis and treatment of liver cancer were solved, and high-sensitivity diagnosis and effective treatment effects were achieved.
Patent Information
- Application Number
- CN202210970197.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-12
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2042-08-12
AI Technical Summary
Existing imaging and histological technologies make it difficult to accurately diagnose liver cancer in the early stages, and there is an urgent need for safe and effective early detection methods and treatments for liver cancer.
hsa_circ_0005524 circular RNA was used as a diagnostic marker for liver cancer and detected by fluorescence quantitative PCR. Its overexpression was used as a potential target for drug development.
It achieves early, highly sensitive diagnosis and effective treatment of liver cancer with strong specificity, stable results, and avoidance of false positives, and has good prospects for clinical application.
Smart Images
Figure CN115725736B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and particularly relates to a circRNA marker for liver cancer diagnosis and treatment and application thereof. BACKGROUND
[0002] It is generally believed that accurate and early diagnosis of liver cancer can significantly improve clinical efficacy and reduce patient pain. However, clinical techniques such as imaging and histology can only detect liver cancer patients in the relatively late stage. Therefore, there is an urgent need to expand the window for early detection of liver cancer and safe and effective new anti-cancer technologies to prolong survival time and improve quality of life. SUMMARY
[0003] The present application aims to provide a liver cancer circRNA marker and application thereof, i.e. hsa_circ_0005524 circular RNA gene. The circRNA marker can be used as a marker for liver cancer diagnosis and as a potential way for liver cancer treatment.
[0004] The inventive concept of the present application is:
[0005] CircRNA is a very interesting conserved single-stranded RNA molecule derived from exon or intron sequences through reverse splicing of precursor mRNA. Unlike typical linear RNA, circRNA forms a covalently closed, continuous stable ring without 5' cap and 3' tail, and therefore has higher nuclease stability, which makes it a new type of biomarker with great advantages for clinical application. Most circRNAs are very abundant and conserved in different species, and have tissue or developmental stage-specific expression. CircRNA plays a role in various human diseases, especially cancer, and can play a role as a better predictive biomarker and cancer treatment target.
[0006] The DROSHA (Drosha Ribonuclease III) gene encodes a subunit of the ribonuclease (RNase) III double-stranded RNA-specific ribonuclease and microprocessor protein complex, catalyzing the initial processing steps of microRNA (miRNA) synthesis. Specifically, DROSHA cleaves the stem-loop structure from the primary microRNA (pri-miRNA) in the cell nucleus to generate the precursor miRNA (pre-miRNA), which is then exported to the cytoplasm for further processing. Studies have found that DROSHA mRNA (protein) expression is elevated in multiple tumors and promotes tumor development and progression. For example, in breast cancer, DROSHA regulates tumor stem cell-like phenotypes and progression (Cell Res. 2021). In gastric cancer, DROSHA promotes tumor cell invasion through the EGFR-ERK1 / 2-MMP7 signaling pathway. These results suggest a pro-oncogenic role for DROSHA in tumors.
[0007] In our study of the DROSHA-derived circRNA, we found that hsa_circ_0005524 is significantly underexpressed in liver cancer, and overexpression significantly inhibits the proliferation, invasion, and migration phenotypes of liver cancer cells. This result suggests that although hsa_circ_0005524 and DROSHA mRNA are derived from the same gene, DROSHA, their circular RNA structures and sequences are not completely identical, which allows them to suppress liver cancer. The significant underexpression of hsa_circ_0005524 in tumors makes it a valuable diagnostic marker for liver cancer, while its overexpression and its ability to inhibit liver cancer progression suggest its potential use as a nucleic acid drug for the treatment of liver cancer.
[0008] The present invention is achieved through the following technical solutions:
[0009] In a first aspect, the present invention provides a liver cancer circRNA marker, wherein the circRNA marker is hsa_circ_0005524;
[0010] The hsa_circ_0005524 molecule is a circular RNA molecule formed by connecting the first sequences of exons 27, 28, and 29 of the DROSHA gene. After amplification, the circular sequence of hsa_circ_0005524 was confirmed using first-generation Sanger sequencing. The full length of hsa_circ_0005524 is 309 bases, and the full-length sequence is:
[0011] GACCTGCGCGAAGTCTGGCTCAATTATCCTCTCCACCCACTCCAACTACAAGAGCCAAATACTGATCGACAACTTATTGAAACTTCTCCAGTTCTACAAAAACTTACTGAGTTTGAAGAAGCAATTGGAGTAATTTTTACTCATGTTCGACTTCTGGCAAGGGCATTCACATTGAGAACTGTGGGATTTAACCATCTGACCCTAGGCCACAATCAGAGAATGGAATTCCTAGGTGACTCCATAATGCAACTGGTAGCCACAGAGTACTTATTCATTCATTTCCCAGATCATCATGAAGGACACTTAACT (SEQ ID No. 1).
[0012] In a second aspect, the present application provides a use of a reagent for detecting a liver cancer circRNA marker in the preparation of a kit for diagnosing liver cancer.
[0013] Further, in a preferred embodiment of the present application, the reagent comprises a primer set for specifically amplifying hsa_circ_0005524.
[0014] Further, in a preferred embodiment of the present application, the primer set for hsa_circ_0005524 comprises a forward primer and a reverse primer.
[0015] The nucleotide sequence of the forward primer is shown as SEQ ID NO. 2.
[0016] The nucleotide sequence of the reverse primer is shown as SEQ ID NO. 3.
[0017] Further, in a preferred embodiment of the present application, the reagent further comprises: a reverse transcription PCR reagent and a fluorescent quantitative PCR reagent.
[0018] Further, in a preferred embodiment of the present application, the reverse transcription PCR reagent comprises: 2X RT Mix, RT Enzyme Mix, RNA free ddH2O.
[0019] Preferably, the reaction system and conditions for reverse transcription of RNA into cDNA are as follows:
[0020]
[0021] The reaction conditions are: 37℃ for 10 min, 42℃ for 20 min, 85℃ for 5 min, and 4℃ for 2 min.
[0022] Further, the fluorescent quantitative PCR reagent comprises: 2X PCR Master Mix, RNA free ddH2O.
[0023] Preferably, the reaction system and reaction condition of the fluorescent quantitative PCR amplification detection are as follows:
[0024]
[0025] The fluorescent quantitative PCR reaction condition is: 95℃ for 5 minutes denaturation; 95℃ for 10 seconds, 60℃ for 35 seconds; 40 cycles.
[0026] In a third aspect, the present application provides a liver cancer diagnosis kit, comprising specific primers for the circRNA marker.
[0027] In a fourth aspect, the present application provides a use of an expression promoter of a liver cancer circRNA marker in the preparation of a drug for treating liver cancer.
[0028] In a fifth aspect, the present application provides a drug for treating liver cancer, wherein the active ingredient comprises an expression promoter of hsa_circ_0005524.
[0029] Compared with the prior art, the present application has at least the following technical effects:
[0030] The present application firstly finds that hsa_circ_0005524 circRNA is related to the occurrence of liver cancer, and the expression of hsa_circ_0005524 in the serum of liver cancer patients is significantly reduced, so that the circRNA can be used as a liver cancer diagnosis marker, and can well predict the occurrence of liver cancer. The fluorescent quantitative PCR method can be used for quantitative detection of the circRNA marker, and the diagnosis of liver cancer can be realized. The diagnosis of liver cancer using the circRNA marker has strong specificity, high sensitivity, stable results, and no false positives, and has good clinical application prospects.
[0031] In addition, the overexpression of the marker hsa_circ_0005524 can significantly inhibit the proliferation ability and invasion ability of liver cancer cells, so that the two circRNA genes can be used as potential targets for liver cancer treatment, i.e. using the expression promoter to develop a drug for treating liver cancer, which is beneficial to realize the effective treatment of liver cancer. BRIEF DESCRIPTION OF DRAWINGS
[0032] Figure 1 Figure 1 is a graph for identifying the circRNA hsa_circ_0005524 in Example 1 of the present application.
[0033] Figure 2The fluorescence quantitative PCR detection result of hsa_circ_0005524 in Example 2 of the present application;
[0034] Figure 3 The graph showing that hsa_circ_0005524 in Example 2 of the present application has good marker performance in serum of liver cancer;
[0035] Figure 4 The fluorescence quantitative PCR detection result of hsa_circ_0005524 in Example 3 of the present application in multiple cell lines;
[0036] Figure 5 The experimental result graph of hsa_circ_0005524 on liver cancer cell proliferation in Example 4 of the present application;
[0037] Figure 6 The experimental result graph of hsa_circ_0005524 on cell migration ability in Example 5 of the present application. DETAILED DESCRIPTION
[0038] The embodiments of the present application will be described in detail below with reference to the examples, but those skilled in the art will understand that the following examples are only for illustration of the present application and should not be regarded as limiting the scope of the present application. The specific conditions not mentioned in the examples are carried out according to the conventional conditions or the conditions recommended by the manufacturer, and the reagents or instruments not mentioned by the manufacturer are all conventional products that can be purchased on the market.
[0039] The specific embodiments of the present application will be described in detail below. It should be understood that the specific embodiments described herein are only for illustration and explanation of the present application, and are not intended to limit the present application.
[0040] Example 1
[0041] Identification of hsa_circ_0005524
[0042] 1. RNA extraction (Trizol method)
[0043] (1) 1 ml trizol was added to the plasma of liver cancer patients and healthy people;
[0044] (2) 200 μL of chloroform was added, and it was shaken vigorously for 10 seconds and placed at room temperature for 10 minutes;
[0045] (3) Centrifuged at 4°C for 10 min at 12,000g, the solution was divided into three layers, the RNA was dissolved in the water phase, and the water phase was transferred to another new RNase free EP tube;
[0046] (4) 1 volume of isopropanol was added and vortexed thoroughly;
[0047] (5) Centrifuge at 12,000 g for 15 min at 4°C. After centrifugation, RNA precipitate appears at the bottom of the tube and the supernatant is discarded.
[0048] (6) Add 1 ml of 75% ethanol, gently invert by hand, centrifuge at 12,000 g for 5 min, and discard the supernatant;
[0049] (7) Allow to dry at room temperature and add 20 μL of DEPC water to dissolve the precipitate.
[0050] 2. Genomic DNA Removal
[0051] To remove residual genomic DNA from total RNA, DNA digestion enzyme was used. The specific reaction system and conditions were as follows. The total volume of the reaction solution was 10 μL and the following components were used:
[0052]
[0053] The reaction solution was digested at 37°C for 40 min and then inactivated by incubation at 85°C for 3 min.
[0054] 3. Reverse transcription of RNA into cDNA
[0055] The reaction system and conditions for reverse transcription of RNA into cDNA are as follows
[0056]
[0057] The reaction conditions were: 37°C for 10 min, 42°C for 20 min, 85°C for 5 min, and 4°C for 2 min.
[0058] 4. Design of reverse PCR primers to amplify the circ-ERBB2 interface and flanking sequence DNA sequencing verification
[0059] Based on some reference sequences provided in the Circbase database, inverse PCR primers were designed to amplify the interface and flanking sequences of hsa_circ_0005524:
[0060]
[0061] The size of the partial sequence of the primer-amplified circular RNA hsa_circ_0005524 is 309 bp; the partial sequence of the circular RNA hsa_circ_0005524 on both sides of the circular interface is PCR-amplified using cDNA as a template, and the PCR product is purified and verified by DNA sequencing after 1.2% concentration nucleic acid agarose electrophoresis separation. The results show that the circular RNA hsa_circ_0005524 molecule is a circular RNA molecule connected by the first three exons of the DROSHA gene. After amplification, the circular sequence of hsa_circ_0005524 is confirmed by first-generation Sanger sequencing, as shown in Figure 1 Figure 1, the full length of hsa_circ_0005524 is 309 bases, and the full length sequence is:
[0062] GACCTGCGCGAAGTCTGGCTCAATTATCCTCTCCACCCACTCCAACTACAAGAGCCAAATACTGATCGACAACTTATTGAAACTTCTCCAGTTCTACAAAAACTTACTGAGTTTGAAGAAGCAATTGGAGTAATTTTTACTCATGTTCGACTTCTGGCAAGGGCATTCACATTGAGAACTGTGGGATTTAACCATCTGACCCTAGGCCACAATCAGAGAATGGAATTCCTAGGTGACTCCATAATGCAACTGGTAGCCACAGAGTACTTATTCATTCATTTCCCAGATCATCATGAAGGACACTTAACT (SEQ ID NO. 1).
[0063] Example 2
[0064] Fluorescent quantitative PCR detection of hsa_circ_0005524
[0065] The method for detecting the expression of the circular RNA hsa_circ_0005524 molecule in the plasma of liver cancer patients and healthy people by fluorescent quantitative PCR amplification is as follows:
[0066] According to the method described in Example 1, total RNA is extracted, and the residual genomic DNA in the extracted RNA is removed by DNAase, and the RNA is reverse transcribed into cDNA; finally, fluorescent quantitative PCR amplification is used for detection, and the primer sequence of the fluorescent quantitative PCR is shown in SEQ ID NO. 2-5.
[0067] The reaction system and reaction conditions for detecting the expression of the circular RNA hsa_circ_0005524 molecule in the plasma of liver cancer patients and healthy people by fluorescence quantitative PCR are as follows:
[0068]
[0069] The fluorescence quantitative PCR reaction conditions are: denaturation at 95°C for 5 minutes; 95°C for 10 seconds, 60°C for 35 seconds; 40 cycles.
[0070] The expression of the circular RNA hsa_circ_0005524 in the plasma of liver cancer patients and healthy people was detected by fluorescence quantitative PCR, and the results are shown in Figure 2
[0071] As can be seen from Figure 2 , compared with normal healthy people, the expression of hsa_circ_0005524 in the plasma of liver cancer patients is significantly reduced.
[0072] As can be seen from Figure 3 , this circular RNA can well predict tumor occurrence: hsa_circ_0005524 AUC=0.8980, indicating that hsa_circ_0005524 can be used as a tumor diagnostic marker and can well predict the occurrence of liver cancer.
[0073] At the same time, the fluorescence quantitative PCR detection method of the embodiment can ideally detect the expression of the RNA hsa_circ_0005524 in organisms.
[0074] Example 3 hsa_circ_0005524 is only significantly reduced in liver cancer cell lines
[0075] In order to explore the expression of hsa_circ_0005524 in various cell lines, the expression of the circular RNA hsa_circ_0005524 in 293T cells, lung, liver, pancreas, cervical and stomach cells was detected by fluorescence quantitative PCR, as shown in Figure 4
[0076] The results show that hsa_circ_0005524 is only significantly reduced in liver cancer compared with normal cells LO2, but the expression of hsa_circ_0005524 in HepG2, SMMC7721 and Huh7 is 44.53%, 69.89% and 73.59% respectively, but this expression reduction phenomenon is not seen in other tumors, so hsa_circ_0029426 can be used as a specific diagnostic marker for liver cancer.
[0077] Example 4
[0078] CCK8 experiment to detect the effect of hsa_circ_0005524 on cell proliferation
[0079] Please make a more detailed and complete exposition of the process of this experiment
[0080] (1) Take the transfected HEPG2 and SMMC-7721 cells in the logarithmic growth phase, digest with 0.25% trypsin solution, and obtain cell precipitate by centrifugation. Resuspend the cells with culture medium and count the cells by cell counting plate.
[0081] (2) According to the results of cell counting, dilute the concentration of cell suspension to about 5000 / 100 μL, and then add the diluted cell suspension to each well of the 96-well plate.
[0082] (3) Construct hsa_circ_0005524 overexpression vector to effectively up-regulate the expression of this circular RNA in liver cancer cell lines HEPG2 and SMMC-7721. The control group (Control) transfects empty plasmid;
[0083] (4) Place the 96-well plate in a constant temperature incubator at 37°C for an appropriate period of time (0, 24, 48 and 72 hours);
[0084] (5) Add 100 μL of 10% CCK8 solution to each well of the 96-well plate (i.e. 90 μL of base medium and 10 μL of CCK8 solution);
[0085] (6) Place the 96-well plate in a constant temperature incubator at 37°C for 1-4h;
[0086] (7) Finally, adjust the SPECTRmaxPLUS34 continuous spectrum spectrophotometer to 450nm wavelength, measure and record the absorbance value of each well, and perform comparative analysis.
[0087] (8) Draw the cell growth curve to evaluate the effect of hsa_circ_0005524 overexpression on the proliferation of HEPG2 and SMMC-7721 cells.
[0088] (9) After overexpression of hsa_circ_0005524 in liver cancer cell lines HEPG2 and SMMC-7721, the cell proliferation ability was detected by CCK8 experiment, and the results are shown in Figure 5 Thus, the growth of liver cancer cells was significantly inhibited, with inhibition rates of 33% for liver cancer cell line HEPG2 and 23% for liver cancer cell line SMMC-7721.
[0089] Example 5
[0090] Cell scratch-wound healing experiment detects the influence of hsa_circ_0005524 on cell migration ability
[0091] (1) 1x106HEPG2 or SMMC-7721 cells were plated in a 60mm culture dish, and 3mL of 1640 complete culture medium was added, and placed in a 37℃, 5% CO2 cell incubator.
[0092] (2) After 24h, the cell confluence reached more than 95% under the microscope, and 200uL yellow gun head was used to draw a line 0.5-1cm behind the 6-well plate, crossing the hole. Each hole crossed at least 5 lines. Then hsa_circ_0005524 overexpression lentivirus infected tumor cells were inoculated into the 6-well plate, and the next day the gun head was compared with the ruler, and the horizontal line scratch behind was as vertical as possible. The gun head should be perpendicular and not inclined.
[0093] (3) Discard the culture medium, wash away the residual cell debris with 2mL of sterile PBS, and then add 3mL of RPMI1640 complete culture medium containing 0.5% FBS.
[0094] (4) The initial position of the cells was observed and photographed under a microscope, and recorded as the 0h time point.
[0095] (5) After 24h, the cell migration position was recorded again.
[0096] (6) 0, 24h sampling, using ImageJ software to calculate the cell migration area and make a statistical chart. The cell migration rate calculation formula is (1-24h scratch area / 0h scratch area) x 100%.
[0097] The results are shown in Figure 6 It was found that cell migration was significantly inhibited, and the inhibition rates were: hsa_circ_0005524 inhibition rate in liver cancer cell line HEPG2 was 60%; hsa_circ_0005524 inhibition rate in liver cancer cell line SMMC-7721 was 60%.
[0098] In conclusion, the present application provides a liver cancer circRNA marker, i.e., hsa_circ_0005524 circular RNA gene. The inventors detected by fluorescent quantitative PCR that the expression amount of the circular RNA gene in the plasma of liver cancer patients is significantly lower than that of healthy people, thus indicating that the circRNA marker can predict the occurrence of liver cancer and can be used as a diagnostic marker for liver cancer. Further, the effect of the liver cancer circRNA marker on cell proliferation was studied by CCK8 experiment, and the results showed that after overexpression of hsa_circ_0005524 in liver cancer cell lines HEPG2 and SMMC-7721, the growth of liver cancer cells was significantly inhibited. The effect of hsa_circ_0005524 on cell migration ability was studied by cell scratch-healing experiment, and the results showed that after overexpression of hsa_circ_0005524 in liver cancer cell lines HEPG2 and SMMC-7721, the cell migration ability was significantly inhibited. Thus, hsa_circ_0005524 can be used as a marker for the diagnosis of liver cancer and as a potential target for the treatment of liver cancer.
[0099] Finally, it should be noted that: the above only describes the preferred embodiments of the present application and is not intended to limit the protection scope of the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.
Claims
1. Use of a reagent for detecting liver cancer circRNA markers in the preparation of a kit for diagnosing liver cancer, characterized in that: The circRNA marker is hsa_circ_0005524; The nucleotide sequence of hsa_circ_0005524 is shown in SEQ ID No.
1.
2. The use according to claim 1, characterized in that The reagent includes a primer set for specifically amplifying the hsa_circ_0005524.
3. The use according to claim 2, characterized in that The primer set for hsa_circ_0005524 includes a forward primer and a reverse primer; The nucleotide sequence of the forward primer is shown in SEQ ID NO.2; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.
3.
4. The use according to claim 1, characterized in that The reagents also include: reverse transcription PCR reagents and fluorescent quantitative PCR reagents.
5. The use according to claim 4, characterized in that The reverse transcription PCR reagents include: 2X RT Mix, RT Enzyme Mix, and RNA-free ddH2O.
6. The use according to claim 4, characterized in that The fluorescent quantitative PCR reagents include: 2X PCR Master Mix and RNA-free ddH2O.