A biomarker and reagent kit for diagnosing peanut allergy

Abstract

This invention provides a diagnostic biomarker and kit for peanut allergy, belonging to the field of immunomolecular biology. The peanut allergy diagnostic biomarker includes long non-coding RNAs ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965, and ENSRNOT00000081904. The peanut allergy diagnostic biomarker and kit provided by this invention exhibit good sensitivity and specificity in detecting peanut allergy, and can replace traditional methods for confirming peanut allergy. It eliminates the invasiveness and associated risks of in vivo detection methods, ensuring that it can assist in the diagnosis of peanut allergy, comprehensively predict the occurrence of food allergies, and provide new ideas for the diagnosis and treatment of peanut allergy.

Description

Technical Field

[0001] This invention belongs to the field of immunomolecular biology technology, and in particular relates to a diagnostic marker and reagent kit for peanut allergy. Background Technology

[0002] As one of the world's major public health issues, food allergies have been on the rise in recent years due to dietary diversification and changes in lifestyles, earning the title of the second wave of allergy epidemics after asthma. Epidemiological surveys show that the prevalence of food allergies is about 2% in adults and as high as 8% in children. Peanut allergy, as one of the most severe food allergies, generally does not disappear with age. Even trace amounts of allergens can trigger severe allergic reactions, mainly manifesting in the skin, respiratory tract, and digestive tract, such as itching, angioedema, rhinitis, asthma, and diarrhea. In severe cases, systemic reactions such as anaphylactic shock can occur.

[0003] Food allergy is an adverse immune response of the body's immune system to food proteins. A typical food allergy response mechanism is mediated by IgE, leading to mast cell degranulation and the release of inflammatory mediators such as histamine. Recent studies have gradually revealed that long non-coding RNAs (LUNs) are widely involved in almost all physiological and pathological activities in the human body, participating in, regulating, or mediating the development of diseases. LUNs are RNA molecules longer than 200 nt that lack protein-coding capabilities, accounting for approximately 98% of total human RNA. LUN molecules possess specific and complex secondary spatial structures, enabling them to interact with proteins, DNA, and RNA. They can regulate gene expression at multiple levels, including epigenetic, transcriptional, post-transcriptional, and protein metabolism levels. Disorders of LUN expression are closely related to the development of various human diseases. Currently, some LUNs have been shown to play a role in allergic diseases, including asthma and atopic dermatitis, indicating their potential as therapeutic targets and biomarkers for allergic diseases. However, the role of LUNs in peanut allergy has not yet been reported.

[0004] Clinically, food allergies are confirmed using in vivo methods such as food challenge and skin spot testing combined with serum sIgE detection. However, these methods often lead to overdiagnosis of food allergies. With the continuous development of molecular biology, proteomics, and genomics, researchers have proposed novel biomarkers that may aid in the diagnosis of food allergies. Currently, clinical practice requires a diagnostic model composed of multiple indicators to comprehensively predict the occurrence of food allergies. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide a diagnostic biomarker and kit for peanut allergy. The peanut allergy diagnostic biomarker, kit, and diagnostic model provided by this invention have good sensitivity and specificity in detecting peanut allergy, and can replace traditional methods for confirming peanut allergy. This eliminates the invasiveness and related risks of in vivo detection methods, ensures that it can assist in the diagnosis of peanut allergy, comprehensively predict the occurrence of food allergies, and provide new ideas for the diagnosis and treatment of peanut allergy.

[0006] This invention provides a diagnostic biomarker for peanut allergy, comprising one or more of the following long non-coding RNAs: ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965, and ENSRNOT00000081904.

[0007] This invention provides a kit for detecting peanut allergy, comprising reagents for detecting the expression levels of the long non-coding RNAs ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965 and ENSRNOT00000081904.

[0008] Preferably, the reagent includes primers for amplifying long non-coding RNAs ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965 and ENSRNOT00000081904.

[0009] The primer sequences for ENSRNOT00000087227 are shown in SEQ ID No. 1 and SEQ ID No. 2;

[0010] The primer sequences for ENSRNOT00000090335 are shown in SEQ ID No. 3 and SEQ ID No. 4;

[0011] The primer sequences for ENSRNOT00000085965 are shown in SEQ ID No. 5 and SEQ ID No. 6;

[0012] The primer sequences for ENSRNOT00000081904 are shown in SEQ ID No. 7 and SEQ ID No. 8.

[0013] Preferably, the concentration of the primers used is independently 8–12 μM.

[0014] Preferably, the amplification system, in 20 μL, comprises the following components: 10 μL of 2×Taq Pro Universal SYBRqPCR Master Mix, 0.4 μL of upstream primer, 0.4 μL of downstream primer, 1 μL of cDNA, and 8.2 μL of ddH2O.

[0015] Preferably, the amplification procedure is as follows: pre-denaturation at 95℃ for 30s; denaturation at 95℃ for 3-10s; annealing at 60℃ for 10-30s; melting curve at 95℃ for 15s, 60℃ for 30s, and 95℃ for 15s.

[0016] Preferably, the expression levels of the long non-coding RNAs ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965, and ENSRNOT00000081904 are substituted into the diagnostic model Y = 38.5719 × ENSRNOT00000087227 + 313.8883 × ENSRNOT00000090335 + 51.874 × ENSRNOT00000085965 - 60.5057 × ENSRNOT00000081904 - 8.9084 for judgment, where ΔCt = Ct 目的基因 -Ct 内参基因 Calculate the Y value. When the Y value is >0, it is determined to be a positive peanut allergy test; otherwise, it is a negative test.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The peanut allergy diagnostic biomarkers provided by this invention, namely lncRNAs ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965, and ENSRNOT00000081904, exhibit good sensitivity and specificity. Detecting these lncRNAs to confirm peanut allergy replaces traditional methods such as food challenge and skin spot testing, eliminating the invasiveness and associated risks of in vivo detection methods. This ensures that the methods can assist in the diagnosis of peanut allergy, comprehensively predict the occurrence of food allergies, and provide new insights for the diagnosis and treatment of peanut allergy. Attached Figure Description

[0019] Figure 1 This is the procedure for constructing a peanut allergy model in BN rats;

[0020] Figure 2 The difference in serum IgE and IgG1 concentrations between the peanut allergy group and the control group in Example 1;

[0021] Figure 3The difference in serum IFN-γ and IL-4 concentrations between the peanut allergy group and the control group in Example 1;

[0022] Figure 4 The difference in serum histamine and MMCP-1 concentrations between the peanut allergy group and the control group in Example 1;

[0023] Figure 5 The expression levels of four lncRNAs in the blood of peanut-allergic rats and control rats, respectively;

[0024] Figure 6 This is the ROC curve of four lncRNAs in blood for the diagnosis of peanut allergy. Detailed Implementation

[0025] This invention provides a diagnostic biomarker for peanut allergy, comprising one or more of the long non-coding RNAs ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965, and ENSRNOT00000081904; preferably, it includes ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965, and ENSRNOT00000081904. This invention obtains the blood lncRNA expression profiles of peanut-allergic rats and control rats through lncRNA sequencing, and screens for differentially expressed lncRNAs.

[0026] This invention provides a kit for detecting peanut allergy, comprising reagents for detecting the expression levels of the long non-coding RNAs ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965 and ENSRNOT00000081904.

[0027] In this invention, the reagents include primers for amplifying long non-coding RNAs ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965, and ENSRNOT00000081904.

[0028] The primer sequences for ENSRNOT00000087227 are shown in SEQ ID No. 1 and SEQ ID No. 2; specifically as follows:

[0029] F1: ACATCGTTTCTTGGCAACCG (SEQ ID No. 1);

[0030] R1:AAAAGCTGAACCACGCTTCC(SEQ ID No.2)

[0031] The primer sequences for ENSRNOT00000090335 are shown in SEQ ID No. 3 and SEQ ID No. 4; specifically as follows:

[0032] F2:GCAGCCTTGAAACTGTCTTCTG(SEQ ID No.3)

[0033] R2:TCAGCCATTGTGGAAGAAGC(SEQ ID No.4)

[0034] The primer sequences for ENSRNOT00000085965 are shown in SEQ ID No. 5 and SEQ ID No. 6; specifically as follows:

[0035] F3:TGACTTGCAGCATGATCACC(SEQ ID No.5)

[0036] R3: TTGAAAGCGCCTGTGTGAAG (SEQ ID No. 6)

[0037] The primer sequences for ENSRNOT00000081904 are shown in SEQ ID No. 7 and SEQ ID No. 8; specifically as follows:

[0038] F4:AGGAATTTCTCTGCCGACCG(SEQ ID No.7)

[0039] R4: GTAACCCTGGTTCTGACCCG (SEQ ID No. 8).

[0040] In this invention, the concentration of the primers used is preferably 8-12 μM, more preferably 9-11 μM, and even more preferably 10 μM.

[0041] In this invention, the kit for detecting peanut allergy preferably also includes other reagents for amplifying long non-coding RNAs; including but not limited to commercially available real-time quantitative PCR amplification buffers, internal reference gene primers, and ddH2O. In a specific implementation of this invention, the kit also includes amplification primers for the internal reference gene β-actin; the specific primer sequences are as follows:

[0042] F5:AAGTGTGACGTTGACATCCGTAAAG(SEQ ID No.9)

[0043] R5: CAGCTCAGTAACAGTCCGCCTAGA (SEQ ID No. 10).

[0044] In this invention, the amplification system, in 20 μL, preferably includes the following components: 10 μL of 2×Taq ProUniversal SYBR qPCR Master Mix, 0.4 μL of upstream primer, 0.4 μL of downstream primer, 1 μL of cDNA, and 8.2 μL of ddH2O.

[0045] In this invention, the preferred amplification procedure is as follows: pre-denaturation at 95°C for 30s; denaturation at 95°C for 3-10s, annealing at 60°C for 10-30s; melting curve at 95°C for 15s, 60°C for 30s, and 95°C for 15s.

[0046] In this invention, blood lncRNA expression profiles of peanut-allergic rats and control rats were obtained through lncRNA sequencing, and differentially expressed lncRNAs were screened out. Then, the obtained differentially expressed lncRNAs were used for regression analysis to construct a diagnostic model. Specifically, the glmnet function for LASSO regression and the lrm function for logistic regression were used to construct the diagnostic model. The diagnostic model is as follows: Y = 38.5719 × ENSRNOT00000087227 + 313.8883 × ENSRNOT00000090335 + 51.874 × ENSRNOT00000085965 - 60.5057 × ENSRNOT00000081904 - 8.9084, where ΔCt = Ct 目的基因 -Ct 内参基因 Calculate the Y value. When the Y value is >0, it is determined to be a positive peanut allergy test; otherwise, it is a negative test.

[0047] Table 1. Diagnostic formula coefficients based on lncRNA

[0048]

[0049] In the specific use of the reagent kit described in this invention, the preferred steps include:

[0050] S1) Extract RNA from the blood sample to be tested;

[0051] S2) The extracted RNA is reverse transcribed to obtain cDNA;

[0052] S3) The obtained cDNA was used as a template for quantitative PCR amplification of long non-coding RNA;

[0053] S4) Obtain the fold change in the expression level of the target long non-coding RNA in the sample to be tested relative to the change in the internal reference gene β-actin.-△Ct By inputting the above diagnostic model, it can be determined whether the sample to be tested is allergic to peanuts.

[0054] In this invention, RNA was extracted from the blood sample to be tested using TRIzol RNA extraction reagent (Invitrogen, America); cDNA synthesis was performed using HiScript III RT SuperMix for qPCR (Vazyme, China); and real-time quantitative PCR was performed using Taq Pro Universal SYBR qPCR Master Mix (Vazyme, China) according to the operating procedures specified in the reagent instructions.

[0055] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0056] Example 1

[0057] Establishment of a peanut allergy model in BN rats

[0058] like Figure 1 As shown, a peanut allergy model was established using commercially available BN rats. After challenge on day 21, the successful establishment of the peanut allergy model was confirmed by measuring body temperature and serum concentrations of IgE, IgG1, IFN-γ, IL-4, histamine, and MMCP-1. Specifically, the BN rats were divided into a peanut allergy group and a negative control group, with 24 and 15 rats in each group, respectively. On days 1, 3, 5, and 15, the peanut allergy group received an intraperitoneal injection of 4 mg / mL peanut protein (using PBS as a solvent), while the negative control group received an intraperitoneal injection of 500 mL of PBS. On day 21, a five-fold dose (20 mg / mL) of peanut protein / PBS was administered for challenge. Body temperature was measured, and the rats were anesthetized with 6.5% chloral hydrate. 1 mL of blood was collected from the canthus of the eye, and 3 mL of TRIzol was rapidly added. The mixture was vortexed or pipette-mixed, quickly placed in liquid nitrogen, and then transferred to -80°C for storage. The rats were euthanized by cervical dislocation after blood collection.

[0059] The results are as follows Figures 2-4 As shown, there were significant differences in serum IgE, IgG1, histamine, MMCP-1, IL-4, and IFN-γ between the peanut allergy group and the control group, indicating that the model was successfully constructed.

[0060] Example 2

[0061] Blood RNA was extracted from rat blood prepared in Example 1.

[0062] 1. Take out a 1mL blood sample from a -80℃ freezer and thaw it on ice.

[0063] 2. Add 200 mL of chloroform, tighten the centrifuge tube cap, shake vigorously for 15 seconds, and let stand at room temperature for 2-3 minutes.

[0064] 3. Centrifuge at 12,000 rpm at 4°C for 15 min. Carefully aspirate the upper aqueous phase into a new centrifuge tube, add an equal volume of isopropanol, invert to mix, and let stand at room temperature for 10 min.

[0065] 4. Centrifuge at 12,000 rpm at 4°C for 10 min. Carefully discard the supernatant, add 1 mL of 75% ethanol prepared with DEPC water, thoroughly wash the cap and walls of the tube, and gently tap the bottom of the tube to suspend the precipitate.

[0066] 5. Centrifuge at 12,000 rpm for 3 min at 4℃, and discard the supernatant. Let stand at room temperature for 2-3 min to air dry. Add 30 mL of RNase-free water, and after complete dissolution, take a small amount to test the concentration and purity; store the remainder at -80℃.

[0067] Example 3

[0068] 1. cDNA synthesis

[0069] The RNA extracted in Example 2 was reverse transcribed using HiScript III RT SuperMix for qPCR (Vazyme, China).

[0070] 1) Removal of genomic DNA

[0071] Prepare the following mixture in RNase-free centrifuge tubes:

[0072] Table 2 Genome Removal Reaction System

[0073] Mixture volume <![CDATA[RNase-free ddH2O]]> To 16μL 4×gDNA wiper Mix 4μL template RNA 1mg

[0074] Gently mix with a pipette and incubate at 42°C for 2 minutes.

[0075] 2) Add 5×HiScript III qRT SuperMix directly to the reaction tube from step one and gently mix with a pipette.

[0076] Table 3 cDNA synthesis reaction system

[0077] Mixture volume The reaction solution in the first step 16μL 5×HiScript III qRT SuperMix 4μL

[0078] 3) Perform reverse transcription reaction

[0079] Table 4 cDNA synthesis reaction procedure

[0080]

[0081]

[0082] 2. Primer design

[0083] Primers were designed online using Primer3Plus based on long non-coding RNA transcript sequences. The primer sequences are shown below:

[0084] ENSRNOT00000087227:

[0085] F1: ACATCGTTTCTTGGCAACCG (SEQ ID No. 1);

[0086] R1:AAAAGCTGAACCACGCTTCC(SEQ ID No.2)

[0087] ENSRNOT00000090335:

[0088] F2:GCAGCCTTGAAACTGTCTTCTG(SEQ ID No.3)

[0089] R2:TCAGCCATTGTGGAAGAAGC(SEQ ID No.4)

[0090] ENSRNOT00000085965:

[0091] F3:TGACTTGCAGCATGATCACC(SEQ ID No.5)

[0092] R3: TTGAAAGCGCCTGTGTGAAG (SEQ ID No. 6)

[0093] ENSRNOT00000081904:

[0094] F4:AGGAATTTCTCTGCCGACCG(SEQ ID No.7)

[0095] R4: GTAACCCTGGTTCTGACCCG (SEQ ID No. 8).

[0096] b-actin

[0097] F5:AAGTGTGACGTTGACATCCGTAAAG(SEQ ID No.9)

[0098] R5: CAGCTCAGTAACAGTCCGCCTAGA (SEQ ID No.10)

[0099] 3. Real-time quantitative PCR

[0100] The experiment was conducted using Taq Pro Universal SYBR qPCR Master Mix (Vazyme, China) following the instructions provided in the reagent package.

[0101] 1) The qPCR reaction system is as follows:

[0102] Table 5 qPCR reaction system

[0103]

[0104]

[0105] 2) qPCR reaction program

[0106] Table 6 qPCR reaction procedure

[0107]

[0108] 4. Calculate the experimental results

[0109] 1) LncRNA expression level

[0110] Ct (threshold cycle number) obtained from the PCR reaction curve was calculated using... Quantitative data analysis of the target gene, ΔCt=Ct 目的基因 -Ct 内参基因 The result is as follows Figure 5 As shown, the expression levels of ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965, and ENSRNOT00000081904 in the blood of peanut-allergic rats were higher than those in the control group.

[0111] 2) ROC diagnostic efficacy analysis

[0112] Receiver operating characteristic (ROC) curves and area under the curve (AUC) were used to evaluate the diagnostic value of four blood lncRNAs in peanut allergy. The results are as follows: Figure 6As shown, the AUC values ​​of ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965, and ENSRNOT00000081904 were 0.8067, 0.8433, 0.85667, and 0.8333, respectively, all showing good diagnostic efficacy. However, when the four lncRNAs were analyzed in combination, the diagnostic efficacy was significantly higher than that of the individual lncRNAs, with an AUC as high as 0.9433. This indicates that the combined expression levels of ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965, and ENSRNOT00000081904 in the blood can effectively diagnose peanut allergy.

[0113] Example 4

[0114] Validation of lncRNA diagnostic efficacy

[0115] According to the appendix Figure 1 The peanut allergy BN rat model was shown. Peanut, milk, and shrimp allergy models were constructed (the construction method of the milk and shrimp allergy models was the same as that of the peanut allergy model, with the sensitizing substances changed to milk and shrimp). There were 3 rats in each group. According to the experimental method described above, RNA was extracted from the blood, reverse transcribed, and the expression level of each lncRNA was obtained by real-time quantitative PCR. The model was fitted according to the formula, and the AUC values ​​of the ROC curves were calculated as shown in the table below. The diagnostic model based on 4 lncRNAs can distinguish peanut allergy from other allergies and has good specificity and sensitivity.

[0116] Table 7. Evaluation of the diagnostic efficacy of the lncRNA model

[0117]

[0118] As can be seen from the above embodiments, the peanut allergy diagnostic markers lncRNA ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965 and ENSRNOT00000081904 provided by the present invention have good sensitivity and specificity and can be used for the diagnosis of peanut allergy.

[0119] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of reagents for detecting diagnostic markers of peanut allergy in the preparation of kits for detecting peanut allergy, characterized in that, The peanut allergy diagnostic markers include long non-coding RNAs ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965 and ENSRNOT00000081904. The expression levels of the long non-coding RNAs ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965, and ENSRNOT00000081904 were substituted into the diagnostic model Y = 38.5719 × ENSRNOT00000087227 + 313.8883 × ENSRNOT00000090335 + 51.874 × ENSRNOT00000085965 - 60.5057 × ENSRNOT00000081904 - 8.9084 for judgment. The expression levels of the long non-coding RNAs were calculated using Ct obtained from the PCR reaction curve, and a 2-1Tt was used. -△Ct Quantitative data analysis of the target gene, ΔCt = Ct 目的基因 -Ct 内参基因 Calculate the Y value. When the Y value is >0, it is determined to be a positive peanut allergy test; otherwise, it is a negative test.

2. The application according to claim 1, characterized in that, The reagent for detecting peanut allergy diagnostic markers includes primers for amplifying long non-coding RNAs ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965, and ENSRNOT00000081904. The primer sequences for ENSRNOT00000087227 are shown in SEQ ID No. 1 and SEQ ID No. 2; The primer sequences for ENSRNOT00000090335 are shown in SEQ ID No. 3 and SEQ ID No. 4; The primer sequences for ENSRNOT00000085965 are shown in SEQ ID No. 5 and SEQ ID No. 6; The primer sequences for ENSRNOT00000081904 are shown in SEQ ID No. 7 and SEQ ID No.

8.

3. The application according to claim 2, characterized in that, The concentration of the primers used is independently 8-12 μM.

4. The application according to claim 2, characterized in that, The amplification system for long non-coding RNAs ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965, and ENSRNOT00000081904, in 20 μL volumes, included the following components: 10 μL of 2×Taq Pro Universal SYBR qPCR Master Mix, 0.4 μL of upstream primer, 0.4 μL of downstream primer, 1 μL of cDNA, and 8.2 μL of ddH2O.

5. The application according to claim 4, characterized in that, The amplification program for long non-coding RNAs ENSRNOT00000087227, ENSRNOT00000090335, ENSRNOT00000085965, and ENSRNOT00000081904 was as follows: pre-denaturation at 95℃ for 30s; denaturation at 95℃ for 3-10s, followed by annealing at 60℃ for 10-30s; melting curves at 95℃ for 15s, 60℃ for 30s, and 95℃ for 15s.

Images