Gene editing system for constructing huntington disease model pig nuclear transfer donor cells with ht gene mutation and application thereof
By constructing a gene-editing system for a Huntington's disease model pig with an HTT gene mutation, and utilizing CRISPR/Cas9 technology and somatic cell nuclear transfer technology, the problems of large differences between existing models and humans and high costs in primates have been solved, providing a stable animal model for Huntington's disease research and treatment.
Patent Information
- Application Number
- CN202210996706.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-19
- Publication Date
- 2026-04-28
- Estimated Expiration
- 2042-08-19
AI Technical Summary
Existing mouse models differ significantly from human Huntington's disease in simulating the physiological and pathological state, failing to accurately reflect the human disease state. Furthermore, primate models are costly and difficult to breed, hindering the effective research and development of drugs for Huntington's disease.
A gene editing system for a Huntington's disease model pig with an HTT gene mutation was constructed using CRISPR/Cas9 technology. Recombinant pig cells were prepared by co-transfecting sgRNAHTT-gU3, sgRNAHTT-gD1, donor plasmid, and NCN protein into pig cells using electroporation transfection. The Huntington's disease model pig was then prepared using somatic cell nuclear transfer technology.
It provides animal models that are closer to human physiological and pathological states, reduces ethical and cost issues, stabilizes genetic variations, supports drug screening, efficacy evaluation and gene therapy research, and provides effective experimental data.
Smart Images

Figure BDA0003805842850000161 
Figure HDA0003805842860000011 
Figure HDA0003805842860000012
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically to the field of gene editing technology, and more specifically relates to a gene editing system for constructing HTT gene-mutated porcine nuclear transplantation donor cells for Huntington's disease model and its application. Background Technology
[0002] Huntington's disease (HD) is an autosomal dominant inherited neurodegenerative disorder that typically manifests in middle age. Symptoms include choreiform movements, and as the disease progresses, patients gradually lose the ability to speak, move, think, and swallow. The disease typically progresses over 10 to 20 years, ultimately leading to death. It was discovered by American physician George Huntington in 1872, hence the name. The primary cause is a mutation in the Huntingtin (HTT) gene on chromosome 4, which causes the glutamine bundles (polyQ bundles) to amplify in the huntingtin protein encoded by the HTT gene. This leads to misfolding of the huntingtin protein, causing it to gradually aggregate within cells, forming large molecular clusters that accumulate in the brain and impair nerve cell function. The penetrance of HD depends on the number of CAG repeats in the polyQ bundles, and the length of the polyQ bundles is negatively correlated with the age of onset. In normal individuals, the polyQ bundle length is typically less than 35 CAGs. Most HD patients carry polyQ bundles encoded by 37 to 48 CAG repeat sequences, while adolescent HD patients typically carry polyQ bundles encoded by more than 55 CAG repeat sequences.
[0003] Research into the pathogenesis and development of Huntington's disease and the development of corresponding drugs both require animal models. Currently, the most commonly used animal model is the mouse model. However, mice differ greatly from humans in body size, organ size, physiology, and pathology, and cannot realistically simulate normal human physiological and pathological states. Pigs, as large animals, are similar in size and physiological function to humans, are easy to breed and raise on a large scale, and have lower ethical and animal protection requirements, making them ideal animal models for human diseases.
[0004] Gene editing is a biotechnology that has seen significant development in recent years. It encompasses everything from homologous recombination-based gene editing to nuclease-based technologies such as ZFN, TALEN, and CRISPR / Cas9, with CRISPR / Cas9 currently being the most advanced. Gene editing technology is increasingly being applied to the creation of animal models. Summary of the Invention
[0005] The purpose of this invention is to provide a gene editing system for constructing porcine nuclear transplantation donor cells for a Huntington's disease model with HTT gene mutations and its applications.
[0006] This invention provides a method for preparing recombinant pig cells, comprising the following steps: replacing a target region in the chromosomal DNA of pig cells with a DNA molecule named DNA molecule A to obtain recombinant pig cells;
[0007] The DNA molecule A is either (I) or (II) as follows:
[0008] (I) The DNA molecule represented by nucleotides 1734-2176 in SEQ ID NO: 16;
[0009] (II) The DNA molecule represented by nucleotides 1071-2176 in SEQ ID NO: 16;
[0010] The target region is the DNA molecule represented by nucleotides 2001-2236 in SEQ ID NO: 9.
[0011] The method to replace the target region in the chromosomal DNA of pig cells with a DNA molecule named DNA molecule A is as follows: sgRNA is used... HTT-gU3 sgRNA HTT-gD1 Porcine cells were co-transfected with donor plasmid and NCN protein; the donor plasmid contained the DNA molecule A; the sgRNA HTT-gU3 The sgRNA has a target sequence binding region as shown in nucleotides 3-22 of SEQ ID NO: 19; the sgRNA HTT-gD1 The target sequence binding region is nucleotides 3-22 of SEQ ID NO: 20; the NCN protein is a Cas9 protein or a fusion protein containing a Cas9 protein.
[0012] The co-transfection specifically employs an electroporation transfection method.
[0013] The specific parameter settings for electroporation transfection are: 1450V, 10ms, 3pulse.
[0014] The co-transfection can be performed using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator.
[0015] This invention provides a kit comprising sgRNA HTT-gU3 sgRNA HTT-gD1 Donor plasmids and NCN proteins.
[0016] The present invention also provides a kit comprising sgRNA. HTT-gU3 sgRNA HTT-gD1 Donor plasmids and PRONCN protein.
[0017] The present invention also provides a kit comprising sgRNA. HTT-gU3 sgRNA HTT-gD1 Donor plasmids and tool plasmids.
[0018] The kits described above also include porcine cells.
[0019] This invention provides sgRNA HTT-gU3 sgRNA HTT-gD1 Application of donor plasmids and NCN proteins in the preparation of kits.
[0020] This invention also provides sgRNA HTT-gU3 sgRNA HTT-gD1 Application of donor plasmids and PRONCN protein in the preparation kit.
[0021] This invention also provides sgRNA HTT-gU3 sgRNA HTT-gD1 Application of donor plasmids and tool plasmids in the preparation of reagent kits.
[0022] The above-described kits are intended for use as follows (a), (b), or (c): (a) to prepare recombinant porcine cells; (b) to prepare Huntington's disease model pigs; (c) to prepare Huntington's disease cell models, tissue models, or organ models.
[0023] sgRNA HTT-gU3 sgRNA HTT-gD1 The ratio of donor plasmid and NCN protein is 0.8-1.2 μg sgRNA. HTT-gU3 0.8-1.2 μg sgRNA HTT-gD1 1.8-2.2 μg donor plasmid; 3-5 μg NCN protein.
[0024] sgRNA HTT-gU3 sgRNA HTT-gD1 The ratio of donor plasmid and NCN protein is as follows: 1 μg sgRNA HTT-gU3 1 μg sgRNA HTT-gD1 2 μg donor plasmid: 4 μg NCN protein.
[0025] porcine cells, sgRNA HTT-gU3 sgRNA HTT-gD1The ratio of donor plasmid and NCN protein is as follows: 200,000 porcine cells: 0.8-1.2 μg sgRNA HTT-gU3 0.8-1.2 μg sgRNA HTT-gD1 1.8-2.2 μg donor plasmid; 3-5 μg NCN protein.
[0026] porcine cells, sgRNA HTT-gU3 sgRNA HTT-gD1 The ratio of donor plasmid and NCN protein is as follows: 200,000 porcine cells: 1 μg sgRNA HTT-gU3 1 μg sgRNA HTT-gD1 2 μg donor plasmid: 4 μg NCN protein.
[0027] Any of the above-mentioned sgRNAs HTT-gU3 It is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 19.
[0028] Specifically, the sgRNA HTT-gU3 As shown in SEQ ID NO: 19.
[0029] Specifically, the sgRNA HTT-gU3 As shown in SEQ ID NO: 12.
[0030] Any of the above-mentioned sgRNAs HTT-gD1 It is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 20.
[0031] Specifically, the sgRNA HTT-gD1 As shown in SEQ ID NO: 20.
[0032] Specifically, the sgRNA HTT-gD1 As shown in SEQ ID NO: 13.
[0033] Any of the NCN proteins mentioned above is a Cas9 protein or a fusion protein containing a Cas9 protein.
[0034] Specifically, the NCN protein is shown in SEQ ID NO: 3.
[0035] Specifically, the donor plasmid carries a DNA molecule named DNA molecule B.
[0036] The DNA molecule B is shown as nucleotides 1-2671 in SEQ ID NO: 16.
[0037] Specifically, the donor plasmid is shown in SEQ ID NO: 16.
[0038] The porcine cells mentioned above are porcine fibroblasts.
[0039] The porcine cells mentioned above are primary porcine fibroblasts.
[0040] The porcine cells mentioned above are primary porcine fibroblasts obtained from newborn pigs.
[0041] The method for preparing the NCN protein includes the following steps:
[0042] (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria;
[0043] (2) The recombinant bacteria were cultured in liquid culture medium at 30°C, then IPTG was added and induced at 25°C, and then the bacterial cells were collected.
[0044] (3) The collected bacterial cells were broken down to collect the crude protein solution;
[0045] (4) The His6-tagged fusion protein was purified from the crude protein solution by affinity chromatography;
[0046] (5) The His6-tagged fusion protein was digested with His6-tagged enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein.
[0047] The plasmid pKG-GE4 contains the fusion gene shown in nucleotides 5209-9852 of SEQ ID NO: 1.
[0048] The preparation method of the NCN protein specifically includes the following steps:
[0049] (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria.
[0050] (2) Inoculate the recombinant bacteria obtained in step (1) into liquid LB medium containing ampicillin and culture with shaking;
[0051] (3) Inoculate the bacterial culture obtained in step (2) into liquid LB medium and culture at 30°C with shaking at 230 rpm until OD. 600nm The value was 1.0, then IPTG was added to make the concentration in the system 0.5mM, and then the cells were cultured at 25℃ and 230rpm for 12 hours with shaking, and then the cells were collected by centrifugation.
[0052] (4) Take the bacterial cells obtained in step (3) and wash them with PBS buffer;
[0053] (5) Take the bacterial cells obtained in step (4), add crude extraction buffer and suspend the bacterial cells, then break the bacterial cells, then centrifuge and collect the supernatant, filter with a 0.22 μm pore size filter membrane and collect the filtrate;
[0054] (6) The His6-tagged fusion protein (the fusion protein shown in SEQ ID NO: 2) was purified from the filtrate obtained in step (5) by affinity chromatography;
[0055] (7) Take the column-passed solution collected in step (6), concentrate it using an ultrafiltration tube, and then dilute it with 25 mM Tris-HCl (pH 8.0);
[0056] (8) Add the recombinant bovine enterokinase with the His6 tag to the solution obtained in step (7) and digest it with enzymes;
[0057] (9) Mix the solution from step (8) with Ni-NTA resin, incubate, and then centrifuge to collect the supernatant.
[0058] (10) Take the supernatant obtained in step (9), concentrate it using an ultrafiltration tube, and then add it to the enzyme storage solution to obtain the NCN protein solution.
[0059] The specific method for purifying the His6-tagged fusion protein from the filtrate obtained in step (5) using affinity chromatography is as follows:
[0060] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then load 50 ml of the filtrate obtained in step (5) (flow rate: 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate: 1 ml / min) to remove contaminating proteins; then elute with 10 column volumes of elution buffer at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).
[0061] The PRONCN protein described above comprises the following components from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease cleavage site, nuclear localization signal, Cas9 protein, and nuclear localization signal.
[0062] The function of the signal peptide is to promote the secretory expression of a protein. The signal peptide can be selected from the Escherichia coli alkaline phosphatase (phoA) signal peptide, Staphylococcus aureus protein A signal peptide, Escherichia coli outer membrane protein (ompa) signal peptide, or any other prokaryotic gene signal peptide, preferably the alkaline phosphatase signal peptide (phoA signal peptide). The alkaline phosphatase signal peptide is used to guide the secretory expression of the target protein into the bacterial periplasmic lumen, thereby separating it from the intracellular protein. The target protein secreted into the bacterial periplasmic lumen is soluble and can be cleaved by the signal peptidase in the bacterial periplasmic lumen.
[0063] The function of the molecular chaperone protein is to increase the solubility of the protein. The molecular chaperone can be any protein that helps form disulfide bonds, preferably a thioreduction protein (TrxA protein). A thioreduction protein, acting as a molecular chaperone, helps the co-expressed target protein (e.g., Cas9 protein) form disulfide bonds, improving protein stability, correct folding, and increasing the solubility and activity of the target protein.
[0064] The protein tag is used for protein purification. The tag can be a His tag (His-Tag, His6 protein tag), GST tag, Flag tag, HA tag, c-Myc tag, or any other protein tag, with a His tag being more preferred. The His tag can bind to a Ni column, enabling one-step Ni column affinity chromatography to purify the target protein, greatly simplifying the purification process.
[0065] The function of the protease cleavage site is to cleave the non-functional segment after purification to release the native form of Cas9 protein. The protease can be selected from enterokinase, factor Xa, thrombin, TEV protease, HRV 3C protease, WELQut protease, or any other endopeptide, with enterokinase being more preferred. EK is an enterokinase cleavage site, facilitating the cleavage of the fused TrxA-His segment using enterokinase to obtain the native form of Cas9 protein. In this application, after cleaving the fusion protein with a His-tagged commercial enterokinase, the TrxA-His segment and the His-tagged enterokinase can be removed by a single affinity chromatography to obtain the native form of Cas9 protein, avoiding the damage and loss of the target protein caused by multiple purification dialysis processes.
[0066] The nuclear localization signal can be any nuclear localization signal, preferably the SV40 nuclear localization signal and / or the nucleoplasmin nuclear localization signal. The NLS is the nuclear localization signal; an NLS site is designed at both the N-terminus and C-terminus of Cas9, enabling Cas9 to more effectively enter the cell nucleus for gene editing.
[0067] The Cas9 protein may be saCas9 or spCas9, preferably spCas9 protein.
[0068] The PRONCN protein is shown in SEQ ID NO: 2.
[0069] The tool plasmid described above comprises the following elements from upstream to downstream: promoter, operon, ribosome binding site, gene encoding PRONCN protein, and terminator.
[0070] The promoter may specifically be the T7 promoter. The T7 promoter is a strong prokaryotic expression promoter that can efficiently drive the expression of exogenous genes.
[0071] The operon can specifically be the Lac operon. The Lac operon is a regulatory element for lactose-induced expression. After the bacteria have grown to a certain number, the expression of the target protein can be induced by IPTG at low temperature, which can avoid the impact of premature expression of the target protein on the growth of the host bacteria. Induction at low temperature also significantly improves the solubility of the expressed target protein.
[0072] The ribosome binding site is the ribosome binding site during protein translation, which is essential for protein translation.
[0073] The terminator can specifically be a T7 terminator. The T7 terminator can effectively terminate gene transcription at the end of the target gene, preventing other downstream sequences outside the target gene from being transcribed and translated.
[0074] For the spCas9 protein codon, this application has optimized the codon to fully adapt to the codon preference of the high-efficiency E. coli expression strain E. coli BL21(DE3) selected in this application, thereby improving the expression level of Cas9 protein.
[0075] The T7 promoter is shown as nucleotides 5121-5139 in SEQ ID NO: 1.
[0076] The Lac operon is shown as nucleotides 5140-5164 in SEQ ID NO: 1.
[0077] The ribosome binding site is shown as nucleotides 5178-5201 in SEQ ID NO: 1.
[0078] The coding sequence of the alkaline phosphatase signal peptide is shown as nucleotides 5209-5271 in SEQ ID NO: 1.
[0079] The coding sequence of the TrxA protein is shown as nucleotides 5272-5598 in SEQ ID NO: 1.
[0080] The coding sequence of His-Tag is shown as nucleotides 5620-5637 in SEQ ID NO: 1.
[0081] The coding sequence of the enterokinase cleavage site is shown as nucleotides 5638-5652 in SEQ ID NO: 1.
[0082] The coding sequence of the nuclear localization signal is shown as nucleotides 5656-5670 in SEQ ID NO: 1.
[0083] The coding sequence of the spCas9 protein is shown as nucleotides 5701-9801 in SEQ ID NO: 1.
[0084] The coding sequence of the nuclear localization signal is shown as nucleotides 9802-9849 in SEQ ID NO: 1.
[0085] The T7 terminator is nucleotides 9902-9949 in SEQ ID NO: 1.
[0086] Specifically, the tool plasmid is plasmid pKG-GE4.
[0087] The plasmid pKG-GE4 contains the DNA molecule represented by nucleotides 5121-9949 of SEQ ID NO: 1.
[0088] Specifically, any of the plasmids pKG-GE4 described above is shown in SEQ ID NO: 1.
[0089] This invention also protects recombinant porcine cells prepared by any of the methods described above.
[0090] The recombinant cells may specifically be homozygous recombinant pig cells or heterozygous recombinant pig cells.
[0091] Compared to pig cells, the only difference in the genomic DNA of homozygous recombinant cells is that the target region in the genomic DNA is replaced by the target exogenous DNA fragment, and they are homozygous (i.e., the same substitution has occurred on two homologous chromosomes).
[0092] Compared to pig cells, the only difference in the genomic DNA of heterozygous recombinant cells is that the target region in the genomic DNA is replaced by the target exogenous DNA fragment, and they are heterozygous (i.e., in a pair of homologous chromosomes, one chromosome has been replaced while the other chromosome has not).
[0093] The target exogenous DNA fragment is shown as nucleotides 1071-2176 in SEQ ID NO: 16.
[0094] The target region is shown as nucleotides 2001-2236 in SEQ ID NO: 9.
[0095] This invention also protects the use of the recombinant porcine cells in the preparation of a Huntington's disease model pig.
[0096] Using the recombinant pig cells as nuclear transfer donor cells for somatic cell cloning, cloned pigs can be obtained, namely, Huntington's disease model pigs.
[0097] The present invention also protects porcine tissues of model pigs prepared using the recombinant porcine cells, namely, a Huntington's disease tissue model.
[0098] The present invention also protects porcine organs of model pigs prepared using the recombinant porcine cells, namely, Huntington's disease organ models.
[0099] This invention also protects porcine cells of model pigs prepared using the recombinant porcine cells, namely, a Huntington's disease cell model.
[0100] This invention also protects the application of the recombinant porcine cells, the Huntington's disease tissue model, the Huntington's disease organ model, the Huntington's disease cell model, or the Huntington's disease model pig, as follows (d1) or (d2) or (d3) or (d4):
[0101] (d1) Screening for drugs to treat Huntington's disease;
[0102] (d2) Efficacy evaluation of medications for Huntington's disease;
[0103] (d3) Evaluate the efficacy of gene therapy and / or cell therapy for Huntington's disease;
[0104] (d4) To study the pathogenesis of Huntington's disease.
[0105] The pig mentioned above can specifically refer to the Congjiang Xiang pig.
[0106] The pigs mentioned above can specifically refer to newborn Congjiang Xiang pigs.
[0107] The pig mentioned above can specifically be the Bama miniature pig.
[0108] The pigs mentioned above can specifically refer to newborn Bama miniature pigs.
[0109] Compared with the prior art, the present invention has at least the following beneficial effects:
[0110] (1) The research object of this invention (pig) has better applicability than other animals (mice, mice, primates).
[0111] Rodents such as mice and rats differ greatly from humans in body size, organ size, physiology, and pathology, making it impossible to realistically simulate normal human physiological and pathological states. Studies have shown that over 95% of drugs proven effective in mice and rats are ineffective in human clinical trials. Among large animals, primates are the closest relatives to humans, but they are small, reach sexual maturity late (mating begins at 6-7 years old), and are single-birth animals, resulting in extremely slow population expansion and high rearing costs. Furthermore, primate cloning is inefficient, difficult, and costly.
[0112] Pigs, as model animals, do not have the aforementioned drawbacks. Pigs are the closest relatives to humans besides primates, and their body size, weight, and organ size are similar to humans. They are also remarkably similar to humans in anatomy, physiology, immunology, nutritional metabolism, and disease pathogenesis. Furthermore, pigs reach sexual maturity early (4-6 months), have high reproductive capacity, produce multiple offspring per litter, and can form a large herd within 2-3 years. In addition, pig cloning technology is very mature, and the costs of cloning and raising pigs are much lower than for primates. Therefore, pigs are very suitable animals to serve as human disease models.
[0113] (2) The vector constructed in this invention uses the strong promoter T7-lac, which can efficiently express the target protein, to express the target protein. The signal peptide of bacterial periplasmic protein alkaline phosphatase (phoA) guides the secretion of the target protein into the bacterial periplasmic lumen, thereby separating it from intracellular proteins. The target protein secreted into the bacterial periplasmic lumen is soluble. Simultaneously, the thioreduction protein TrxA is fused with the Cas9 protein for expression. TrxA helps the co-expressed target protein form disulfide bonds, improving protein stability, correct folding, and increasing the solubility and activity of the target protein. To facilitate the purification of the target protein, a His tag is designed, allowing for one-step Ni column affinity chromatography purification of the target protein, greatly simplifying the purification process. Furthermore, an enterokinase cleavage site is designed after the His tag to facilitate the removal of the fused TrxA-His polypeptide fragment, yielding the native form of the Cas9 protein. After cleaving the fusion protein with a His-tagged enterokinase, the TrxA-His polypeptide fragment and the His-tagged enterokinase can be removed by a single affinity chromatography step, yielding the native form of Cas9 protein. This avoids the damage and loss to the target protein caused by multiple purification dialysis steps. Furthermore, this invention also designs an NLS site at the N-terminus and C-terminus of Cas9, enabling Cas9 to more effectively enter the cell nucleus for gene editing. Additionally, this invention selects E. coli BL21(DE3) as the target protein expression strain, which can efficiently express exogenous genes cloned into expression vectors containing the phage T7 promoter (such as pET-32a). Moreover, this invention optimizes the codons for the Cas9 protein to perfectly suit the codon preferences of the expression strain, thereby improving the expression level of the target protein. Furthermore, this invention induces the expression of the target protein with IPTG at low temperature after the bacteria have grown to a certain quantity, avoiding the impact of premature expression on host bacterial growth. Low-temperature induction also significantly improves the solubility of the expressed target protein. After the above-mentioned optimization design and experimental implementation, the activity of the obtained Cas9 protein was significantly improved compared with that of the commercial Cas9 protein.
[0114] (3) Using the recombinant cells obtained by the present invention for somatic cell nuclear transfer animal cloning, cloned pigs that have undergone the target recombination can be directly obtained, and the gene mutation can be stably inherited.
[0115] This invention utilizes the CRISPR / Cas9 system and homologous recombination technology to prepare recombinant pig cells in which a target region of the genomic DNA is replaced by a target exogenous DNA fragment. Cloned pigs prepared from these recombinant pig cells using somatic cell nuclear transfer animal cloning technology can serve as a model pig for Huntington's disease. This invention will contribute to the study and elucidation of the pathogenesis of Huntington's disease caused by HTT gene dysfunction. It can also be used for drug screening, efficacy evaluation, gene therapy, and cell therapy research, providing effective experimental data for further clinical applications and thus offering a powerful experimental means for the successful treatment of human Huntington's disease. This invention has significant application value for the development of drugs for Huntington's disease and for elucidating the pathogenesis of this disease. Attached Figure Description
[0116] Figure 1 This is a schematic diagram of the structure of plasmid pET-32a.
[0117] Figure 2 This is a schematic diagram of the structure of plasmid pKG-GE4.
[0118] Figure 3 This is an electrophoresis diagram showing the optimized ratio of gRNA to NCN protein in Example 2.
[0119] Figure 4 This is an electrophoresis diagram comparing the gene editing efficiency of NCN protein and commercial Cas9 protein in Example 2.
[0120] Figure 5 The image shows electrophoresis results of PCR amplification using primer pairs HTT-E1-JDF1925 and HTT-E1-JDR2875, respectively, with genomic DNA from 10 pigs as templates in Example 3.
[0121] Figure 6 This is a schematic diagram of the structure of plasmid PB-puroR-hHTTex1(81Q).
[0122] Figure 7 This is an electrophoresis image used in Example 4 to identify whether the 5' end of the target exogenous DNA fragment in the recombinant cell has successfully recombinated.
[0123] Figure 8 This is an electrophoresis image used in Example 4 to identify whether the 3' end of the target exogenous DNA fragment in the recombinant cell has successfully recombinated.
[0124] Figure 9 This is an electrophoresis image used in Example 4 to identify whether the target exogenous DNA fragment of the recombinant cell was homozygous or heterozygous.
[0125] Figure 10 This is a sequencing peak diagram of the PCR product of the target exogenous DNA sequenced using the upstream primer for a single-cell clone numbered 1.
[0126] Figure 11 This is a sequencing peak diagram of the PCR product of the target exogenous DNA sequenced using downstream primers for single-cell clone number 1. Detailed Implementation
[0127] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0128] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. The recombinant plasmids constructed in the examples have all been sequenced and verified. The commercially available Cas9-A protein is a commercially available, effective Cas9 protein. The commercially available Cas9-B protein is a commercially available, effective Cas9 protein. Complete culture medium (% by volume): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37°C, incubator with 5% CO2 and 5% O2.
[0129] In Example 2, the primary porcine fibroblasts used were all prepared from the ear tissue of newly hatched Jiangxiang pigs. In Examples 3 and 4, the primary porcine fibroblasts used were all prepared from the ear tissue of newly hatched Bama Xiang pigs. Method for preparing primary porcine fibroblasts from porcine ear tissue: ① Take 0.5g of porcine ear tissue, remove hair and bone tissue, then soak in 75% alcohol for 30-40s, wash 5 times with PBS buffer containing 5% (v / v) Penicillin-Streptomycin (Gibco), and wash once with PBS buffer; ② Cut the tissue into small pieces with scissors, digest with 5mL of 0.1% collagenase solution (Sigma) at 37℃ for 1h, then centrifuge at 500g for 5min and discard the supernatant; ③ Resuspend the pellet in 1mL of complete culture medium, then plate it into a 10cm diameter cell culture dish containing 10mL of complete culture medium and sealed with 0.2% gelatin (VWR), and culture until the cells reach approximately 60% confluence with the bottom of the dish; ④ After completing step ③, digest and collect the cells with trypsin, then resuspend them in complete culture medium for subsequent electroporation experiments.
[0130] Example 1: Preparation and purification of NCN protein
[0131] I. Construction of a high-efficiency prokaryotic Cas9 expression vector
[0132] A schematic diagram of the structure of plasmid pET-32a is shown below. Figure 1 .
[0133] Plasmid pKG-GE4 was obtained by modifying plasmid pET-32a. Plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (abbreviated as plasmid pKG-GE4), as shown in SEQ ID NO: 1, is a circular plasmid; its structural schematic diagram is shown below. Figure 2 .
[0134] In SEQ ID NO: 1, nucleotides 5121-5139 form the T7 promoter, nucleotides 5140-5164 encode the Lac operator, nucleotides 5178-5201 form the ribosome binding site (RBS), nucleotides 5209-5271 encode the alkaline phosphatase signal peptide (phoA signal peptide), nucleotides 5272-5598 encode the TrxA protein, nucleotides 5620-5637 encode the His-Tag (also known as the His6 tag), nucleotides 5638-5652 encode the enterokinase cleavage site (EK cleavage site), nucleotides 5656-5670 encode the nuclear localization signal, nucleotides 5701-9801 encode the spCas9 protein, nucleotides 9802-9849 encode the nuclear localization signal, and nucleotides 9902-9949 form the T7 terminator. The nucleotides encoding the spCas9 protein have been codon-optimized for Escherichia coli BL21(DE3) strain.
[0135] The main modifications to plasmid pKG-GE4 are as follows: ① The coding region of the TrxA protein was retained. The TrxA protein can help the expressed target protein form disulfide bonds, increasing the solubility and activity of the target protein. An alkaline phosphatase signal peptide coding sequence was added before the TrxA protein coding region. The alkaline phosphatase signal peptide can guide the expressed target protein to be secreted into the bacterial periplasmic lumen and can be cleaved by prokaryotic periplasmic signal peptidase. ② A His-Tag coding sequence was added after the TrxA protein coding sequence. The His-Tag can be used for... Enrichment of the target protein; ③ Add the coding sequence of the enterokinase cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) downstream of the His-Tag coding sequence. The purified protein will remove His-Tag and the upstream fused TrxA protein under the action of enterokinase; ④ Insert the Cas9 gene of suitable Escherichia coli BL21(DE3) strain with optimized codons, and add nuclear localization signal coding sequences upstream and downstream of this gene to increase the nuclear localization ability of the purified Cas9 protein in the later stage.
[0136] The fusion gene in plasmid pKG-GE4, as shown in nucleotides 5209-9852 of SEQ ID NO: 1, encodes the fusion protein shown in SEQ ID NO: 2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, abbreviated as PRONCN protein). Due to the presence of alkaline phosphatase signal peptide and enterokinase cleavage site, the fusion protein is cleaved by enterokinase to form the protein shown in SEQ ID NO: 3. The protein shown in SEQ ID NO: 3 is named NCN protein.
[0137] II. Induced Expression
[0138] 1. Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria.
[0139] 2. Inoculate the recombinant bacteria obtained in step 1 into liquid LB medium containing 100 μg / ml ampicillin and culture overnight at 37°C with shaking at 200 rpm.
[0140] 3. Inoculate the bacterial culture obtained in step 2 into liquid LB medium and incubate at 30°C with shaking at 230 rpm until OD reaches 100%. 600nm The concentration was set to 1.0, then isopropyl thiogalactoside (IPTG) was added to a concentration of 0.5 mM in the system. The mixture was then cultured at 25°C and 230 rpm for 12 hours with shaking. Finally, the cells were collected by centrifugation at 4°C and 10,000 g for 15 minutes.
[0141] 4. Take the bacterial cells obtained in step 3 and wash them with PBS buffer.
[0142] III. Purification of the fusion protein TrxA-His-EK-NLS-spCas9-NLS
[0143] 1. Take the bacterial cells obtained in step 2, add crude extraction buffer and suspend the bacterial cells, then homogenize the bacterial cells using a homogenizer (3 cycles at 1000 par), then centrifuge at 4℃ and 15000g for 30 min, collect the supernatant, filter the supernatant through a 0.22μm pore size filter membrane, and collect the filtrate. In this step, 10 ml of crude extraction buffer is prepared for every gram of wet bacterial cells.
[0144] Crude extraction buffer: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, 1mM PMSF, with the balance being ddH2O.
[0145] 2. Affinity chromatography was used to purify the fusion protein.
[0146] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then load 50 ml of the filtrate obtained in step 1 (flow rate: 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate: 1 ml / min) to remove contaminating proteins; finally, elute with 10 column volumes of elution buffer at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).
[0147] Ni-NTA agarose column: GenScript, L00250 / L00250-C, 10ml packing material.
[0148] Equilibrium solution: contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, and the balance is ddH2O.
[0149] Buffer solution: containing 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 50 mM Imidazole, with the balance being ddH2O.
[0150] Eluent: Contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, and the balance is ddH2O.
[0151] IV. Enzymatic digestion of the fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein
[0152] 1. Take 15 ml of the post-column solution collected in step 3, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, 15 ml capacity), and then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0). Use 6 ultrafiltration tubes to obtain a total of 6 ml.
[0153] 2. Add the commercially available His6-tagged recombinant bovine enterokinase (Sangon Biotech, C620031, Recombinant Bovine Enterokinase Light Chain, His6-tagged) to the solution obtained in step 1 (approximately 6 ml), and digest at 25°C for 16 hours. Add 2 units of enterokinase per 50 μg of protein.
[0154] 3. Take the solution from step 2 (about 6 ml) and mix it with 480 μl of Ni-NTA resin (GenScript, L00250 / L00250-C). Mix by rotation at room temperature for 15 min, then centrifuge at 7000 g for 3 min and collect the supernatant (4-5.5 ml).
[0155] 4. Take the supernatant obtained in step 3 and concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml). Then add it to the enzyme storage solution and adjust the protein concentration to 5 mg / ml to obtain the NCN protein solution.
[0156] Sequencing revealed that the N-terminal 15 amino acid residues in the NCN protein solution are as shown in positions 1 to 15 of SEQ ID NO: 3, which is the NCN protein.
[0157] The NCN protein used in subsequent embodiments was provided by an NCN protein solution.
[0158] Enzyme stock solution (pH 7.4): contains 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% (v / v) glycerol, with the balance being ddH2O.
[0159] Example 2: Performance of NCN protein
[0160] The following two gRNA targets targeting the TTN gene were selected:
[0161] TTN-gRNA1 target: AGAGCACAGTCAGCCTGGCG;
[0162] TTN-gRNA2 target: CTTCCAGAATTGGATCTCCG.
[0163] The primers used to identify target fragments containing gRNA from the TTN gene are as follows:
[0164] TTN-F55: TACGGAATTGGGGAGCCAGCGGA;
[0165] TTN-R560: CAAAGTTAACTCTCTGTGTCT.
[0166] I. Preparation of gRNA
[0167] 1. Preparation of TTN-T7-gRNA1 and TTN-T7-gRNA2 transcription templates
[0168] The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 4.
[0169] The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 5.
[0170] 2. Obtain gRNA through in vitro transcription
[0171] Using TTN-T7-gRNA1 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The TTN-gRNA1 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908). TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 6.
[0172] Using TTN-T7-gRNA2 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The TTN-gRNA2 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908). TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 7.
[0173] II. Optimization of the ratio of gRNA to NCN protein
[0174] 1. Co-transfection of porcine primary fibroblasts
[0175] Group 1: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 0.5 μg TTN-gRNA1 : 0.5 μg TTN-gRNA2 : 4 μg NCN protein.
[0176] Group 2: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 0.75 μg TTN-gRNA1 : 0.75 μg TTN-gRNA2 : 4 μg NCN protein.
[0177] Group 3: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg NCN protein.
[0178] Group 4: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 1.25 μg TTN-gRNA1 : 1.25 μg TTN-gRNA2 : 4 μg NCN protein.
[0179] Group 5: TTN-gRNA1 and TTN-gRNA2 were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.
[0180] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).
[0181] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.
[0182] 3. After completing step 2, cells were digested and collected with trypsin, genomic DNA was extracted, and PCR amplification was performed using primers consisting of TTN-F55 and TTN-R560, followed by 1% agarose gel electrophoresis.
[0183] See electrophoresis image Figure 3The 505bp band is the wild-type band (WT), and the band around 254bp (the wild-type band theoretically has a deletion of 251bp) is the deletion mutation band (MT).
[0184] Gene deletion mutation efficiency = (MT gray level / MT band bp) / (WT gray level / WT band bp + MT gray level / MT band bp) × 100%. The gene deletion mutation efficiency of the first group is 19.9%, the gene deletion mutation efficiency of the second group is 39.9%, the gene deletion mutation efficiency of the third group is 79.9%, and the gene deletion mutation efficiency of the fourth group is 44.3%. No mutation occurred in the fifth group.
[0185] The results showed that the gene editing efficiency was highest when the mass ratio of the two gRNAs to the NCN protein was 1:1:4, and the actual dosage was 1 μg:1 μg:4 μg. Therefore, the optimal dosage of the two gRNAs to the NCN protein was determined to be 1 μg:1 μg:4 μg.
[0186] III. Comparison of gene editing efficiency between NCN protein and commercial Cas9 protein
[0187] 1. Co-transfection of porcine primary fibroblasts
[0188] Cas9-A group: TTN-gRNA1, TTN-gRNA2, and commercial Cas9-A protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts : 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg Cas9-A protein.
[0189] pKG-GE4 group: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg NCN protein.
[0190] Cas9-B group: TTN-gRNA1, TTN-gRNA2, and commercial Cas9-B protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts : 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg Cas9-B protein.
[0191] Control group: porcine primary fibroblasts were co-transfected with TTN-gRNA1 and TTN-gRNA2. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2.
[0192] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).
[0193] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.
[0194] 3. After completing step 2, cells were digested and collected with trypsin, genomic DNA was extracted, and PCR amplification was performed using primers consisting of TTN-F55 and TTN-R560, followed by 1% agarose gel electrophoresis.
[0195] See electrophoresis image Figure 4 The gene deletion mutation efficiency using commercial Cas9-A protein was 28.5%, that using NCN protein was 85.6%, and that using commercial Cas9-B protein was 16.6%.
[0196] The results showed that, compared with commercially available Cas9 protein, the NCN protein prepared using this invention significantly improved gene editing efficiency.
[0197] Example 3: Screening for highly efficient gRNA targets of the HTT gene
[0198] Information on the porcine HTT gene: Encodes huntingtin protein; located on chromosome 8; Gene ID: 397014, Susscrofa. The amino acid sequence of the protein encoded by the porcine HTT gene is shown in SEQ ID NO: 8. The porcine genomic DNA contains 69 exons; the first coding exon and its upstream 2000 bp and downstream 1000 bp are shown in SEQ ID NO: 9.
[0199] The plasmid pKG-GE3 is a circular plasmid, as shown in SEQ ID NO: 2 of patent application 202010084343.6. In SEQ ID NO: 2 of patent application 202010084343.6, nucleotides 395-680 form the CMV enhancer, nucleotides 682-890 form the EF1a promoter, nucleotides 986-1006 encode the nuclear localization signal (NLS), nucleotides 1016-1036 encode the nuclear localization signal (NLS), nucleotides 1037-5161 encode the Cas9 protein, nucleotides 5162-5209 encode the nuclear localization signal (NLS), nucleotides 5219-5266 encode the nuclear localization signal (NLS), and nucleotides 5276-5332 encode polypeptide P2A (the amino acid sequence of polypeptide P2A is “ATNFSLLKQAGDVEENPGP”, with the break point at…). Nucleotides 5333-6046 (between the first and second amino acid residues at the C-terminus) encode the EGFP protein, nucleotides 6056-6109 encode polypeptide T2A (the amino acid sequence of polypeptide T2A is “EGRGSLLTCGDVEENPGP”, with the break point between the first and second amino acid residues at the C-terminus), nucleotides 6110-6703 encode the Puromycin protein (abbreviated as Puro protein), nucleotides 6722-7310 form the WPRE sequence element, nucleotides 7382-7615 form the 3'LTR sequence element, and nucleotides 7647-7871 form the bGH poly(A)signal sequence element. In SEQ ID NO: 2 of patent application 202010084343.6, nucleotides 911-6706 form a fusion gene, expressing a fusion protein. Due to the presence of the self-cleaving peptide P2A and the self-cleaving peptide T2A, the fusion protein spontaneously forms the following three proteins: a protein with Cas9 protein, a protein with EGFP protein, and a protein with Puro protein.
[0200] The pKG-U6gRNA vector, or plasmid pKG-U6gRNA, is a circular plasmid, as shown in SEQ ID NO: 3 of patent application 202010084343.6. In SEQ ID NO: 3 of patent application 202010084343.6, nucleotides 2280-2539 form the hU6 promoter, and nucleotides 2558-2637 are used for transcription to form the gRNA backbone. In use, a DNA molecule of approximately 20 bp (the target sequence binding region for gRNA transcription) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid. The recombinant plasmid is then transcribed into gRNA in cells.
[0201] I. Conservation analysis of the pre-defined deletion region of the HTT gene and adjacent genomic sequences
[0202] Ten newborn Bama miniature pigs were selected, including six females (named BC1, BC2, BC3, BC4, BC5, and BC6) and four males (named BX1, BX2, BX3, and BX4).
[0203] HTT-E1-JDF1925: CGTCTTTGGTTGTCAATCCCG;
[0204] HTT-E1-JDR2875: CTAAACAGCGCACCACGAAC.
[0205] Using genomic DNA from 10 pigs as templates, PCR amplification was performed using primer pairs consisting of HTT-E1-JDF1925 and HTT-E1-JDR2875, followed by 1% agarose gel electrophoresis. (See electrophoresis image below.) Figure 5 PCR amplification products were recovered and sequenced. The sequencing results were compared with HTT gene sequences in public databases. Conserved regions common to 10 pigs were selected for gRNA target design.
[0206] II. Target Screening
[0207] Several targets were initially screened by NGG (avoiding possible mutation sites), and 6 targets were further screened out after preliminary experiments.
[0208] The six target points are as follows:
[0209] HTT-E1-gU1 target: CGCTGCTGAGCGGAGCCCCG;
[0210] HTT-E1-gU2 target: CTTTTCCAGGGTCGCCATGG;
[0211] HTT-E1-gU3 target: AGCTTTCATCAGCTTTTCCA.
[0212] HTT-E1-gD1 target: AGGGGGCCCGCACTCACGGT;
[0213] HTT-E1-gD2 target: CGCACTCACGGTCGGTGCAG;
[0214] HTT-E1-gD3 target: CGCTGCACCGACCGTGAGTG.
[0215] III. Preparation of gRNA
[0216] plasmid pKG-U6gRNA was digested with restriction endonuclease BbsI, and the vector backbone (a large linear fragment of about 3kb) was recovered.
[0217] HTT-E1-gU1-S and HTT-E1-gU1-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(HTT-E1-gU1). Plasmid pKG-U6gRNA(HTT-E1-gU1) expresses the sgRNA shown in SEQ ID NO: 10. HTT-E1-gU1 sgRNA HTT-E1-gU1 (SEQ ID NO: 10):
[0218] CGCUGCUGAGCGGAGCCCCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
[0219] HTT-E1-gU2-S and HTT-E1-gU2-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(HTT-E1-gU2). Plasmid pKG-U6gRNA(HTT-E1-gU2) expresses the sgRNA shown in SEQ ID NO: 11. HTT-E1-gU2 sgRNA HTT-E1-gU2 (SEQ ID NO: 11):
[0220] CUUUUCCAGGGUCGCCAUGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
[0221] HTT-E1-gU3-S and HTT-E1-gU3-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(HTT-E1-gU3). Plasmid pKG-U6gRNA(HTT-E1-gU3) expresses the sgRNA shown in SEQ ID NO: 12. HTT-E1-gU3 sgRNA HTT-E1-gU3 (SEQ ID NO: 12):
[0222] AGCUUUCAUCAGCUUUUCCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
[0223] HTT-E1-gD1-S and HTT-E1-gD1-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(HTT-E1-gD1). Plasmid pKG-U6gRNA(HTT-E1-gD1) expresses the sgRNA shown in SEQ ID NO: 13. HTT-E1-gD1 sgRNA HTT-E1-gD1 (SEQ ID NO: 13):
[0224] AGGGGGCCCGCACUCACGGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
[0225] HTT-E1-gD2-S and HTT-E1-gD2-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(HTT-E1-gD2). Plasmid pKG-U6gRNA(HTT-E1-gD2) expresses the sgRNA shown in SEQ ID NO: 14. HTT-E1-gD2 sgRNA HTT-E1-gD2 (SEQ ID NO: 14):
[0226] CGCACUCACGGUCGGUGCAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
[0227] HTT-E1-gD3-S and HTT-E1-gD3-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(HTT-E1-gD3). Plasmid pKG-U6gRNA(HTT-E1-gD3) expresses the sgRNA shown in SEQ ID NO: 15.HTT-E1-gD3 。sgRNA HTT-E1-gD3 (SEQ ID NO:15):
[0228] CGCUGCACCGACCGUGAGUGguuuuagagcuagaaauagcaaguuaaaaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
[0229] HTT-E1-gU1-S:caccgCGCTGCTGAGCGGAGCCCCG;
[0230] HTT-E1-gU1-A:aaacCGGGGCTCCGCTCAGCAGCGc;
[0231] HTT-E1-gU2-S:caccgCTTTTCCAGGGTCGCCATGG;
[0232] HTT-E1-gU2-A:aaacCCATGGCGACCCTGGAAAAGc;
[0233] HTT-E1-gU3-S:caccgAGCTTTCATCAGCTTTTCCA;
[0234] HTT-E1-gU3-A:aaacTGGAAAAGCTGATGAAAGCTc;
[0235] HTT-E1-gD1-S:caccgAGGGGGCCCGCACTCACGGT;
[0236] HTT-E1-gD1-A:aaacACCGTGAGTGCGGGCCCCCTc;
[0237] HTT-E1-gD2-S:caccgCGCACTCACGGTCGGTGCAG;
[0238] HTT-E1-gD2-A:aaacCTGCACCGACCGTGAGTGCGc;
[0239] HTT-E1-gD3-S:caccgCGCTGCACCGACCGTGAGTG;
[0240] HTT-E1-gD3-A:aaacCACTCACGGTCGGTGCAGCGc。
[0241] HTT-E1-gU1-S, HTT-E1-gU1-A, HTT-E1-gU2-S, HTT-E1-gU2-A, HTT-E1-gU3-S, HTT-E1-gU3-A, HTT-E1-gD1-S, HTT-E1-gD1-A, HTT-E1-gD2-S, HTT-E1-gD2-A, HTT-E1-gD3-S, and HTT-E1-gD3-A are all single-stranded DNA molecules.
[0242] IV. Comparison of editing efficiency for different target combinations
[0243] 1. Co-transfection
[0244] Group 1: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (HTT-E1-gU1) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (HTT-E1-gU1): 1.08 μg of plasmid pKG-GE3.
[0245] Group 2: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (HTT-E1-gU2) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (HTT-E1-gU2): 1.08 μg of plasmid pKG-GE3.
[0246] Group 3: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (HTT-E1-gU3) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (HTT-E1-gU3): 1.08 μg of plasmid pKG-GE3.
[0247] Group 4: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (HTT-E1-gD1) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (HTT-E1-gD1): 1.08 μg of plasmid pKG-GE3.
[0248] Group 5: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (HTT-E1-gD2) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (HTT-E1-gD2): 1.08 μg of plasmid pKG-GE3.
[0249] Group 6: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (HTT-E1-gD3) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (HTT-E1-gD3): 1.08 μg of plasmid pKG-GE3.
[0250] Group 7: Primary porcine fibroblasts were electroporated without plasmids using the same electroporation parameters.
[0251] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).
[0252] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.
[0253] 3. After completing step 2, cells were digested and collected using trypsin, lysed, and genomic DNA was extracted. PCR amplification was performed using primer pairs consisting of HTT-E1-JDF1925 and HTT-E1-JDR2875, followed by 1% agarose gel electrophoresis to detect mutations in target genes.
[0254] After gel extraction and recovery of the target product, it was sent to a sequencing company for sequencing. The sequencing results were then analyzed using the web-based Synthego ICE tool to determine the gene editing efficiency at different target sites. The gene editing efficiencies of groups 1, 2, 3, 4, 5, and 6 were 15%, 28%, 48%, 65%, 32%, and 8%, respectively, while no gene editing occurred in group 7. These results indicate that sgRNA... HTT-E1-gU3 and sgRNA HTT-E1-gD1 The editing efficiency is relatively high.
[0255] Example 4: Preparation of a single-cell clone of Bama miniature pig with HTT gene recombinant
[0256] I. Construction of the PB-puroR-hHTTex1(81Q)Donor vector
[0257] The PB-puroR-hHTTex1(81Q) Donor vector is the plasmid PB-puroR-hHTTex1(81Q).
[0258] The plasmid PB-puroR-hHTTex1(81Q), as shown in SEQ ID NO: 16, is a circular plasmid. A schematic diagram of its structure is shown below. Figure 6In SEQ ID NO: 16, nucleotides 1-1070 form the left arm, and nucleotides 1071-1667 encode the Puromycin resistance protein (abbreviated as Puromycin). R The protein, with nucleotides 1677-1733 encoding the P2A polypeptide (the amino acid sequence of the P2A polypeptide is "ATNFSLLKQAGDVEENPGP", and the self-cleavage occurs between the first and second amino acid residues at the C-terminus), nucleotides 1734-2176 being the human HTT gene exon 1 used to replace porcine HTT gene exon 1 (which encodes a protein segment with 81 consecutive amino acid residues Q), and nucleotides 2177-2671 forming the downstream homologous arm (Right Arm).
[0259] II. Preparation of gRNA
[0260] Two highly efficient gRNA targets (HTT-E1-gU3 target and HTT-E1-gD1 target) were selected from the screening in Example 3.
[0261] 1. Preparation of HTT-T7-gU3 and HTT-T7-gD1 transcription templates
[0262] The HTT-T7-gU3 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 17.
[0263] The HTT-T7-gD1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 18.
[0264] 2. Obtain gRNA through in vitro transcription
[0265] Using HTT-T7-gU3 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The sgRNA was recovered and purified using the Transcription Clean-Up Kit (Thermo, AM1908). HTT-gU3 sgRNA HTT-gU3 It is a single-stranded RNA, as shown in SEQ ID NO: 19.
[0266] Using HTT-T7-gD1 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing.TM The sgRNA was recovered and purified using the Transcription Clean-Up Kit (Thermo, AM1908). HTT-gD1 sgRNA HTT-gD1 It is a single-stranded RNA, as shown in SEQ ID NO: 20.
[0267] sgRNA HTT-gU3 (SEQ ID NO: 19):
[0268] GGAGCUUUCCAUCAGCUUUUCCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU
[0269] sgRNA HTT-gD1 (SEQ ID NO: 20):
[0270] GGAGGGGGCCCGCACUCACGGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU
[0271] III. Transfection of porcine primary fibroblasts
[0272] sgRNA HTT-gU3 sgRNA HTT-gD1 Porcine primary fibroblasts were co-transfected with plasmid PB-puroR-hHTTex1(81Q) and NCN protein. The ratio was approximately 200,000 porcine primary fibroblasts to 1 μg sgRNA. HTT-gU3 1 μg sgRNA HTT-gD1 2 μg plasmid PB-puroR-hHTTex1(81Q) and 4 μg NCN protein were used for co-transfection. Electroporation was performed using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).
[0273] IV. Purinomycin-based pressure screening
[0274] 1. Screening for positive cells with puroR-hHTTex1(81Q) gene insertion using puromycin
[0275] (1) After completing step three, culture in complete culture medium for 16-18 hours, then replace with new complete culture medium for further culture. The total culture time is 48 hours.
[0276] (2) After completing step (1), replace the culture medium with a complete culture medium containing 1.5 μg / mL puromycin for screening culture (replace with a new complete culture medium containing 1.5 μg / mL puromycin every day) for 3 weeks.
[0277] After one week of screening and culture, a large number of cells died.
[0278] After two weeks of screening and culture, only a few cells died, while some positive clones began to divide and proliferate, and the number of cells continued to increase.
[0279] The purpose of the third week of screening culture is to ensure complete degradation of intracellular plasmids in order to eliminate false-positive cell clones.
[0280] (3) After completing step (2), collect the cells and use complete culture medium to restore the cells to a good state for the next step of single cell sorting.
[0281] 2. Single-cell sorting and scale-up culture
[0282] (1) After completing step 1, collect cells, digest them with trypsin, neutralize them with complete culture medium, centrifuge at 500g for 5min, discard the supernatant, resuspend the pellet in 1mL of complete culture medium and dilute appropriately, pick single cells with a pipette and transfer them to a 96-well plate (pre-add 100μl of complete culture medium to each well and seed one cell per well) and culture for 2 days, then replace with complete culture medium containing 1.5μg / mL puromycin (replace with new complete culture medium containing 1.5μg / mL puromycin every 2-3 days, observe the cell growth in each well with a microscope during this period, and exclude wells without cells or non-single-cell clones).
[0283] (2) When the cells in the wells of the 96-well plate from step (1) have filled the bottom of the wells (about 2 weeks), digest them with trypsin and collect the cells. Two-thirds of the cells are seeded into 6-well plates containing complete culture medium, and the remaining one-third of the cells are collected in 1.5 mL centrifuge tubes.
[0284] (3) When the cells in the wells of the 6-well plate in step (2) reach 50% fullness, digest them with 0.25% (Gibco) trypsin and collect the cells. Use cell cryopreservation solution (90% complete culture medium + 10% DMSO, volume ratio) to freeze the cells.
[0285] V. Identification of homologous recombination in exon 1 of the porcine HTT gene at the genomic level
[0286] To detect whether the target exogenous DNA fragment (as shown in nucleotides 1071-2176 of SEQ ID NO: 16) has been integrated into the pig genome through homologous recombination and replaced the target region in the genomic DNA (as shown in nucleotides 2001-2236 of SEQ ID NO: 9), the centrifuge tube from step 2(2) of step four was used to extract cellular genomic DNA. PCR amplification was performed using specific primer pairs (the specific primer pairs were: the upstream primer pair consisting of HTTex1-Lr-JDF and HTTex1-Lr-JDR, the downstream primer pair consisting of HTTex-Rr-JDF and HTTex-Rr-JDR, and the middle primer pair consisting of HTTex1-wt-JDF and HTTex1-wt-JDR), followed by electrophoresis, and the PCR products were recovered and sequenced. Primary pig fibroblasts were used as wild-type controls (WT).
[0287] The primer pair consisting of HTTex1-Lr-JDF and HTTex1-Lr-JDR was used to identify whether the 5' end of the target exogenous DNA fragment had successfully recombinated (target sequence is 1796 bp). Electrophoresis results are shown below. Figure 7 The primer pair consisting of HTTex1-Rr-JDF and HTTex1-Rr-JDR was used to identify whether the 3' end of the target exogenous DNA fragment had successfully recombinated (target sequence is 1539 bp). Electrophoresis results are shown below. Figure 8 The primer pair consisting of HTTex1-wt-JDF and HTTex1-wt-JDR was used to identify whether the recombinant cells were homozygous or heterozygous (a 652bp fragment was amplified using the target region of the genomic DNA as a template, and a 1522bp fragment was amplified using the target exogenous DNA fragment as a template). If only the 1522bp fragment was amplified, it indicates that the cell is a homozygous recombinant cell where the target exogenous DNA fragment has integrated into the pig genome and replaced the target region of the genomic DNA (the same recombination occurred on a pair of homologous chromosomes). If both the 652bp and 1522bp fragments were amplified, it indicates that the cell is a heterozygous recombinant cell where the target exogenous DNA fragment has integrated into the pig genome and replaced the target region of the genomic DNA (one of the pair of homologous chromosomes underwent recombination, and the other remained wild-type). If only the 652bp fragment was amplified, it indicates that the cell is a wild-type cell (neither pair of homologous chromosomes underwent recombination). Electrophoresis results are shown in [Figure number missing]. Figure 9 .
[0288] HTTex1-Lr-JDF:ATGGACAGCAAGTCAGAGGC;
[0289] HTTex1-Lr-JDR: CGTGGGCTTGTACTCGGTC;
[0290] HTTex1-Rr-JDF:GCCACATCGAGCGGG;
[0291] HTTex1-Rr-JDR:GTCAACTCGACCCAATACTCCA;
[0292] HTTex1-wt-JDF:CCCGAGTCCCATTCATTGCC;
[0293] HTTex1-wt-JDR: CTCGGAAAGGACTCGCCATT.
[0294] The genotyping results of 32 randomly selected single-cell clones are shown in Table 1. Single-cell clone numbered 12 is a wild-type cell, single-cell clones numbered 6, 19, 24 and 30 are homozygous recombinant cells, and the remaining single-cell clones are heterozygous recombinant cells.
[0295] Table 1
[0296]
[0297] The amplification products of all cells in Table 1 were verified to be correct by Sanger sequencing. Taking the single-cell clone numbered 1 as an example, the sequencing peak diagram of the PCR amplification product of the upstream primer pair is shown in [Figure 1]. Figure 10 The sequencing peak diagram of the PCR amplification products of the downstream primer pair is shown in the figure. Figure 11 .
[0298] Whole-genome sequencing was performed on a subset of cells listed in Table 1 to detect site-specific integration of exogenous DNA fragments and to simultaneously detect random integration. No random integration of exogenous DNA fragments was found in any of the single-cell clones analyzed by whole-genome sequencing.
[0299] Whole-genome sequencing revealed that, compared with primary porcine fibroblasts from the same source, the only difference in the genomic DNA of homozygous recombinant cells was that the target region in the genomic DNA was replaced by the target exogenous DNA fragment, and the cells were homozygous (i.e., the same substitution occurred on both homologous chromosomes).
[0300] Whole-genome sequencing revealed that, compared with primary porcine fibroblasts from the same source, the only difference in the genomic DNA of the heterozygous recombinant cells was that the target region in the genomic DNA was replaced by the target exogenous DNA fragment, and the cells were heterozygous (i.e., one chromosome in a pair of homologous chromosomes was replaced while the other chromosome was not replaced).
[0301] The target exogenous DNA fragment is shown as nucleotides 1071-2176 in SEQ ID NO: 16. The target region is shown as nucleotides 2001-2236 in SEQ ID NO: 9.
[0302] The aforementioned heterozygous and homozygous recombinant cells are both target recombinant cells. Using these target recombinant cells as nuclear transfer donor cells for somatic cell cloning yields cloned pigs, which are the Huntington's disease model pigs.
[0303] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. A method for preparing recombinant pig cells, comprising the following steps: replacing a target region in the chromosomal DNA of pig cells with a DNA molecule named DNA molecule A, thereby obtaining recombinant pig cells; The DNA molecule A is the DNA molecule represented by nucleotides 1071-2176 in SEQ ID NO: 16; The target region is the DNA molecule represented by nucleotides 2001-2236 in SEQ ID NO: 9; The method to replace the target region in the chromosomal DNA of pig cells with a DNA molecule named DNA molecule A is as follows: sgRNA is used... HTT-gU3 sgRNA HTT-gD1 Porcine cells were co-transfected with donor plasmid and NCN protein; the donor plasmid contained the DNA molecule A; the sgRNA HTT-gU3 The sgRNA has a target sequence binding region as shown in nucleotides 3-22 of SEQ ID NO: 19; the sgRNA HTT-gD1 The sgRNA has a target sequence binding region as shown in nucleotides 3-22 of SEQ ID NO: 20; the NCN protein is shown in SEQ ID NO:
3. The method for preparing the NCN protein includes the following steps: (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria; (2) The recombinant bacteria were cultured in liquid culture medium at 30°C, then IPTG was added and the culture was induced at 25°C, and then the bacterial cells were collected; (3) The collected bacterial cells were broken down to collect the crude protein solution; (4) The His6-tagged fusion protein was purified from the crude protein solution by affinity chromatography; (5) The His6-tagged fusion protein was digested with His6-tagged enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein. The gene encoding the fusion protein in plasmid pKG-GE4 is shown in nucleotides 5209-9852 of SEQ ID NO:
1.
2. A kit comprising sgRNA HTT-gU3 sgRNA HTT-gD1 Donor plasmids and NCN proteins; The sgRNA HTT-gU3 The sgRNA as described in claim 1 HTT-gU3 ; The sgRNA HTT-gD1 The sgRNA as described in claim 1 HTT-gD1 ; The donor plasmid is the donor plasmid described in claim 1; The NCN protein is the NCN protein described in claim 1; The kit is intended for use as follows (a), (b), or (c): (a) to prepare recombinant porcine cells; (b) to prepare Huntington's disease model pigs; (c) to prepare Huntington's disease cell models, tissue models, or organ models.
3. sgRNA HTT-gU3 sgRNA HTT-gD1 Application of donor plasmids and NCN proteins in the preparation kit; The sgRNA HTT-gU3 The sgRNA as described in claim 1 HTT-gU3 ; The sgRNA HTT-gD1 The sgRNA as described in claim 1 HTT-gD1 ; The donor plasmid is the donor plasmid described in claim 1; The NCN protein is the NCN protein described in claim 1; The kit is intended for use as follows (a), (b), or (c): (a) to prepare recombinant porcine cells; (b) to prepare Huntington's disease model pigs; (c) to prepare Huntington's disease cell models, tissue models, or organ models.
Citation Information
Patent Citations
CRISPR / Cas9 system and application thereof in construction of swine-derived recombinant cells with insulin receptor substrate gene defects
CN112522255A
Recombinant vector for knock-in of human Huntington gene, construction method of recombinant vector and application of recombinant vector in construction of model pig
CN107988256A
DNA template for modifying primary cells by gene editing and fixed-point insertion method
CN112210573A