Application of rice osGLN7 protein or substance for regulating expression thereof in regulating plant disease resistance

Abstract

The application discloses application of rice OsGLN7 protein or a substance for regulating expression of the rice OsGLN7 protein in regulation of plant disease resistance, and belongs to the technical field of biotechnology, and particularly relates to application of rice OsGLN7 protein or a substance for regulating expression of the rice OsGLN7 protein in regulation of plant disease resistance. The rice OsGLN7 gene has a function of positively regulating rice resistance to bacterial leaf blight, overexpression of the rice OsGLN7 gene can significantly improve the resistance of rice to bacterial leaf blight, and the disease resistance of a plant with a function loss of the OsGLN7 protein after gene editing is reduced. This shows that the OsGLN7 protein and the gene coding the OsGLN7 protein can be used for improving the disease resistance of plants, and have important significance for cultivation of disease-resistant plants.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of rice OsGLN7 protein or substances that regulate its expression in regulating plant disease resistance. Background Technology

[0002] Rice bacterial blight is a significant bacterial disease in rice cultivation worldwide, causing severe damage in rice-growing areas of South my country and Southeast Asia. In normal years, it can lead to a yield reduction of about 10%, and in severe cases, a reduction of 50%-60%. Breeding resistant varieties using resistance genes is currently the most economical and effective measure for controlling rice bacterial blight. To date, 47 rice bacterial blight resistance genes have been reported domestically and internationally. http: / / www.shigen.nig.ac.jp / rice / oryzabase / gene / list However, disease-resistant genes derived from wild rice are difficult to utilize; some resistance genes only exhibit resistance at the mature stage; and most resistance genes have a narrow spectrum of resistance. Rice bacterial blight pathogens exhibit complex diversity and high variability. Production practices show that after the large-scale promotion and planting of disease-resistant varieties carrying a single major gene, potential virulence races may rise to become dominant races, or new virulence races may emerge due to pathogen mutation, easily leading to the loss of varietal resistance.

[0003] With the development of molecular biology techniques, disease-resistant genes can be introduced into susceptible varieties through hybridization or transgenics to improve plant disease resistance; alternatively, disease-susceptibility genes can be edited to enhance plant disease resistance. Therefore, identifying resistance or susceptibility genes for rice bacterial blight is of great significance for improving rice resistance. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to improve the disease resistance of plants.

[0005] To address the problems existing in the prior art, the present invention provides the application of protein or gene expression substances or substances that regulate the activity or content of said proteins in regulating plant disease resistance.

[0006] The application provided by this invention is the use of proteins or substances that regulate gene expression, or substances that regulate the activity or content of said proteins, in any of the following:

[0007] 1) The application of proteins or substances that regulate gene expression or substances that regulate the activity or content of said proteins in regulating plant disease resistance;

[0008] 2) The application of proteins or substances that regulate gene expression or substances that regulate the activity or content of said proteins in the preparation of products that regulate plant disease resistance;

[0009] 3) The application of proteins or substances that regulate gene expression or substances that regulate the activity or content of said proteins in the cultivation of plants with altered disease resistance;

[0010] 4) The application of proteins or substances that regulate gene expression or substances that regulate the activity or content of said proteins in the preparation of products that cultivate plants with altered disease resistance.

[0011] 5) Application of proteins or substances that regulate gene expression or substances that regulate the activity or content of said proteins in plant breeding.

[0012] The protein may be any of the following proteins:

[0013] (a1) A protein with the amino acid sequence SEQ ID No. 3;

[0014] (a2) A protein having the same function as the amino acid sequence shown in SEQ ID No. 3, by substitution and / or deletion and / or addition of one or more amino acid residues. For example, those skilled in the art can, based on the amino acid sequence shown in SEQ ID No. 3 and conventional techniques such as the conserved substitution of amino acids, obtain a protein mutant with the same function as the amino acid sequence shown in SEQ ID No. 3 by substitution, deletion and / or addition of one or more amino acids without affecting its activity;

[0015] (a3) is a protein that has more than 80% identity with any of the amino acid sequences defined in (a1)-(a2) and has the same function;

[0016] (a4) A fusion protein obtained by attaching a tag to the end of any of the proteins defined in (a1)-(a3).

[0017] The amino acid sequence of the protein described in a2) above may be SEQ ID No. 3.

[0018] The protein described in a1) above is named OsGLN7. The protein described in a2) is an OsGLN7 mutant.

[0019] To facilitate the purification or detection of the protein in a1), a tag protein can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in SEQ ID No. 3 in the sequence listing.

[0020] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0021] The tagged proteins include, but are not limited to: GST (glutathione thiotransferase) tagged protein, His6 tagged protein (His-tag), MBP (maltose-binding protein) tagged protein, Flag tagged protein, SUMO tagged protein, HA tagged protein, Myc tagged protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tagged protein.

[0022] Those skilled in the art can readily mutate the nucleotide sequence encoding the protein OsGLN7 of this invention using known methods, such as directed evolution or point mutation. Artificially modified nucleotides that possess 75% or more of the nucleotide sequence identity with the protein OsGLN7 isolated in this invention, provided they encode and function as protein OsGLN7, are derived from and equivalent to the nucleotide sequence of this invention.

[0023] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0024] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained.

[0025] In this document, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0026] In this document, the 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0027] The protein mentioned in the above applications is derived from rice (Oryza sativa L.).

[0028] In this article, the substance that regulates the activity and / or content of the protein may be a substance that regulates gene expression, wherein the gene encodes the protein OsGLN7.

[0029] In the above text, the substance regulating gene expression can be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcriptional level of the gene; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of translation of the gene; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0030] In this invention, the regulation can be increased, enhanced, or raised. The regulation can also be decreased, weakened, or reduced.

[0031] In the above applications or methods, the substances that enhance, increase, or upregulate the gene expression and the substances that regulate the activity or content of the protein can be biological materials related to the protein, and the biological materials can be any of the following:

[0032] c1) The nucleic acid molecule encoding the OsGLN7 protein mentioned above;

[0033] c2) An expression cassette containing the nucleic acid molecule described in c1);

[0034] c3) A recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2);

[0035] c4) Recombinant microorganisms containing the nucleic acid molecules described in c1), or recombinant microorganisms containing the expression cassette described in c2), or recombinant microorganisms containing the recombinant vector described in c3);

[0036] c5) A transgenic plant cell line containing the nucleic acid molecule described in c1), or a transgenic plant cell line containing the expression cassette described in c2);

[0037] c6) Transgenic plant tissue containing the nucleic acid molecules described in c1), or transgenic plant tissue containing the expression cassette described in c2);

[0038] c7) A transgenic plant organ containing the nucleic acid molecule described in c1), or a transgenic plant organ containing the expression cassette described in c2);

[0039] e1) Nucleic acid molecules that inhibit or reduce the expression of the OsGLN7 protein-encoding gene;

[0040] e2) An expression cassette containing the nucleic acid molecule described in e1);

[0041] e3) A recombinant vector containing the nucleic acid molecule described in e1), or a recombinant vector containing the expression cassette described in e2);

[0042] e4) Recombinant microorganisms containing the nucleic acid molecules described in e1), or recombinant microorganisms containing the expression cassette described in e2), or recombinant microorganisms containing the recombinant vector described in e3);

[0043] e5) A transgenic plant cell line containing the nucleic acid molecule described in e1), or a transgenic plant cell line containing the expression cassette described in e2);

[0044] e6) Transgenic plant tissue containing the nucleic acid molecules described in e1), or transgenic plant tissue containing the expression cassette described in e2);

[0045] e7) A transgenic plant organ containing the nucleic acid molecule described in e1) or a transgenic plant organ containing the expression cassette described in e2).

[0046] In the above-mentioned biological materials, optionally, according to the above-described applications, the nucleic acid molecule in c1) is any of the following DNA molecules:

[0047] d1) The nucleotide sequence is the DNA molecule shown in SEQ ID NO.1;

[0048] d2) The coding region sequence is the DNA molecule shown in SEQ ID NO.2 of the sequence listing;

[0049] d3) has 90% or more identity with the nucleotide sequence defined by d1) or d2) and is derived from rice and encodes the above-mentioned OsGLN7 protein.

[0050] d4) Hybridizes under strict conditions to the nucleotide sequence defined by d1) or d2) and the DNA molecule encoding the OsGLN7 protein described above.

[0051] Optionally, c3) the recombinant vector is a plasmid having the DNA molecule shown in SEQ ID No. 1 or SEQ ID No. 2, such as pMDC43-OsGLN7 prepared in the following examples.

[0052] The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0053] Optionally, according to the above application, the nucleic acid molecule of e1) is an sgRNA or its encoding gene for editing the plant OsGLN7 gene using CRISPR / Cas9. The target sequence of the sgRNA may be as shown in SEQ ID No. 4. The encoding gene of the sgRNA may be as shown in SEQ ID No. 6.

[0054] The aforementioned sgRNA can work in conjunction with CRISRP / Cas9 gene editing tools to achieve efficient site-specific knockout of the rice OsGLN7 gene, thereby disrupting the biological function of the rice OsGLN7 gene.

[0055] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, they may be vector pGWC or vector pMDC43.

[0056] Recombinant expression vectors containing the OsGLN7 gene can be constructed using existing plant expression vectors. These plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors suitable for plant microbombardment. The plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylate signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3' end of genes including, but not limited to, Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the Nos gene for lipase) and plant genes (such as the soybean storage protein gene).

[0057] When constructing recombinant plant expression vectors using the OsGLN7 gene, any enhancing or constitutive promoter can be added before its transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. These can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the gene of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0058] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0059] By using any vector capable of guiding the expression of exogenous genes in plants, the OsGLN7 gene or gene fragments provided in this invention can be introduced into plant cells or recipient plants to obtain transgenic cell lines and transgenic plants with altered disease resistance. The expression vector carrying the OsGLN7 gene can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants.

[0060] Optionally, the expression cassette described in e2) is an expression cassette having the DNA molecule shown in SEQ ID No. 6, for example, the expression cassette sequence is shown in SEQ ID No. 5.

[0061] Optionally, the recombinant vector described in e3) is a recombinant vector having the DNA molecule shown in SEQ ID No. 6, such as the CRISPR / Cas9-OsGLN7 prepared in the following examples.

[0062] Optionally, according to the above application, the disease resistance refers to the plant's resistance to bacterial blight.

[0063] The above-mentioned regulation of plant disease resistance can increase / decrease plant disease resistance, for example, by shortening / increasing the length of lesions caused by rice bacterial blight.

[0064] This invention also provides a method for improving plant disease resistance.

[0065] The method for improving plant disease resistance provided by the present invention can enhance plant disease resistance by increasing and / or increasing the expression level of the coding gene of the protein described above in the target plant, or / and increasing and / or increasing the activity and / or content of the coding gene of the protein described above.

[0066] The present invention also provides a method for reducing plant disease resistance, wherein the method may be to inhibit or reduce or silence the activity and / or content of the protein in the target plant, or / and, inhibit or reduce or silence the expression level of the gene encoding the protein, thereby reducing plant disease resistance.

[0067] In the above method, reducing the expression level and / or activity of the gene encoding the protein OsGLN7 in the target plant can be achieved by using gene mutation, gene knockout, gene editing, or gene knockdown techniques to reduce or inactivate the gene encoding the protein OsGLN7 in the genome of the target plant.

[0068] This invention also provides a method for cultivating disease-resistant plants.

[0069] The method for cultivating disease-resistant plants provided by the present invention includes increasing and / or increasing the expression of the coding gene of the above-mentioned protein and / or the content and / or activity of the above-mentioned protein in the starting plant, or / and increasing and / or increasing the activity and / or content of the coding gene of the above-mentioned protein, to obtain a disease-resistant plant.

[0070] In the above cultivation method, the enhancement, increase, or upregulation of the activity and / or content of the protein in the target plant, and / or the expression level of the gene encoding the protein, can be achieved by introducing the OsGLN7 gene into the recipient plant, resulting in a target plant with higher disease resistance than the recipient plant. The OsGLN7 gene encodes the OsGLN7 protein.

[0071] In one embodiment of the present invention, the method for cultivating disease-resistant plants includes the following steps:

[0072] (1) Construct a recombinant expression vector containing the DNA molecule shown in SEQ ID NO.1 or containing the DNA encoding the OsGLN7 gene as shown in SEQ ID NO.2;

[0073] (2) The recombinant expression vector constructed in step (1) is transferred into the recipient plant (such as crop or rice);

[0074] (3) Disease-resistant plants with higher disease resistance than the recipient plants were obtained through screening and identification.

[0075] This invention also provides a method for cultivating susceptible plants.

[0076] The method for cultivating susceptible plants provided by the present invention includes reducing and / or inhibiting the expression of the coding gene of the above-mentioned protein and / or the content and / or activity of the above-mentioned protein in the starting plant, or / and reducing and / or inhibiting the activity and / or content of the coding gene of the above-mentioned protein, to obtain a susceptible plant.

[0077] As one embodiment of the present invention, the method for cultivating susceptible plants includes the following steps: introducing a CRISPR-Cas9 system containing sgRNA that targets the OsGLN7 encoding gene into plants to obtain plants with reduced resistance to bacterial blight.

[0078] The implementation scheme includes replacing “CCTGACCTCACAGCTGGATATCGG” in OsGLN7 of the plant genomic DNA with “CCTGACCTCACAGCTGGTATCGG” or “CCTGACCTCACAGCTGGTTATCGG” to obtain plants with reduced resistance to bacterial blight.

[0079] The replacement can be a homozygous replacement, meaning that the same replacement occurs in homologous chromosomes.

[0080] In this document, the introduction can be described as transforming a vector carrying the DNA molecule of the present invention into a host bacterium using any known transformation method, such as chemical transformation or electroporation. The introduced DNA molecule can be a single copy or multiple copies. The introduction can be the integration of a foreign gene into the host chromosome or the expression of a plasmid outside the chromosome.

[0081] In this invention, the purpose of plant breeding may include cultivating disease-resistant plants. The plants described herein may be any of the following: N1) monocotyledonous or dicotyledonous plants; N2) grasses; N3) oregano; N4) rice.

[0082] The aforementioned OsGLN7 protein, its biological materials, and the substances that regulate the expression of the OsGLN7 protein encoding gene may also fall within the scope of protection of this invention.

[0083] This invention cloned the OsGLN7 gene and, through transgenic overexpression of this gene, significantly improved the resistance of rice to bacterial blight. This invention also knocked out the OsGLN7 protein-coding gene, significantly reducing the resistance of rice to bacterial blight.

[0084] This invention discovers that the rice OsGLN7 gene positively regulates rice resistance to bacterial blight. Overexpression of the OsGLN7 gene in rice significantly enhances rice resistance to bacterial blight; conversely, gene editing to disrupt the biological function of the OsGLN7 gene reduces rice resistance to bacterial blight. The OsGLN7 gene can be used to improve rice resistance to bacterial blight, which is of great significance for breeding new rice varieties resistant to bacterial blight. Attached Figure Description

[0085] Figure 1 The PCR identification results of the OsGLN7 gene overexpression transgenic lines in Example 4 of this invention; wherein, M is the DNA molecular weight standard (DL2000+DNA marker), V is the positive control, CK is the negative control, and OE1-OE3 are OsGLN7 overexpression transgenic lines.

[0086] Figure 2The results show the relative expression levels of the OsGLN7 gene overexpressing transgenic lines in Example 4 of this invention.

[0087] Figure 3 This is a sequencing peak diagram of the OsGLN7 gene-edited lines KO1 and KO2 in Example 4 of this invention.

[0088] Figure 4 This is a comparison of the nucleotide sequences of the OsGLN7 gene-edited lines KO1 and KO2 with those of Nipponbare in Example 4 of this invention.

[0089] Figure 5 The length of lesions in the transgenic lines overexpressing the Nipponbare (Nip) and OsGLN7 genes in Example 5 of this invention.

[0090] Figure 6 The length of lesions in the Nipponbare (Nip) and OsGLN7 gene-edited lines in Example 5 of this invention. Detailed Implementation

[0091] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0092] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0093] In the quantitative experiments in the following examples, three replicate experiments were set up, and the average value of the results was taken.

[0094] In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5' terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA.

[0095] Vector pGWC: from BioVector NTCC Typical Culture Collection Center.

[0096] Vector pMDC43: from BioVector NTCC Typical Culture Collection.

[0097] Agrobacterium tumefaciens EHA105: from BioVector NTCC Type Culture Collection.

[0098] The pYLsgRNA-OsU6a vector and the pYLCRISPR / Cas9Pubi-H vector have been described in Ma X, Zhang Q, Zhu Q. et al. A Robust CRISPR / Cas9 System for Convenient, High-Efficiency MultiplexGenome Editing in Monocot and Dicot Plants, Mol Plant. 2015, 8(8):1274-1284. With the consent of Professor Liu Yaoguang of South China Agricultural University, the public may obtain the biological materials from the applicant. The biological materials are only for repeating the relevant experiments of this invention and may not be used for other purposes.

[0099] The bacterial blight pathogen strain GIV is described in the article “Fang Zhongda, Xu Zhigang, Guo Chongjian, Yin Shangzhi, Wu Shangzhong, Xu Xianming, Zhang Qi. Study on pathogenicity of bacterial blight pathogen in rice in China. Acta Phytopathologica Sinica, 1990, 20(2): 81-88”, which can be obtained by the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0100] The biological material of the rice variety Nipponbare (Wang W, Mauleon R, Hu Z, et al. Genomic variation in 3010 diverse accessions of Asian cultivated rice, Nature, 2018, 557(7703):43-49.) is available to the public from the applicant. This biological material is only for the purpose of repeating the relevant experiments of this invention and may not be used for any other purpose.

[0101] LOC_Os07g35560 encodes a precursor of an endonuclease β-1,3-glucanase, named OsGLN7. The genomic sequence is shown in SEQ ID No. 1, the coding region sequence is shown in SEQ ID No. 2, and the encoded protein sequence is shown in SEQ ID No. 3.

[0102] Example 1: Cloning of the rice OsGLN7 gene

[0103] 1. Obtaining the coding region sequence of the rice OsGLN7 gene

[0104] Total RNA was extracted from leaves of the rice variety Nipponbare, and cDNA was synthesized using FastKing gDNA Dispelling RTSuperMix (Code: KR118, TIANGEN). Using this cDNA as a template, PCR amplification was performed using primers OsGLN7-CDS-F: 5'-ATGGCGCTCGCTCTCGCT-3' and OsGLN7-CDS-R: 5'-TCAAGAGTTGTTTGGTGA-3', and PrimeSTARGXL DNA Polymerase (Code: R050A, Takara) was used to obtain the amplified product, which is the coding region sequence of the OsGLN7 gene, as shown in SEQ ID NO.2.

[0105] Example 2: Construction of expression vector and gene editing vector for rice disease resistance gene OsGLN7

[0106] 1. Construction of the OsGLN7 gene expression vector

[0107] The CDS sequence of the OsGLN7 gene from Nipponbare was constructed into the expression vector pMDC43 using the Gateway system, resulting in the expression vector pMDC43-OsGLN7 containing the OsGLN7 gene. The steps are as follows:

[0108] (1) Total RNA was extracted from the rice variety Nipponbare and reverse transcribed to obtain cDNA. Using the cDNA as a template, PCR amplification was performed using forward primers OsGLN7-CDS-F: 5'-ATGGCGCTCGCTCTCGCT-3' (SEQ ID No. 7) and OsGLN7-CDS-R: 5'-TCAAGAGTTGTTTGGTGA-3' (SEQ ID No. 8) to obtain the amplified product (i.e., the CDS sequence of OsGLN7, SEQ ID NO. 2), which was then recovered by gel excision.

[0109] (2) The gel extraction product obtained in step (1) was subjected to A treatment. Specifically, 20 μL of the extracted product was mixed with 20 μL of PCR SuperMix (Code: AS111-11, TRANSGEN BIOTECH) and a PCR reaction was performed. The reaction program was: 95℃ for 5 min, 72℃ for 20 min, and stored at 4℃. Subsequently, the PCR product was purified and recovered using a standard DNA product purification kit (Code: DP204-02, TIANGEN).

[0110] (3) The recovered product obtained in step (2) is TA cloned and ligated with the vector backbone obtained by digesting the entry vector pGWC with Eam1105 to obtain a recombinant vector with the correct sequence containing the DNA fragment shown in SEQ ID NO.2, which is named positive entry cloning plasmid pGWC-OsGLN7.

[0111] (4) The positive introductory cloning plasmid pGWC-OsGLN7 obtained in step (3) is subjected to LR reaction with the target vector pMDC43 to obtain a recombinant vector containing the DNA fragment shown in SEQ ID NO.2, named pMDC43-OsGLN7.

[0112] LR reaction system: pGWC-OsGLN7 1μL (50-100ng), support pMDC43 1μL (50-100ng), LRenzymemix 0.5μL.

[0113] LR reaction conditions: Incubation at 25℃ for 6 h, transformation of E. coli DH5α, screening for positive clones to obtain the correct expression vector pMDC43-OsGLN7 containing the OsGLN7 gene. pMDC43-OsGLN7 contains the OsGLN7 gene CDS sequence shown in SEQ ID NO.2 and the 35S promoter, and can express the OsGLN7 protein fusion protein with GFP shown in SEQ ID NO.3. The expression of this protein is driven by the 35S promoter.

[0114] 2. Construction of the OsGLN7 gene knockout vector

[0115] Construct a recombinant vector for editing the OsGLN7 gene using the CRISPR / Cas9 method.

[0116] Target sequence: CCTGACCTCACAGCTGGTAT (positions 590-609 of SEQ ID NO.1 in the sequence listing, i.e. SEQ ID NO.4);

[0117] The steps for constructing the sgRNA expression cassette are as follows:

[0118] 1) Using the pYLsgRNA-OsU6a vector as a template, PCR amplification was performed using primers UF (5'-CTCCGTTTTACCTGTGGAATCG-3'(SEQ ID No.9)) and U6a-OsGLN7-R (5'-ATACCAGCTGTGAGGTCAGCGGCAGCCAAGCCAGCA-3'(SEQ ID No.10)). The DNA fragment with the correct sequence was named U6a-OsGLN7.

[0119] 2) Using the pYLsgRNA-OsU6a vector as a template, PCR amplification was performed using primers gR-OsGLN7-F (5'-GCCTGACCTCACAGCTGGTATGTTTTAGAGCTAGAAAT-3'(SEQ ID No.11)) and gR-R (5'-CGGAGGAAAATTCCATCCAC-3'(SEQ ID No.12)). The DNA fragment with the correct sequence was named sgRNA-OsGLN7.

[0120] 3) U6a-OsGLN7 and sgRNA-OsGLN7 were ligated together using overlapping PCR. Subsequently, PCR amplification was performed using Pps-GGL (5'-TTCAGAGGTCTCTCTCGACTAGTATGGAATCGGCAGCAAAGG-3'(SEQ ID No. 13)) and Pgs-GGR (5'-AGCGTGGGTCTCGACCGACGCGTATCCATCCACTCCAAGCTC-3'(SEQ ID No. 14)) with an infusion adapter. The correctly sequenced DNA fragment was named U6a-sgRNA-OsGLN7, which is the sgRNA expression cassette. The sequence of U6a-sgRNA-OsGLN7 is SEQ ID NO. 5 in the sequence listing. Positions 44-490 of SEQ ID NO. 5 are the U6a promoter, and positions 491-593 are the coding sequence for sgRNA. U6a-sgRNA-OsGLN7 can encode sgRNA, and the coding sequence of sgRNA is SEQ ID NO.6 in the sequence listing.

[0121] Construction of the recombinant vector CRISPR / Cas9-OsGLN7:

[0122] The above-mentioned U6a-sgRNA-OsGLN7 was ligated with the vector backbone obtained by BsaI digestion of the pYLCRISPR / Cas9Pubi-H vector to undergo homologous recombination ligation reaction to obtain the OsGLN7 gene knockout vector CRISPR / Cas9-OsGLN7.

[0123] Homologous recombination reaction system: U6a-sgRNA-OsGLN7 (10-15 ng), pYLCRISPR / Cas9Pubi-H vector digested with BsaI (60-80 ng), 1.5 μL of 10×CutSmart Buffer, 1.5 μL of 10 mM ATP, 10 U of BsaI-HF, 35 U of T4 DNA ligase, and ddH2O added to make up to 15 μL.

[0124] The enzyme digestion-ligation reaction program was as follows: 37℃ for 10 min, 10℃ for 5 min, 20℃ for 5 min, for 3 cycles; then 37℃ for 3 min, 10℃ for 5 min, 20℃ for 5 min, for 10 cycles. The reaction system was transformed into *E. coli* DH5α, and positive clones were screened. The recombinant vector with the correct sequence was named CRISPR / Cas9-OsGLN7. CRISPR / Cas9-OsGLN7 contains an sgRNA expression cassette and can express sgRNA and Cas9.

[0125] Example 3: Obtaining Transgenic Rice

[0126] Transgenic rice was prepared using pMDC43-OsGLN7 and CRISPR / Cas9-OsGLN7 from Example 2, respectively. Nipponbare rice was used as the recipient plant for transgenic rice preparation, and the Nipponbare variety showed moderate resistance to the Chinese bacterial blight strain GIV. The specific steps are as follows:

[0127] (1) Take out the mature seeds of the plant, remove the shells, and select plump, clean seeds without sterile spots for disinfection.

[0128] (2) Inoculate the sterilized seeds onto the induction medium and culture them in the dark at 28°C for about 14 days. Select callus tissue with good appearance and good growth.

[0129] (3) The recombinant vector pMDC43-OsGLN7 constructed in Example 2 was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant bacteria, named EHA105 / pMDC43-OsGLN7. The recombinant vector CRISPR / Cas9-OsGLN7 was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant bacteria, named EHA105 / CRISPR / Cas9-OsGLN7.

[0130] (4) Take the recombinant bacteria EHA105 / pMDC43-OsGLN7 and EHA105 / CRISPR / Cas9-OsGLN7 obtained in step (3), resuspend the bacteria in the infection medium to obtain EHA105 / pMDC43-OsGLN7 and EHA105 / CRISPR / Cas9-OsGLN7 bacterial suspensions.

[0131] (5) Immerse the Nipponbare callus tissue from step (2) in the bacterial suspension prepared in step (4) for 20 min. After infection, discard the bacterial suspension, take the callus tissue, blot dry with sterile filter paper, and then place it on a co-culture medium and incubate in the dark at 28°C for 50-55 h.

[0132] (6) After completing step (5), select callus tissues without obvious Agrobacterium on the surface and transfer them to antibacterial culture medium and incubate in the dark at 28°C for 3-4 days.

[0133] (7) After completing step (6), the callus tissue is transferred to the screening medium and cultured in the dark at 28°C for 30 days, and subcultured every 10 days.

[0134] (8) After completing step (7), take fresh hygromycin-resistant callus tissue, inoculate it into pre-regeneration medium, and culture it in the dark at 28°C for 7 days. Then place it in a light culture room (12h light / 12h dark) and continue to culture for 7 days. Then transfer it to regeneration medium and continue to culture in the light until regenerated plants grow, and obtain transgenic plants.

[0135] The transgenic plants obtained using the recombinant vector pMDC43-OsGLN7 are designated as OsGLN7 transgenic plants.

[0136] The transgenic plants obtained using the recombinant vector CRISPR / Cas9-OsGLN7 are designated as OsGLN7 gene knockout plants.

[0137] Culture media and formulations used for genetic transformation:

[0138] Induction medium: CaCl2·2H2O 440mg, KH2PO4 170mg, MgSO4·7H2O 370mg, NH4NO3 1650mg, KNO3 1900mg, KI 0.83mg, CoCl2·6H2O 0.025mg, H3BO3 6.2mg, Na2MoO4·2H2O 0.25mg, MnSO4·4H2O 22.3mg, CuSO4·5H2O 0.025mg, ZnSO4·7H2O 8.6mg, Na2-EDTA·2H2O 37.3mg, FeSO4·7H2O 27.8mg, VB1 0.1mg, VB6 0.5mg, nicotinic acid 0.5mg, inositol 100mg, glycine 2mg, 2,4-D 2mg, hydrolyzed casein 2g, maltose 30g, agar 3g, deionized water to 1L.

[0139] Infection medium: For preparation method, please refer to the reference: Hiei Y, Ohta S, Komari T, et al. Efficient transformation of rice (Oryza sativa, L.) mediated by Agrobacterium, and sequence analysis of the boundaries of the T-DNA[J]. Plant Journal, 1994, 6(2): 271-282. Replace the concentration of acetylsylcholine in the reference with 200 μM.

[0140] Co-culture medium: Acetyleugenol and glucose were added to the induction medium to make the final concentration of acetyleugenol in the medium 200 μM and the final concentration of glucose in the medium 10 g / L.

[0141] Antibacterial medium: Add cephalosporin to the induction medium to make the final concentration of cephalosporin in the medium 500 mg / L.

[0142] Screening medium: Hygromycin and cephalosporin were added to the induction medium to make the final concentration of hygromycin in the medium 65 mg / L and the final concentration of cephalosporin in the medium 500 mg / L.

[0143] Pre-regeneration medium: CaCl2·2H2O 440mg, KH2PO4 170mg, MgSO4·7H2O 370mg, NH4NO3 1650mg, KNO3 1900mg, KI 0.83mg, CoCl2·6H2O 0.025mg, H3BO3 6.2mg, Na2MoO4·2H2O 0.25mg, MnSO4·4H2O 22.3mg, CuSO4·5H2O 0.025mg, ZnSO4·7H2O 8.6mg, Na2-EDTA·2H2O 37.3mg, FeSO4·7H2O 27.8mg, VB1 0.1mg, VB6 0.5 mg of nicotinic acid, 0.5 mg of inositol, 100 mg of glycine, 2 mg of hydrolyzed casein, 2 g of maltose, 30 g of agar, 3 g of kinetin, 2 mg of naphthaleneacetic acid, and deionized water to a final volume of 1 L; add hygromycin to a concentration of 50 mg / L before pouring the agar plates.

[0144] Regeneration medium: CaCl2·2H2O 440mg, KH2PO4 170mg, MgSO4·7H2O 370mg, NH4NO3 1650mg, KNO3 1900mg, KI 0.83mg, CoCl2·6H2O 0.025mg, H3BO3 6.2mg, Na2MoO4·2H2O 0.25mg, MnSO4·4H2O 22.3mg, CuSO4·5H2O 0.025mg, ZnSO4·7H2O 8.6mg, Na2-EDTA·2H2O 37.3mg, FeSO4·7H2O 27.8mg, VB1 0.1mg, VB6 0.5 mg of nicotinic acid, 0.5 mg of inositol, 100 mg of glycine, 2 mg of hydrolyzed casein, 30 g of maltose, 6 g of agar, 2 mg of kinetin, 1 mg of naphthaleneacetic acid, and deionized water to 1 L; add hygromycin to a concentration of 50 mg / L before pouring the plates.

[0145] Example 4: Identification of genetically modified rice

[0146] 1. Screening and identification of transgenic plants overexpressing OsGLN7

[0147] The plants to be tested were Nipponbare (CK) and the OsGLN7 overexpressing transgenic plants obtained in Example 3.

[0148] Genomic DNA was extracted from the plants to be tested. Using the genomic DNA as a template, PCR amplification was performed using a primer pair consisting of pMDC43-TF (5'-AGACAACCATTACCTGTCC-3'(SEQ ID No.15)) and OsGLN7-R2 (5'-CCCAACTGAGCGCACTATTG-3'(SEQ ID No.16)). The pMDC43-OsGLN7 plasmid was used as a positive control, and the recipient variety Nipponbare was used as a negative control.

[0149] PCR amplification products were subjected to 1% agarose gel electrophoresis. Both the positive control (V) and positive OsGLN7 overexpressing transgenic plants showed a 566 bp band, while the negative control (CK) did not amplify any band. Electrophoresis images of some samples are shown below. Figure 1 Three positive OsGLN7 overexpressing transgenic lines were selected and designated as OE1, OE2, and OE3, respectively.

[0150] 2. Identification of transgenic rice overexpression at the RNA level

[0151] Total RNA was extracted from OsGLN7 overexpressing transgenic lines (OE1, OE2, OE3) and wild-type Nipponbare, and reverse transcribed. The expression of the OsGLN7 gene at the RNA level was detected by qRT-PCR using primers OsGLN7-qF: 5'-CTACAAAAGCAAGTTGGTGTGT-3' (SEQ ID No. 17) and OsGLN7-qR: 5'-AGTCATTAAACGCGTAAGATGC-3' (SEQ ID No. 18). The internal reference gene was detected using primers Actin-F: 5'-GACTCTGGTGATGGTGTCAGC-3' (SEQ ID No. 19) and Actin-R: 5'-GGCTGGAAGAGGACCTCAGG-3' (SEQ ID No. 20).

[0152] The results are as follows Figure 2 As shown, the expression level of the OsGLN7 gene in OE1, OE2, and OE3 was significantly upregulated compared to the wild-type Nipponbare (Nip), with the expression level being more than 5 times that of the wild type.

[0153] 3. Identification of OsGLN7 gene knockout plants

[0154] The plants to be tested were the recipient variety Nipponbare (Nip) and the OsGLN7 gene knockout plants obtained in Example 3.

[0155] Genomic DNA was extracted from the plants to be tested. Using the genomic DNA as a template, PCR amplification was performed using OsGLN7-TF (5'-CTGATAGATCCACCGTCCGT-3'(SEQ ID No.21)) and OsGLN7-TR (5'-TCACGAGAGATTTGGCCATT-3'(SEQ ID No.22)) as primers. The recipient variety Nipponbare was used as a negative control.

[0156] The obtained PCR amplification products were subjected to 1% agarose gel electrophoresis, and the negative control showed a 522bp band.

[0157] The PCR amplification products were sequenced. The PCR amplification product sequences of the OsGLN7 gene knockout plants were compared with the negative control. In the knockout line KO1, nucleotide A was inserted at position 607 of SEQ ID No. 1 in the sequence listing, and in the knockout line KO2, nucleotide T was inserted at position 607 of SEQ ID No. 1 in the sequence listing. The other sequences of the OsGLN7 gene remained unchanged. The sequencing peak diagram of the knockout lines is shown below. Figure 3 As shown, the sequence changes are as follows: Figure 4 As shown.

[0158] Example 5: Identification of resistance to bacterial blight in transgenic lines

[0159] The plants to be tested were: Nipponbare (Nip), positive OsGLN7 overexpressing transgenic lines OE1, OE2, and OE3, and positive OsGLN7 knockout lines KO1 and KO2.

[0160] 1. After cultivating each plant in the greenhouse for about 25 days, transplant them to the net house for planting. Plant them individually, with 20 plants per net house.

[0161] 2. During the peak tillering stage of the rice plants in step 1, inoculate them with the Chinese bacterial blight pathogen strain GIV. Artificial inoculation is performed using the leaf-cutting method, inoculating each rice plant with 5 leaves (bacterial concentration 1×10⁻⁶). 9 The inoculation volume for each leaf was equal, 40 μL (cfu / mL).

[0162] 3. About 14 days after inoculation, measure the length of lesions on the leaves of each plant. There is one lesion along the vein of each leaf. Measure the length of lesions on 3 inoculated leaves of each plant and calculate the average value.

[0163] Statistical results are as follows Figure 5 and Figure 6 As shown in the figure, the lesion length of Nipponbare (Nip) was 7.1 cm. The lesion lengths of the positive OsGLN7 overexpressing transgenic lines OE1, OE2, and OE3 were 5.6 cm, 5.3 cm, and 5.0 cm, respectively, all significantly shorter than the lesion length of Nipponbare (Nip), indicating that the OsGLN7 gene can improve the resistance of rice to bacterial blight. The lesion lengths of the positive OsGLN7 gene knockout lines KO1 and KO2 were 15.4 cm and 15.7 cm, respectively, significantly longer than the lesion length of Nipponbare (Nip), indicating that knocking out the coding region of the OsGLN7 gene can reduce the resistance of rice to bacterial blight.

[0164] The above results indicate that the OsGLN7 gene can positively regulate rice resistance to bacterial blight.

[0165] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. The use of a substance that enhances, increases, or upregulates the expression of a protein-coding gene, or a substance that enhances, increases, or upregulates the content of said protein, in any of the following: 1) Application in improving plant resistance to bacterial leaf blight; 2) Application in the preparation of products that enhance plant resistance to bacterial blight; 3) Application in cultivating plants resistant to bacterial blight; 4) Application in the preparation of products containing plants resistant to bacterial blight; The protein in question is the protein with the amino acid sequence SEQ ID No. 3; The plant in question is rice; The substance is any one of the following: c1) The nucleic acid molecule encoding the protein; c2) An expression cassette containing the nucleic acid molecule described in c1); c3) A recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) Recombinant microorganisms containing the nucleic acid molecules described in c1), or recombinant microorganisms containing the expression cassette described in c2), or recombinant microorganisms containing the recombinant vector described in c3); c5) A transgenic plant cell line containing the nucleic acid molecule described in c1), or a transgenic plant cell line containing the expression cassette described in c2); c6) Transgenic plant tissue containing the nucleic acid molecules described in c1), or transgenic plant tissue containing the expression cassette described in c2); c7) A transgenic plant organ containing the nucleic acid molecule described in c1), or a transgenic plant organ containing the expression cassette described in c2).

2. The application according to claim 1, characterized in that: c1) The nucleic acid molecule is a DNA molecule whose nucleotide sequence is shown in SEQ ID NO.

1.

3. The use of the substance that knocks out the protein-coding gene as described in claim 1 in any of the following: 1) Application in reducing plant resistance to bacterial blight; 2) Application in the preparation of products that reduce plant resistance to bacterial blight; 3) Application in the cultivation of plants susceptible to bacterial blight; 4) Application in the preparation of products containing plants susceptible to bacterial blight; The plant in question is rice; The substance is any one of the following: e1) Knock out the nucleic acid molecule of the protein-coding gene described in claim 1; e2) An expression cassette containing the nucleic acid molecule described in e1); e3) A recombinant vector containing the nucleic acid molecule described in e1), or a recombinant vector containing the expression cassette described in e2); e4) Recombinant microorganisms containing the nucleic acid molecules described in e1), or recombinant microorganisms containing the expression cassette described in e2), or recombinant microorganisms containing the recombinant vector described in e3); e5) A transgenic plant cell line containing the nucleic acid molecule described in e1), or a transgenic plant cell line containing the expression cassette described in e2); e6) Transgenic plant tissue containing the nucleic acid molecules described in e1), or transgenic plant tissue containing the expression cassette described in e2); e7) A transgenic plant organ containing the nucleic acid molecule described in e1) or a transgenic plant organ containing the expression cassette described in e2).

4. The application according to claim 3, characterized in that: The nucleic acid molecule mentioned in e1) is the sgRNA of the plant OsGLN7 gene edited using CRISPR / Cas9 or the gene encoding the sgRNA.

5. A method for improving plant disease resistance, characterized in that: The method is to enhance, increase, or upregulate the activity and / or content of the protein described in claim 1 or 2 in the target plant, or / and to enhance, increase, or upregulate the expression level of the gene encoding the protein described in claim 1 or 2, so as to improve the plant's disease resistance; the disease resistance is resistance to bacterial blight; the plant is rice.

6. A method for reducing plant disease resistance, characterized in that: The method involves knocking out the gene encoding the protein described in claim 1 to reduce plant disease resistance; the disease resistance is resistance to bacterial blight, and the plant is rice.

7. A breeding method for cultivating disease-resistant rice, characterized in that, Includes the following steps: (1) Construct a recombinant expression vector containing the coding gene of the protein described in claim 1; (2) The recombinant expression vector constructed in step (1) is transferred into the recipient rice to obtain a disease-resistant plant with higher disease resistance than the recipient plant; The disease resistance mentioned refers to resistance to bacterial blight.

Images