Application of watermelon ClmiR159-3P and its precursor gene

Abstract

The invention discloses the application of watermelon ClmiR159‑3P and its precursor gene. It belongs to the field of molecular biology technology. The nucleotide sequence of watermelon ClmiR159‑3P is shown in SEQ ID NO.1. The nucleotide sequence of ClMIR159, the precursor of watermelon ClmiR159‑3P, is shown in SEQ ID NO.2. Using the watermelon ClmiR159‑3p precursor gene ClMIR159 to construct overexpression ClMIR159 plant materials can effectively increase the expression amount of plant CBFs genes and improve plant cold tolerance.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and particularly relates to application of watermelon ClmiR159-3P and a precursor gene thereof in improving plant cold tolerance. Background Art

[0002] Watermelon is native to tropical Africa, prefers high temperature and dry environment, and cannot tolerate low temperature. Low temperature in winter and spring not only increases the economic cost of watermelon cultivation due to energy input, but also easily leads to a decrease in photosynthesis rate, stunted root growth, and even plant death, thus affecting yield and quality.

[0003] During the long evolution process, plants have formed adaptation or resistance regulatory mechanisms to various adverse conditions, thus completing their growth and development process under low temperature adverse conditions. For example, after sensing low temperature, plants activate a cold adaptation process with CBF-dependent (C-repeatbinding transcription factor) and non-CBF-dependent regulatory pathways. The CBF-dependent regulatory pathway has been studied more deeply, which is the transcriptional regulatory cascade mediated by C-repeat (CRT) binding factor / dehydration-responsive element (DRE) binding factor (CBF / DREB), which is crucial for inducing a series of cold-responsive genes (COR). In this pathway, CBFs / DREBs are rapidly induced by low temperature, and CBFs / DREBs can bind to the CRT / DRE cis-elements in the promoter region of COR genes and activate their transcription. As a CBF transcription activator that has been studied more clearly, ICE1 (MYC-type bHLH transcription factor) can directly bind to the promoter of CBF genes and activate their expression under low temperature. SUMOE3 ligase SIZ1 and ubiquitin E3 ligase HOS1 can change the SUMOylation and ubiquitination of ICE1 and affect the stability and activity of ICE1 protein. Low temperature can also activate SnRK2.6 / OST1. Activated SnRK2.6 modifies ICE1 by phosphorylation, thereby breaking the interaction between ICE1 and HOS1, inhibiting ICE1 degradation, and activating downstream CBF-COR gene expression. However, in the long-term artificial domestication process for the purpose of pursuing yield and quality, the functions of stress resistance genes in many cultivated varieties are missing or weakened, resulting in reduced resistance. Therefore, exploring cold-resistant genes and verifying their functions are of great significance for the breeding of new cold-resistant plant varieties. Summary of the invention

[0004] In view of this, the present invention provides the application of watermelon ClmiR159-3p and its precursor gene ClMIR159 in regulating plant CBFs gene expression and low temperature resistance. The cold tolerance of plants can be effectively regulated by cloning the watermelon ClmiR159-3p precursor gene ClMIR159 and constructing plant materials overexpressing ClMIR159 using transgenic technology.

[0005] In order to achieve the above object, the present invention adopts the following technical solution:

[0006] Watermelon ClmiR159-3P, the nucleotide sequence is shown in SEQ ID NO.1.

[0007] The nucleotide sequence of ClMIR159, the precursor of watermelon ClmiR159-3P, is shown in SEQ ID NO.2.

[0008] Furthermore, a recombinant vector or recombinant bacteria carrying ClMIR159 is constructed.

[0009] Watermelon ClmiR159-3p or ClMIR159 or the above-mentioned recombinant vector or the above-mentioned recombinant bacteria can be used to increase the expression of plant CBFs genes.

[0010] Furthermore, the expression of plant CBFs genes was increased by overexpressing watermelon ClmiR159-3p or ClMIR159.

[0011] Watermelon ClmiR159-3p or ClMIR159 or the above-mentioned recombinant vector or the above-mentioned recombinant bacteria can be used to improve the plant's low temperature resistance.

[0012] Furthermore, plant cold resistance was improved by overexpressing watermelon ClmiR159-3p or ClMIR159.

[0013] Watermelon ClmiR159-3p or ClMIR159 or the above-mentioned recombinant vector or the above-mentioned recombinant bacteria can be used for molecular breeding.

[0014] Using target gene prediction, degradation group sequencing and qRT-PCR technology, the target genes of ClmiR159-3p were identified as Cla97C08G151350 (MYB33) and Cla97C11G224710 (SPOROCYTELESS-like).

[0015] Through the above technical scheme, it can be known that compared with the prior art, the present invention discloses the use of watermelon ClmiR159-3p and its precursor gene ClMIR159 in regulating plant low temperature resistance. By genetic means, Arabidopsis heterologous overexpression ClMIR159 materials are constructed, and the expression level of ClmiR159-3p is regulated. It is found that ClMIR159 overexpression can increase plant CBFs gene expression and improve plant low temperature resistance. Using target gene prediction combined with degradation group sequencing and qRT-PCR technology, the target genes of ClmiR159-3p are identified as Cla97C08G151350 (MYB33) and Cla97C11G224710 (SPOROCYTELESS-like). The ClmiR159-3p / ClMIR159 provided by the present invention provides genetic resources for creating cold-resistant plant germplasm and cultivating new cold-resistant varieties, and has good potential application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 To identify the cold resistance of two different watermelon grafting materials of the present invention;

[0017] Figure 2 The qRT-PCR detection results of ClmiR159-3p in the cold-tolerant and cold-intolerant watermelon materials under low temperature stress of the present invention;

[0018] Figure 3 This is the semi-quantitative PCR detection result of ClMIR159 in heterologous overexpression of Arabidopsis thaliana of the present invention;

[0019] Figure 4 To identify the low temperature resistance of the Arabidopsis plants heterologously overexpressing ClMIR159 of the present invention;

[0020] Figure 5 The qRT-PCR detection results of the CBFs gene in Arabidopsis thaliana heterologously overexpressed by ClMIR159 of the present invention;

[0021] Figure 6 These are the qRT-PCR detection results of ClmiR159-3p target genes Cla97C08G151350 (MYB33) and Cla97C11G224710 (SPOROCYTELESS-like) in the cold-tolerant and cold-intolerant watermelon materials under low temperature stress of the present invention. DETAILED DESCRIPTION

[0022] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] Example 1 Response of ClmiR159-3p to low temperature stress in cold-tolerant and cold-intolerant watermelon materials

[0024] In order to change the cold tolerance of watermelon, the watermelon cultivar Nongkeda No. 5 (N5) was used as the scion and the cold-tolerant wild watermelon germplasm TC was used as the rootstock. The grafting was carried out by cleft grafting. A control group N5 / N5 of self-root grafting was set up. When the grafted seedlings grew to four leaves and one heart, they were treated with normal temperature and low temperature respectively. The treatment combinations were: N5 / N5+25℃, N5 / TC+25℃, N5 / N5+4℃, N5 / TC+4℃.

[0025] After 36 hours of treatment, the net photosynthetic rate, maximum photochemical efficiency of PSII, and malondialdehyde content were measured in each treatment group. Figure 1 As shown in the figure, after 36 h of low temperature treatment at 4°C, the net photosynthetic rate and Fv / Fm of N5 / TC plants were significantly higher than those of N5 / N5 plants, while their malondialdehyde (MDA) content was significantly lower than that of N5 / N5, indicating that N5 / TC plants were more cold-tolerant than N5 / N5.

[0026] Leaves were collected at 0, 6, 12, 24, and 36 hours after low-temperature treatment, quickly frozen with liquid nitrogen, and stored in a -80°C ultra-low temperature refrigerator for the determination of ClmiR159-3p. The nucleotide sequence of watermelon ClmiR159-3p is shown in SEQ ID NO.1: UUUGGAUUGAAGGGAGCUCUA.

[0027] The miRNA of watermelon leaves was extracted using a miRNA kit (Tiangen, Beijing), and the extracted miRNA was reverse transcribed using a miRcut Plus miRNA First-Strand cDNA Kit. The primer sequences for ClmiR159-3p amplification are shown in Table 1, and U6 was used as the internal reference primer. The miRcute Enhanced miRNA Fluorescence Quantification Detection Kit (SYBRGreen) was used for miRNA fluorescence quantitative detection.

[0028] The 20 μl reaction system included 10 μl SYBR fluorescent dye, 1 μl cDNA, 0.4 μl upstream primer, 0.4 μl downstream primer, and 8.2 μl ddH 2 O. The PCR reaction conditions were: 95°C for 15 min, 94°C denaturation for 20 s, 60°C annealing and extension for 34 s, and 40 cycles.

[0029] Table 1 qRT-PCR primer sequences

[0030]

[0031] Results Figure 2 Under normal temperature conditions and low temperature stress, the relative expression of ClmiR159-3p in N5 / TC plants was significantly higher than that in N5 / N5 from 0 to 24 h. Under low temperature stress, ClmiR159-3p in both N5 / N5 and N5 / TC grafted plants began to up-regulate from the 6th hour, reached a peak at 12 hours, then rapidly decreased, and returned to the initial level at 24 hours. At 12 hours of low temperature treatment, the relative expression of ClmiR159-3p in N5 / TC plants was 1.43 times higher than that in N5 / N5. The above results indicate that ClmiR159-3p may be involved in the response and adaptation of cold-tolerant watermelon materials to low temperatures.

[0032] Example 2 Construction and detection of transgenic Arabidopsis thaliana materials overexpressing ClMIR159

[0033] (1) Searching the watermelon genome database shows that the ClMIR159 gene is located at 25169051-25169256 bp of chromosome Cla97Chr04, and the gene sequence is as follows:

[0034] tagggtttgaggcagagctccttgaagtccaatagaggtttatgccaggttgattaagctgctaagctatggatcccacagcccctattgctaatctcataaatcaaaattaagctaataggcctgtggcttgcatatctcaggagcttcatcacctgtttttg ttagatccttgTTTTGGATTGAAGGGAGCTCTAcatcttctct; SEQ ID NO. 2.

[0035] According to the requirements for constructing miRNA precursors, the upstream and downstream of the ClMIR159 gene were extended by about 150 bp, that is, the fragment located at 25168917-25169399 bp on chromosome 4 in the genome, and the following sequence was obtained:

[0036]

[0037] The bold sequence in the sequence is the sequence part that matches the upstream and downstream primers; the single underlined sequence is the genomic sequence part corresponding to ClMIR159; the double underlined sequence is the genomic sequence part corresponding to mature ClmiR159-3p.

[0038] (2) PCR amplification of target gene

[0039] The above fragment was amplified from the cDNA of the watermelon cultivar 'Nongkeda No. 5' (N5) using PCR technology. The PCR primers used were: (with recognition sequences for restriction endonucleases BamHI and EcoRI at the 5' end)

[0040] TTTTGCTCTTC-3';SEQ ID NO.4;

[0041] MIR159-R:5'-ATCCCCCGGGCTGCAGGAATTCGATATC-GGTTAAGAAAA TGGGATAATGGG-3'; SEQ ID NO.5;

[0042] PCR amplification obtained a ClMIR159 fragment with a length of 539 bp and containing the homology arms of the pGREEN vector. The 20 μl reaction system included 10 μl high-fidelity enzyme, 1 μl cDNA, 0.5 μl upstream primer, 0.5 μl downstream primer, and 8 μl ddH2O. The PCR reaction conditions were: 98°C for 10 s, 55°C denaturation for 5 s, 72°C annealing and extension for 35 s, and 36 cycles.

[0043] (3) The ClMIR159 fragment amplified in step (2) was ligated with the pGREEN linearized vector double-digested with XhoI and EcoRV restriction endonucleases to obtain the recombinant plasmid pGREEN-ClMIR159.

[0044] (4) pGREEN-ClMIR159 was transformed into Agrobacterium tumefaciens strain GV3101 by heat shock method.

[0045] (5) Agrobacterium containing pGREEN-ClMIR159 plasmid was inoculated to an OD of 1.5-2.0, and the unopened Arabidopsis inflorescence was infected by the floral dip method. The harvested T0 generation Arabidopsis was screened for resistant plants using BASTA. Leaves of wild-type Columbia and BASTA-resistant plants were collected to extract DNA, and ClMIR159 overexpression positive transgenic plants (OE#1-#3) were identified by PCR. The primer sequences used for PCR are as follows:

[0046] MIR159-2F:5'-CATTTGGAGAGGACAGCCCA-3'; SEQ ID NO.6;

[0047] MIR159-2R:5'-CTCCAGTGAAAAGTTCTTCTCC-3'; SEQ ID NO.7;

[0048] The 20 μl reaction system included 10 μl Taq enzyme, 1 μl cDNA, 0.5 μl upstream primer, 0.5 μl downstream primer, and 8 μl ddH 2 O. The PCR reaction conditions were: 94°C for 3 min, 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 40 s, 35 cycles, and 72°C for 5 min.

[0049] Results Figure 3 The wild type had no DNA band of ClMIR159, while the overexpression lines OE#1-OE#3 had DNA band of ClMIR159.

[0050] The positive ClMIR159 gene overexpression lines were harvested individually and self-pollinated for three consecutive generations for purification.

[0051] Example 3 Identification of low temperature resistance of Arabidopsis plants heterologously overexpressing MIR159

[0052] After sterilizing, Arabidopsis seeds with heterologous overexpression of ClMIR159 were sown in 1 / 2MS medium and cultured normally until Arabidopsis had 4 true leaves. Wild-type Arabidopsis and ClMIR159 overexpressing plants were treated with -10℃ low temperature for 1.5h, and then recovered under normal temperature for 5d; a control group without low temperature treatment was set up.

[0053] Results Figure 4 Under normal conditions, there was basically no difference in the phenotypes between wild-type Arabidopsis and overexpressing Arabidopsis OE#1, OE#2, and OE#3 plants. After low temperature treatment, wild-type Arabidopsis plants were short, some of them died, and most of the leaves turned yellow; while OE#1 plants were larger, with slightly yellow leaves and fewer plant deaths; OE#2 and OE#3 Arabidopsis plants had slightly yellow leaves and fewer plant deaths.

[0054] Under normal conditions, the survival rates of wild-type Arabidopsis and overexpressed Arabidopsis OE#1, OE#2, and OE#3 were all 100%, and the relative conductivity of the three strains was basically the same. After low temperature treatment, the survival rate of overexpressed Arabidopsis was significantly higher than that of wild-type Arabidopsis, and the three strains OE#1, OE#2, and OE#3 were 33.84%, 46.84%, and 27.65% higher than WT, respectively; the relative conductivity of overexpressed Arabidopsis was significantly lower than that of wild-type Arabidopsis, and OE#1, OE#2, and OE#3 were 19.08%, 15.35%, and 22.44% lower than WT, respectively.

[0055] The above results indicate that overexpression of ClMIR159 can improve the low temperature resistance of Arabidopsis.

[0056] Example 4 Regulation of CBFs gene expression by heterologous overexpression of ClMIR159 in Arabidopsis

[0057] In order to explore the regulation of CBFs gene expression by ClMIR159 heterologous expression in Arabidopsis, leaves of wild-type Arabidopsis and overexpressed Arabidopsis were collected at 0h, 1h, 12h, 1d, 3d, and 5d after low temperature treatment. Total RNA from Arabidopsis leaves was extracted using an RNA extraction kit (Tiangen, Beijing). Total RNA was reversed into cDNA using the FastKing cDNA first-strand synthesis kit (Tiangen, Beijing).

[0058] The amplification primer sequences of AtCBFs genes are shown in Table 1; Atactin is used as the internal reference gene.

[0059] Fluorescence quantitative PCR was analyzed using the iQ5 real-time quantitative instrument from Bio-rad, USA. ExTaqTM II (2×) kit (Takara, Tokyo, Japan). The 20 μl reaction system included 10 μl SYBR fluorescent dye, 1 μl cDNA, 1 μl upstream primer, 1 μl downstream primer, and 7 μl ddH2O. The PCR reaction conditions were: 95°C for 3 min; 95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 30 s, and 40 cycles. The Ct value obtained by fluorescence quantitative PCR was 2 -ΔΔCt The CBF relative gene expression level was calculated by this method.

[0060] Depend on Figure 5It can be seen that after low temperature treatment, the expression levels of AtCBF1, AtCBF2, and AtCBF3 in the leaves of WT, OE#1, OE#2, and OE#3 were all upregulated, and the change trends of the three expression levels were basically the same. The expression levels of AtCBF1, AtCBF2, and AtCBF3 in the leaves of WT, OE#2, and OE#3 all reached their peaks after 1 hour of low temperature, and OE#2 reached the highest level at 12 hours. Compared with wild-type Arabidopsis, the expression levels of AtCBF1, AtCBF2, and AtCBF3 in the leaves of OE#2 increased by 97.21%, 80.27%, and 47.88% at 1 hour, respectively, and those of OE#3 increased by 76.28%, 48.55%, and 102.23%, respectively.

[0061] The above results indicate that the low temperature resistance induced by ClMIR159 overexpression is related to its regulation of CBFs gene expression.

[0062] Example 5 Identification of target genes of watermelon ClmiR159-3p

[0063] To determine the target genes of ClmiR159-3p, the target genes of ClmiR159-3p were identified through the psRNATarget website (https: / / www.zhaolab.org / psRNA Target / ) and degradome sequencing.

[0064] Depend on Figure 6 It can be seen that the predicted splicing site of the target gene is located at the 10th site of ClmiR159-3p. Using β-actin as the internal reference gene, qRT-PCR analysis showed that the expression trends of the target genes Cla97C08G151350 (MYB33) and Cla97C11G224710 (SPOROCYTELESS-like) were basically opposite to those of ClmiR159-3p, indicating that these two genes may be regulated by ClmiR159-3p.

[0065] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0066] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to the above embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of ClMIR159, the precursor of watermelon ClmiR159-3P, in improving plant low temperature resistance; The nucleotide sequence of the precursor ClMIR159 of the watermelon ClmiR159-3P is shown in SEQ ID NO.2, and the plant shown is Arabidopsis thaliana.

2. The use according to claim 1, characterized in that: Improving plant cold resistance by overexpressing ClMIR159, the precursor of ClmiR159-3P in watermelon.

Images