Methods for directed transfer of heterochromatin

Abstract

The present application provides a method for directional transfer of heterologous chromosomes, which comprises the following steps: artificially adding a functional intron containing a loxP sequence into a drug resistance gene, splitting the drug resistance gene into two parts with an overlapping region containing a loxP sequence, inserting the two parts of the drug resistance gene into target chromosomes of a donor species and a recipient species respectively (the two parts of the drug resistance gene undergo Cre / loxP site-specific recombination under the action of a Cre recombinase, and the drug resistance function is recovered), and realizing directional transfer of heterologous chromosomes by means of heterologous cell fusion. The method can be widely applied to gene function research, construction of human disease models, development of therapeutic antibodies, and pharmacological and pharmacodynamic tests.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of genetic engineering, and particularly relates to a method for directional transfer of heterologous chromosomes. BACKGROUND

[0002] Transgenic technology refers to a technology of transferring exogenous DNA into the genome of an animal and producing a heritable modification. An animal stably carrying exogenous DNA produced by the technology is a transgenic animal. When the exogenous DNA contains human genome information, the obtained transgenic animal is called a humanized animal. With the continuous development of genetic engineering technology, humanized animal models have gradually realized humanization from individual bases or amino acids to large gene clusters and even chromosomes. So far, a variety of humanized animals expressing human genes have been obtained, and these animal models are widely used in the research of gene function, the construction of human disease models, the development of therapeutic antibodies, the testing of pharmacological efficacy, and the like, which has strongly promoted the in-depth research on human diseases and health (Devoy et al., 2011; Moriwaki et al., 2020; Scheer and Wilson, 2016; Zhu et al., 2019).

[0003] Among these humanized animal models, humanized mouse models have become an increasingly important tool for studying human diseases. The main applications include immunoglobulin humanized mouse models and Down syndrome mouse models.

[0004] The relatively mature immunoglobulin humanized mouse models currently include HuMab mice (Lonberg et al., 1994), Xeno mice (Green et al., 1994), Tc mice (Tomizuka et al., 2000), VelocImmune mice and Ky mice (Lee et al., 2014; Macdonald et al., 2014; Murphy et al., 2014). Compared with murine antibodies, human-mouse chimeric antibodies and humanized antibodies, fully human antibodies produced by these immunoglobulin humanized mouse models have low immunogenicity and high success rate of clinical application transformation (Carter, 2006; Hwang and Foote, 2005; Lonberg, 2005), which provides the possibility of screening more therapeutic antibodies.

[0005] Down syndrome, also known as trisomy 21 syndrome or congenital idiocy, is a disease caused by abnormality of human chromosome 21, with an incidence of 1 / 800 in newborns (Driscoll and Gross, 2009). Sixty percent of fetuses are aborted, and the surviving children have special facial features, low intelligence, and growth and development deformities (Korenberg et al., 1994). Due to the high mortality rate and strong developmental defects of Down syndrome, it is imperative to construct an animal model that can simulate human disease for research on the causes of the disease and the exploration of treatment methods.

[0006] Ts65Dn (Davisson et al., 1990) and Ts1Cje (Sago et al., 1998) are both Down syndrome mouse models and have been widely used in the study of the pathogenesis and drugs of Down syndrome. They are Down syndrome models obtained from spontaneous chromosomal abnormalities in mice induced by radiation. The Tc1 model is obtained by irradiating microcells to transfer human chromosome 21 into mouse embryonic stem cells. The transferred human chromosome is free in the mouse genome, but the random loss probability in mouse somatic cells is 25% (Hernandez et al., 1999). The TcMac21 model is constructed by splicing the long arm of human chromosome 21 to the mouse centromere to form a more stable artificial chromosome in mouse cells, and then transferring it into mouse embryonic stem cells by microcell-mediated chromosome transfer. This model does not exhibit the phenomenon of loss of exogenous chromosomes in somatic cells (Kazuki et al., 2020).

[0007] Numerous studies have shown that human DNA information in genome humanized mice can be correctly transcribed and expressed in the mouse transcription system. However, in the process of achieving Mb-level genome humanization, the carrying capacity of transgenic vectors and gene transfer technology have been greatly challenged (Brüggemann et al., 1989). Current common genome humanization techniques include: recombinant yeast artificial chromosome (YAC) mediated method, bacterial artificial chromosome (BAC) mediated continuous homologous recombination method, recombinase-mediated genome replacement method (RMGR), and microcell-mediated chromosome transfer method (MMCT).

[0008] The carrying capacity of YAC exogenous genes is generally 1-2 Mb, but after entering the recipient cells, it is integrated into the recipient genome in a random integration form. The integration position not only has an unpredictable impact on mouse endogenous genes, but also may affect the expression of human genes. In addition, during the construction of YAC, the vector itself is prone to recombination events, and the size and type of exogenous genes transferred are greatly limited (Bellis et al., 1991).

[0009] The carrying capacity of MAC for foreign genes meets the requirements of super large DNA. If a MAC containing a target human DNA is to be obtained, multiple loxP sites need to be knocked in near the target gene, and the target MAC is finally obtained through multiple Cre / loxP recombination. Conventional gene transfer techniques cannot realize the transfer of MAC into recipient cells. The most commonly used MAC transfer method is the microcell fusion method, i.e., the MMCT technology. However, most human cells cannot effectively produce microcells. The production of MAC microcells generally needs to rely on hybrid cells produced by the fusion of human cells and A9 cells or CHO cells. The MMCT process involves one cell-cell fusion and one microcell-cell fusion experiment. The efficiency of this process is usually 10 -7 -10 -4 , and the MAC stably exists in the genome of the transgenic animal. In addition, the MAC obtained is unstable in the genome of the recipient, and there is a loss of the MAC in some tissues and organs of the humanized mouse (Kazuki et al., 2004).

[0010] The carrying capacity of BAC for foreign genes is only 300 kb. By combining BAC with homologous recombination technology, Cre / loxP recombination system or piggyBac transposon system, multiple human genes can be transferred to specific sites. This technology needs to prepare multiple chimeras and homozygotes, which is very time-consuming (Lee et al., 2014; Macdonald et al., 2014).

[0011] After the fusion of human and mouse cells, a large number of human chromosomes are lost, while mouse chromosomes tend to be completely retained (Weiss and Green, 1967). Some research groups have transferred natural human chromosomes to mouse embryonic stem cells by MMCT technology to obtain immunoglobulin humanized and Down syndrome model mice. However, different human chromosomes have different stabilities in mouse cells, and there is a phenomenon of loss of human chromosomes in some tissues and organs of the transgenic mouse.

[0012] The existing genome humanization technology is time-consuming and laborious, and the efficiency is very low. Therefore, simplifying the construction process of super large human transgenic vectors, improving the transfer efficiency of super large DNA, and ensuring the stability of human genes transferred into mouse cells and tissues are of great significance for obtaining more genome humanized animal models, screening more human disease therapeutic drugs, revealing the pathogenesis of human diseases, and studying the function of non-coding regions. SUMMARY

[0013] The purpose of the present application is to provide a method for the directional transfer of heterologous chromosomes.

[0014] In order to achieve the object of the present application, in a first aspect, the present application provides a recombinant translocation screening system for mediating targeted transfer of heterologous chromosomes, comprising a recipient cell gene editing vector and a donor cell gene editing vector.

[0015] The recipient cell gene editing vector comprises a gene editor 1 targeting the telomere proximal position of the recipient cell chromosome and a Donor DNA 1; the Donor DNA 1 is composed of the following elements: a promoter-5' drug resistance gene-a functional intron containing a loxP sequence.

[0016] The donor cell gene editing vector comprises a gene editor 2 targeting the centromere proximal position of the donor cell chromosome and a Donor DNA 2; the Donor DNA 2 is composed of the following elements: a functional intron containing a loxP sequence-3' drug resistance gene-polyA sequence.

[0017] The 5' drug resistance gene and the 3' drug resistance gene are the complete drug resistance gene artificially split into two parts, and the split 5' drug resistance gene and 3' drug resistance gene can undergo Cre / loxP site-specific recombination under the action of Cre recombinase, thereby restoring the drug resistance function.

[0018] Further, the position of the split drug resistance gene follows the principle of RNA splicing and refers to the conserved sequence information near the splicing site, and the base sequence is selected as AAGG or CAGG.

[0019] RNA splicing refers to the process that DNA is first transcribed into pre-messenger RNA in the presence of RNA polymerase, the intron is removed by splicing, and the exon is connected to become mature mRNA. The splicing donor site (SD) located at the 5' end of the intron, the splicing acceptor site (SA) located at the 3' end of the intron, and the branch site near the 3' end of the intron are the basic elements for the recognition and function of the RNA splicing body. The 5' end sequence of the eukaryotic intron starts with GT, and the 3' end sequence ends with AG. The sequence of the exon near the SD is mostly A / CAG (about 60%), and the sequence near the SA is mostly G (60%). The split position of the drug resistance gene in the present application is determined by using the relevant conserved sequence and the frequency of the base in eukaryotes.

[0020] The drug resistance gene can be neo or puro, and other drug resistance genes can also be selected.

[0021] The functional intron can be an SV40LT intron, and the sequence is shown in SEQ ID No: 1, which is an SV40LT intron after sequence optimization.

[0022] Preferably, the promoter is a Pol II promoter, and other common universal promoters can also be used.

[0023] Preferably, the gene editor is a targeting vector based on CRISPR-Cas9 technology, the gene editor 1 comprises an sgRNA targeting the pericentromere position of the chromosome of the recipient cell, and the gene editor 2 comprises an sgRNA targeting the pericentromere position of the chromosome of the donor cell.

[0024] The recipient cell and the donor cell in the application can be cells from different species.

[0025] Preferably, the recipient cell is from a mouse or a pig, and the donor cell is from a human.

[0026] More preferably, the recipient cell and the donor cell are stem cell lines from the corresponding species, including induced pluripotent stem cells.

[0027] In the application, the reference sequence of the loxP sequence is 5'-ATAACTTCGTATAGCATACATTATACGAA GTTAT-3'; and the reference sequence number of the Cre recombinase in NCBI is 2777477.

[0028] In theory, the chromosome targeting transfer method provided by the application can complete the transfer of a chromosome of Mbp level, such as a whole chromosome arm, so the insertion position of the exogenous drug resistance gene on the donor chromosome should be as close to the centromere position as possible to ensure the complete transfer of the whole chromosome arm. In addition, in order to ensure the integrity of the recipient chromosome, the insertion position of the exogenous drug resistance gene should be as close to the telomere position of the recipient chromosome as possible.

[0029] In a second aspect, the application provides a method for heterologous chromosome targeting transfer, comprising the following steps:

[0030] 1) introducing a gene editing vector for the recipient cell into the recipient cell to obtain cell I;

[0031] 2) introducing a gene editing vector for the donor cell into the donor cell to obtain cell II;

[0032] 3) fusing cell I and cell II to realize the targeting transfer of heterologous chromosomes (from the donor to the recipient).

[0033] Preferably, the method for cell fusion is physical fusion mediated by electric pulse.

[0034] The optimized conditions are: AC parameters 80Vrms-30s, branch parameters 1250V-30μs. The total amount of starting cells for fusion is about 6×10 8

[0035] ​More preferably, the donor cell is irradiated with a cobalt source before cell fusion.

[0036] The cobalt source irradiation average dose is 10 Gy / min, the optimal cobalt source irradiation dose of the donor human induced pluripotent stem cell is 120 Gy (irradiation for 12 min, for the recipient mouse zygote) and 120-180 Gy (irradiation for 12-18 min, for the recipient pig oocyte), and the optimal cobalt source irradiation dose of the donor A9H14 cell is 60 Gy (irradiation for 6 min, for the recipient mouse zygote or pig oocyte).

[0037] In a third aspect, the present application provides application of the recombination translocation screening system for mediating the targeted transfer of the heterologous chromosome or the method for the targeted transfer of the heterologous chromosome in the research of gene function, the construction of human disease model, the development of therapeutic antibody and the test of pharmacology and efficacy, etc.

[0038] By means of the above technical solution, the present application has at least the following advantages and beneficial effects:

[0039] (I) The method for the targeted transfer of the heterologous chromosome provided by the present application adopts the recombination translocation screening system, artificially splits the complete drug resistance gene into two parts, and respectively inserts the two parts into the target chromosome to be transferred. The split 5' drug resistance gene and 3' drug resistance gene can be recombined at the Cre / loxP site under the action of the Cre recombinase, so as to restore the drug resistance function. The cell containing the recombined chromosome has drug resistance, and the positive cell successfully having the chromosome transfer can be easily screened out by using the corresponding drug.

[0040] (II) The present application realizes the site-specific insertion of the recombination translocation screening system by using the CRISPR-Cas9 gene editing technology. Compared with the traditional homologous recombination mediated gene knock-in, the CRISPR / Cas9 technology has the advantages of simple sgRNA design and high gene knock-in efficiency. In theory, the CRISPR / Cas9 technology can be used to perform chromosome operation in the whole gene range in cooperation with the chromosome transfer method provided by the present application.

[0041] (III) The targeted transfer technology of the heterologous chromosome provided by the present application can be used for the construction of 21 trisomy syndrome animal model, the preparation of humanized antibody, the humanization of T cell receptor (TCR) and the humanization of major histocompatibility complex (MHC), etc., and is helpful for the research in the aspects of human disease model construction, therapeutic antibody development and pharmacology and efficacy test, etc.

[0042] (Four) The heterochromosomal targeted transfer technology provided by the application is also suitable for the targeted transfer of homologous or heterologous chromosomes of other species except mice and humans, and can be widely applied to the construction of animal models and the research of gene functions, etc. For example, the transfer of mammalian cell chromosomes required in synthetic biology, the restoration of ancient organisms by using gene information, and the transfer of bat cell chromosomes to other species to explore the genes regulating the life span and antiviral properties.

[0043] (Five) The heterochromosomal targeted transfer technology provided by the application is realized by physical fusion mediated by an electric pulse. In the fused cell, except for the donor chromosome fragments successfully transferred to the recipient chromosome, other donor chromosomes are naturally lost to ensure the normal karyotype of the fused cell.

[0044] (Five) The heterochromosomal targeted transfer technology provided by the application is realized by physical fusion mediated by an electric pulse. The donor and recipient cells used for fusion are stem cell lines from the corresponding species, so that the fused cell after the occurrence of chromosomal targeted transfer can be used for the preparation of an animal model.

[0045] (Six) The heterochromosomal targeted transfer technology provided by the application is realized by physical fusion mediated by an electric pulse, and the donor stem cell is subjected to cobalt source irradiation treatment before fusion, so that, in the fused cell, except for the donor chromosome fragments successfully transferred to the recipient chromosome, other donor chromosomes are naturally lost to ensure the normal karyotype of the fused cell. BRIEF DESCRIPTION OF DRAWINGS

[0046] Figure 1 FIG. 1 is a schematic diagram of the T-puro system-mediated translocation of chromosomes 5 and 6 in HEK293T cells in the preferred embodiment of the application. A is the schematic diagram of the exogenous DNA insertion position and exogenous DNA fragment of human chromosomes 5 and 6, and B is the schematic diagram of Cre / loxP recombination after the expression of Cre recombinase in HEK293T. After recombination, a T-puro element is formed on the chromosome and the CD74-ROS1 gene fusion is realized.

[0047] Figure 2For the DNA level detection result of the CD74-ROS1 fusion gene in the preferred embodiment of the present application, the control groups are HEK293T-CD74 monoclonal (CD47-CT45), HEK293T-ROS1 monoclonal (ROS1-CT46), HEK293T-Cre monoclonal (Cre), HEK293T cells (293T), and water; the experimental group is HEK293T CD74-ROS1 monoclonal (CT45-CT46-Cre). The detection primer is ZLJ822 / ZLJ823, and the PCR product size is 549bp (A). The sequencing result (B) also shows the formation of the CD74-ROS1 fusion gene.

[0048] Figure 3 For the influence of cell electrofusion direct current voltage on cell fusion in the preferred embodiment of the present application, the fusion direct current parameters of each group are 500V-30μs, 500V-60μs, 750V-30μs, 750V-60μs, 1000V-30μs, 1000V-60μs, 1250V-30μs, 1250V-60μs, 1500V-30μs, and 1500V-60μs. The flow cytometry analysis results in A show that the proportion of red and green fluorescent positive cells is 0.40%, 0.38%, 0.83%, 0.98%, 1.40%, 2.65%, 5.44%, 5.26%, 5.68%, and 5.52%, respectively. In B, the abscissa represents the fusion direct current parameter, and the ordinate represents the electrofusion efficiency (%) or the proportion of red and green fluorescent double-positive cells (%). The yellow broken line in B represents the proportion of red and green fluorescent double-positive cells in the flow cytometry analysis results of three independent electrofusion experiments under each fusion direct current parameter condition, and the blue broken line represents the cell electrofusion efficiency calculated by the formula "double-labeled cell fusion efficiency = number of red and green double-positive cells / number of smaller cells in red and green cells", which is 1.11%, 1.10%, 2.40%, 2.94%, 4.39%, 8.41%, 17.49%, 16.86%, 19.45%, and 17.58%, respectively.

[0049] Figure 4The influence of cell electrofusion alternating voltage on cell fusion in the preferred embodiment of the present application. The fusion direct current parameters of each group are 30Vrms-60s, 60Vrms-30s, 60Vrms-60s, 80Vrms-30s, 80Vrms-60s, 80Vrms-60s, respectively. The proportion of red and green fluorescent double positive cells in the flow cytometry analysis results in A is 2.11%, 1.88%, 2.27%, 3.57%, 4.17%, 6.35%, respectively. In B, the abscissa is the fusion alternating current parameter, and the ordinate is the electrofusion efficiency (%) or the proportion of fluorescent double positive cells (%). The ordinate is the electrofusion efficiency (%) or the proportion of red and green fluorescent double positive cells (%). The yellow broken line represents the proportion of red and green fluorescent double positive cells in the flow cytometry analysis results in three independent electrofusion experiments under the condition of each fusion direct current parameter, and the blue broken line represents the cell electrofusion efficiency calculated by the formula "double-labeled cell fusion efficiency = number of red and green double positive cells / number of smaller cells in red and green cells", which is 2.11%, 1.88%, 2.27%, 3.57%, 4.17%, 6.35%, respectively.

[0050] Figure 5 The influence of the total amount of cells and the standing time before fusion on the fusion efficiency in the preferred embodiment of the present application. A represents that the initial cell amount for electrofusion is 6x10 6 The number of mononuclear cells, binuclear cells and multinuclear cells after fusion in each experimental group when the fusion standing time is 0 minutes, 3 minutes and 5 minutes, respectively; B represents that the initial cell amount for electrofusion is 6x10 7 The number of mononuclear cells, binuclear cells and multinuclear cells after fusion in each experimental group when the fusion standing time is 0 minutes, 3 minutes and 5 minutes, respectively; C represents that the initial cell amount for electrofusion is 6x10 8 The number of mononuclear cells, binuclear cells and multinuclear cells after fusion in each experimental group when the fusion standing time is 0 minutes, 3 minutes and 5 minutes, respectively. White in the figure represents mononuclear cells, yellow represents binuclear cells, and gray represents multinuclear cells.

[0051] Figure 6 The schematic diagram of chromosomal recombination translocation in the fusion of mouse embryonic stem cells and human induced pluripotent stem cells in the preferred embodiment of the present application. A is the schematic diagram of the exogenous DNA insertion position and exogenous DNA fragment of mouse chromosome 10 and human chromosome 21, and B is the schematic diagram of Cre / loxP recombination after expressing Cre recombinase in HEK293T. After recombination, T-puro element is formed on the chromosome and the chromosomal translocation recombination is realized.

[0052] Figure 7The fluorescence expression of the puromycin-resistant fusion monoclonal cell line in the preferred embodiment of the present application is observed on the 17th day and the 23rd day of culture, and red and green fluorescence can be observed simultaneously, and the scale is 500 μm.

[0053] Figure 8 The fusion cell monoclonal recombination translocation DNA level detection result is shown. The fusion monoclonal cells are detected by T-puro PCR, the PCR detection primer is ZLJ850 / ZLJ851, and the target band size is 526 bp.

[0054] Figure 9 The fluorescence in situ hybridization result of the puromycin-resistant fusion monoclonal cell line in the preferred embodiment of the present application is shown. The red fluorescence is human Cot-1 DNA positive, the purple fluorescence signal is the metaphase chromosome DNA dyed by DAPI, and the scale is 20 μm. DETAILED DESCRIPTION

[0055] The purpose of the present application is to provide a chromosome directional transfer technology, which comprises the following steps:

[0056] 1. Establishing a recombination translocation screening system, and integrating elements into target chromosomes by using a site-directed knock-in strategy;

[0057] 2. Optimizing cell fusion conditions;

[0058] 3. Realizing directional movement of chromosomes and detecting the same.

[0059] The establishment of the recombination translocation system in step 1 is realized by the following method:

[0060] 1) Adding a functional intron containing a loxP sequence to the drug resistance gene artificially, and splitting the same into two parts with an overlapping region containing a loxP sequence;

[0061] 2) Inserting the two split drug resistance genes in the recombination translocation screening system into the target chromosomes of the donor species and the recipient species, respectively;

[0062] 3) The split drug resistance genes undergo Cre / loxP site-specific recombination under the action of Cre recombinase, and the drug resistance function is restored.

[0063] The splitting of the drug resistance gene in step 1) is realized by the following method: following the principle of RNA splicing and referring to the conserved sequence information near the splicing site, a site with a base sequence of AAGG or CAGG is selected, an SV40LT functional intron containing a loxP sequence is artificially added to the site, and the same is split into two parts with an overlapping region containing a loxP sequence.

[0064] Step 2) The split drug resistance gene insertion is achieved by using CRISPR / Cas9 system mediated non-homologous end joining to respectively insert the two split drug resistance genes into the telomere of the recipient chromosome and the centromere of the donor chromosome.

[0065] Step 3) The drug resistance function recovery is achieved by Cre / loxP site-specific recombination of the split drug resistance genes under the action of Cre recombinase, and the complete drug resistance gene is formed again between the donor and recipient chromosomes that need to be transferred, so that the cells that complete the targeted chromosome transfer have corresponding drug resistance.

[0066] The optimization of cell fusion conditions in step 2 is achieved by the following method:

[0067] a. Detect the effect of direct current voltage on cell fusion, and optimize the direct current parameters of cell fusion;

[0068] b. Detect the effect of alternating current voltage on cell fusion, and optimize the alternating current parameters of cell fusion;

[0069] c. Detect the effect of cell density on cell fusion, and determine the most suitable amount of starting cells for fusion.

[0070] The effect of direct current voltage on cell fusion in step a is detected by the following method: set the alternating current parameters and cell density fixed, and set different experimental groups with different direct current voltages and durations. Red fluorescence and green fluorescence are used to label the cells before fusion. After cell fusion is completed, flow cytometry analysis is performed, the proportion of double-fluorescent positive cells is counted, and the cell electrofusion efficiency is calculated. The cell electrofusion efficiency can be calculated by the following formula:

[0071] Double-labeled cell fusion efficiency = number of red-green double-positive cells / number of smaller cells in red-green cells

[0072] The effect of direct current voltage on cell fusion in step 2 is detected by the following method: set the direct current parameters and cell density fixed, and set different experimental groups with different alternating current voltages and durations. Red fluorescence and green fluorescence are used to label the cells before fusion. After cell fusion is completed, flow cytometry analysis is performed, the proportion of double-fluorescent positive cells is counted, and the cell electrofusion efficiency is calculated. The cell electrofusion efficiency can be calculated by the following formula:

[0073] Double-labeled cell fusion efficiency = number of red-green double-positive cells / number of smaller cells in red-green cells

[0074] The effect of the cell density on cell fusion in step 3) is detected by the following method: setting the direct current parameter and the alternating current parameter fixed, setting different experimental groups with different initial cell densities for fusion, using red fluorescence and green fluorescence to mark the cells before fusion respectively, after completing cell fusion, performing flow analysis, counting the proportion of double-fluorescent positive cells, and calculating the cell electrofusion efficiency. The cell electrofusion efficiency can be calculated by the following formula:

[0075] Double-labeled cell fusion efficiency = number of red-green double-positive cells / number of smaller cells in red-green cells

[0076] The directional transfer and detection of chromosomes in step 3) are realized by the following method:

[0077] (1) Transfecting donor and recipient cells with a recombinant translocation screening system;

[0078] (2) Fusion of donor and recipient cells;

[0079] (3) Realization and detection of directional transfer of chromosomes.

[0080] The transfection of the recombinant translocation screening system in step (1) is realized by the following method: using the CRISPR / Cas9-mediated DNA site-directed knock-in strategy dependent on non-homologous end joining, the exogenous DNA fragments of the recombinant translocation screening system are respectively integrated into the centromere position of the recipient chromosome and the centromere position of the donor chromosome.

[0081] The fusion of donor and recipient cells in step (2) is realized by the following method: using the optimized electrofusion conditions: alternating current parameter 80Vrms-30s, direct current parameter 1250V-30μs, and total amount of cells for initial fusion 6×10 8 , electrofusion of cells from the donor and the recipient is performed.

[0082] The directional transfer of chromosomes in step (3) is realized by the following method: expressing Cre recombinase in the fused cells, obtaining single clone cells after corresponding drug screening, and realizing chromosomal translocation while realizing Cre / loxP site-specific recombination of the drug resistance gene element.

[0083] The detection of the directional transfer of chromosomes in step (3) is realized by the following method: extracting the genome of the single clone cell with corresponding drug resistance, performing chromosomal translocation PCR detection, and performing fluorescence in situ hybridization.

[0084] The following examples are intended to illustrate the present application but not to limit the scope of the present application. If not specifically indicated, the examples are performed according to the conventional experimental conditions, such as Sambrook et al. Molecular Cloning: a Laboratory Manual (2001), or the conditions suggested by the manufacturer's instructions.

[0085] Example 1 Recombinant translocation screening T-puro system mediated chromosomal translocation of HEK293T cells

[0086] The technical process of constructing the recombinant translocation screening system in the present application mainly includes the following two aspects:

[0087] First, the establishment of T-puro vector system Figure 1

[0088] Using the CRISPR / Cas9 mediated DNA site-directed knock-in strategy dependent on non-homologous end joining, the exogenous DNA fragments of the T-puro system are respectively site-directed integrated into the CD74 gene site on chromosome 5 and the ROS1 gene site on chromosome 6 of HEK293T cells. The starting vector for constructing the T-puro vector is pUC57.

[0089] The insertion position of the exogenous DNA fragment at the CD74 gene site is between the 6th and 7th exons, and the target site sgRNA sequence is: 5'-GTCCTGAAGTAGAAGGTCAAAGG-3', which is located on the long arm antisense strand of hChr.5. The exogenous DNA fragment contains green fluorescent protein and Blasticidin S resistance gene regulated by EF1α promoter, and 5'-puro and SV40LT functional intron with loxP sequence regulated by Pol II promoter. The sequence of the exogenous DNA fragment is shown in SEQ ID No: 2.

[0090] The insertion position of the exogenous DNA fragment at the ROS1 gene site is between the 33rd and 34th exons, and the target site sgRNA sequence is: 5'-GTTAAATTTAGTTGAAGCACAGG-3', which is located on the long arm antisense strand of hChr.6. The exogenous DNA fragment contains SV40LT functional intron with loxP sequence and 3'-puro regulated by Pol II promoter, and red fluorescent protein and Hygromycin B resistance gene regulated by EF1α promoter. The sequence of the exogenous DNA fragment is shown in SEQ ID No: 3.

[0091] ​Subsequently, through the expression of Cre recombinase, the CD74-ROS1 fusion gene was formed while achieving Cre / loxP site-specific recombination of the T-puro element.

[0092] Second, detection of chromosomal translocations in HEK293T cells ( Figure 2 )

[0093] The average efficiency of obtaining puromycin-resistant positive clones from HEK293T cells via recombination was 1.04 × 10⁻⁶. -3 -2.13×10 -3 PCR detection of the CD74-ROS1 fusion gene was performed on positive clones of HEK293T cells resistant to puromycin. The primers were ZLJ822 and ZLJ823. The PCR product size was 549 bp. The positive clones were labeled CT45-CT46-Cre. PCR products with the correct fragment size were observed, and Sanger sequencing results also confirmed the formation of the CD74-ROS1 fusion gene. This indicates that expression of the Cre recombinant protein in HEK293T positive clone cells can mediate chromosomal translocation between Chr.5 and Chr.6.

[0094] Primer ZLJ822: 5'-CCAAGAGAGCCTTGGGCGTT-3'

[0095] Primer ZLJ823: 5'-AAGACCTCACATGCCACAAAGAAG-3'

[0096] Figure 2 The complete sequencing sequence is as follows:

[0097] TAATCCAGCCTGTGT (ROS1) CCAGGCAGTGTGAGGGCCTATCTAGAGGTACCTTAA(pCT44sequence)← GAGTGTGCAAAGCCCCTGTCTGCTAACTGCATAACTTCGTATAGC ATACATTATACGAAGTTAT (loxP) GCTTGCTGTGCTTACTGAGGATAAAGCATG(94bp overlap)→(pCT43 sequence)GGCGCGCCGGTATGTCGGGAACCT TCTACTTCAGGAC (CD74)

[0098] The numbers below the sequencing peaks are: 10, 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130.

[0099] Optimization of cell electrofusion conditions

[0100] The optimization of cell electrofusion conditions in this embodiment mainly includes the following four aspects:

[0101] First, the effect of direct current voltage on cell fusion Figure 3

[0102] First, the size and duration of the direct current voltage for cell electrofusion were optimized. Ten experimental groups were set up, with each group serving as a control. The total amount of fused cells in each experimental group was 6 x 10 6 The ratio of red fluorescent and green fluorescent labeled mouse embryonic stem cells was 1:1. The cell suspension was allowed to stand in the fusion tank for 5 minutes before fusion. The alternating current parameters for electrofusion were 80 Vrms-60 s. The direct current parameters were 500 V-30 μs, 500 V-60 μs, 750 V-30 μs, 750 V-60 μs, 1000 V-30 μs, 1000 V-60 μs, 1250 V-30 μs, 1250 V-60 μs, 1500 V-30 μs, and 1500 V-60 μs. After fusion, the cells were allowed to stand in the fusion tank for 10 minutes to complete the fusion of the cell membranes. Then the cells were resuspended, centrifuged to remove the ECF buffer, and finally resuspended in 3i medium for flow cytometry analysis.

[0103] The flow cytometry results showed that when the alternating current parameters were 80 Vrms-60 s, the number of double-fluorescent labeled mouse embryonic stem cells after fusion generally showed an increasing trend with the extension of direct current voltage or direct current treatment time. The double-positive cell proportion in the experimental groups was 0.40%, 0.38%, 0.83%, 0.98%, 1.40%, 2.65%, 5.44%, 5.26%, 5.68%, and 5.52%, respectively. The difference in double-positive cell proportion between the 1000 V-60 μs and 1250 V-30 μs groups was the largest, but there was no significant increase in double-positive cell proportion when the direct current voltage parameter was greater than 1250 V-30 μs.

[0104] ​The data obtained by flow analysis was further analyzed using the formula "double-labeled cell fusion efficiency = number of red-green double-positive cells / number of smaller cells in red-green cells". The electrofusion efficiency of the 10 experimental groups was 1.11%, 1.10%, 2.40%, 2.94%, 4.39%, 8.41%, 17.49%, 16.86%, 19.45%, and 17.58%, respectively. When the direct current voltage reached 1250V-30μs, the fusion efficiency remained relatively stable as the direct current parameter increased. The fusion efficiency calculated by the formula avoids the changes in green fluorescent single-positive or red fluorescent single-positive cells caused by experimental errors, as well as the proportion of non-fluorescent feeder cells in the total cells, which affects the determination of the optimal result of electrofusion. Considering that higher direct current voltage or longer direct current action time can cause greater damage to cells, leading to a decrease in cell survival rate, the direct current voltage parameter for electrofusion was finally determined to be 1250V-30μs.

[0105] Second, the effect of alternating current voltage on cell fusion Figure 4

[0106] Six experimental groups were set up, each serving as a control. The total amount of fused cells in each experimental group was 6x10 6 The ratio of red fluorescent and green fluorescent mouse embryonic stem cells was 1:1. The cell suspension was allowed to stand in the fusion tank for 5 minutes before electrofusion. The direct current parameter for electrofusion was 1250V-30μs, and the alternating current parameters were 30Vrms-60s, 60Vrms-30s, 60Vrms-60s, 80Vrms-30s, 80Vrms-60s, and 80Vrms-60s, respectively. The fused cells were allowed to stand in the electrode tank for 10 minutes to complete the fusion time, and then the cells were resuspended, centrifuged to remove the ECF buffer, and finally resuspended in 3i medium for flow analysis.

[0107] The flow analysis results showed that when the direct current parameter was 1250V-30μs, the number of double-fluorescent labeled mouse embryonic stem cells after fusion generally increased with the increase of alternating current voltage or the extension of alternating current duration. The proportion of double-positive cells in the experimental groups was 2.11%, 1.88%, 2.27%, 3.57%, 4.17%, and 6.35%, respectively.

[0108] The data obtained by flow analysis was further analyzed using the fusion efficiency calculation formula. The electrofusion efficiency of the 6 experimental groups was 6.37%, 5.10%, 5.99%, 10.26%, 11.00%, and 19.90%, respectively. Through observation of the state of the fused and resting cells, excessive arrangement can lead to the formation of more multinucleated cells, which is not conducive to the formation of hybrid cell monoclonal in the later stage. After comprehensive analysis, the alternating current voltage parameter for electrofusion was finally determined to be 80Vrms-30s.

[0109] ​Third, the effect of cell density on cell fusion ( Figure 5 )

[0110] Using optimized electrofusion conditions with AC parameters of 80Vrms-30s and DC parameters of 1250V-30μs, nine experimental groups were set up, with a total fusion cell count of 6×10⁻⁶. 6 6×10 7 6×10 8 The pre-fusion resting times were 0 minutes, 3 minutes, and 5 minutes. Three minutes after electrofusion, images were taken, and the number of mononuclear cells, binucleated cells, and multinucleated cells in 600 fused cells per field of view in each experimental group was counted under a 20x microscope. When the cell count was 6 × 10⁶ cells / year... 6 At this time, a 5-minute pre-fusion resting time yielded the highest number of binuclear cells; without pre-fusion resting, the fusion efficiency was extremely low (<1%); the cell quantity was 6×10⁶. 7 At this time, a 3-minute pre-fusion resting time resulted in the highest number of binucleated cells, while an extension of 5 minutes significantly increased the number of multinucleated cells; the cell count was 6 × 10⁶. 8 At this time, the highest number of binuclear cells were obtained by resting before fusion. When the resting time was 3 minutes and 5 minutes, the overall fusion efficiency increased, but the number of multinucleated cells increased, while the proportion of binuclear cells decreased. Finally, it was determined that when the initial amount of fusion cells was sufficient, 6 × 10⁶ cells were optimal. 8 The number and ratio of binucleated cells obtained by electrofusion without cell settling are optimal. However, when the number of cells is small, different settling times before fusion are required to improve the efficiency of electrofusion.

[0111] Fourth, the effect of pre-fusion donor cell cobalt source irradiation on cell fusion (Table 1).

[0112] Eleven experimental groups were set up. The donor cells included human induced pluripotent stem cells and A9H14 cells (mouse A9 cells containing human chromosome 14). The recipient cells were enucleated porcine oocytes or mouse zygotes. The cobalt source irradiation doses for human induced pluripotent stem cells were 120 Gy (irradiation time 12 min) and 180 Gy (irradiation time 18 min). The irradiation doses for A9H14 cells were 40 Gy (irradiation time 4 min), 60 Gy (irradiation time 6 min), and 61.5 Gy (irradiation time 6 min 9 s).

[0113] The donor cells are directly injected into the recipient cells, and the injected cells are subjected to electrofusion treatment using the optimized electrofusion conditions described above. The donor cells are labeled with red or green fluorescent markers. By counting the fluorescent positive rate of the injected fusion cells, the proportion of donor cell chromosomes successfully transferred into the recipient cells can be reflected. In addition, the blastocyst rate of the injected fusion cells can reflect whether the fusion cells can continue to develop normally, i.e., whether the chromosome directional transfer method provided by the present application can ultimately be used to prepare animal models.

[0114] After the donor A9H14 cells are irradiated by a cobalt source, the fluorescent positive rate of the fusion cells injected into porcine oocytes or mouse zygotes can be significantly improved. When the irradiation dose is 60 Gy, the fusion cells of A9H14 cells and porcine oocytes can successfully develop to the blastocyst stage.

[0115] After the donor cells are replaced by human induced pluripotent stem cells from A9H14 cells, the blastocyst rate of the fusion cells injected into porcine oocytes or mouse zygotes is significantly improved, and can be as high as more than 50%.

[0116] Finally, it is determined that the donor cells are stem cells and can significantly improve the efficiency of donor cell chromosome transfer to recipient cells after being irradiated by a cobalt source, and ensure that the fusion cells can continue to develop normally and be used to prepare subsequent animal models.

[0117] The experimental results are shown in Table 1. A9H14 cells are mouse A9 cells containing a human chromosome 14, hiPSCs are human induced pluripotent stem cells, mCherry represents red fluorescence, GFP represents green fluorescence, and Gy is the cobalt irradiation dose unit.

[0118] Table 1

[0119]

[0120] Example 3 Directional transfer of human chromosome fragments to mouse chromosomes

[0121] The directional transfer of human chromosome fragments to mouse chromosomes in this example mainly includes the following two aspects:

[0122] First, the recombination translocation screening system is transfected into human pluripotent stem cells and mouse embryonic stem cells Figure 6

[0123] Using the CRISPR / Cas9-mediated non-homologous end joining-dependent DNA site-directed knock-in strategy, the exogenous DNA fragments of the T-puro system (the starting vector is pUC57) are respectively integrated into the proximal centromere position of mouse chromosome 10 and the proximal centromere position of the long arm of human chromosome 21.

[0124] ​The mouse cells used for cell electrofusion are mouse embryonic stem cells, and the last gene of mouse chromosome 10 is determined by NCBI database as Vmn2r86 (the number of gene Vmn2r86 on NCBI is 625109). The insertion position of the exogenous DNA fragment is downstream of the Vmn2r86 gene and as close to the telomere of the chromosome as possible. The target site sgRNA sequence is: 5'-GGCTCCGGCTCTAAATCGGTAGG-3'. The exogenous DNA fragment contains green fluorescent protein and Blasticidin S drug resistance gene regulated by EF1α promoter, and 5'-puro and SV40LT functional intron with loxP sequence regulated by Pol II promoter. The sequence of the exogenous DNA fragment is shown in SEQ ID No: 2.

[0125] The human cells used for cell electrofusion are human induced pluripotent stem cells, and the insertion position of the exogenous DNA fragment in human chromosome 21 is near the centromere of the long arm (the insertion site is on the CHM13 assembly). The target site sgRNA sequence is: 5'-GTGCAGAACGGTGATGCTCAGAGG-3'. The exogenous DNA fragment contains SV40LT functional intron with loxP sequence and 3'-puro regulated by Pol II promoter, and red fluorescent protein and Hygromycin B drug resistance gene regulated by EF1α promoter. The sequence of the exogenous DNA fragment is shown in SEQ ID No: 3.

[0126] Subsequently, through the expression of Cre recombinase, the chromosomal translocation of human and mouse is realized while realizing the Cre / loxP site-specific recombination of T-puro element.

[0127] The total amount of starting cells of human induced pluripotent stem cells and mouse embryonic stem cells before fusion is 10 7 After Blasticidin S and Hygromycin B drug screening, red and green double fluorescent positive monoclonal cells are obtained. Figure 7 The monoclonal cells are picked for large-scale culture, and part of the cells are subjected to puromycin drug screening verification.

[0128] Second, detection of heterologous chromosomal translocation

[0129] The genome of the red and green double fluorescent positive and puromycin resistant monoclonal cells was extracted, and T-puro translocation PCR was performed. The PCR detection primers were ZLJ850 and ZLJ851, and the target band size was 526 bp. The results showed that in 10 monoclonal cells (#1-1, #1-2, #1-3, #1-4, #2-1, #2-2, #2-3, #2-4, #3-1, #3-2), except for monoclonal #3-1, T-puro PCR was positive, and wild-type mouse embryonic stem cells and cells not transfected with Cre recombinase were negative Figure 8

[0130] Primer ZLJ850: 5'-TCGGGCTCGACATCGGCAAGGTAAGTGCTTCTTCCTTAAAT C-3'

[0131] Primer ZLJ851: 5'-GCCGTCGTCCGCGACCCACACCTAAAATACACAAACAATT AGG-3'

[0132] To further prove the presence of human chromosome fragments in puromycin-resistant monoclonal cells, fluorescence in situ hybridization was performed on puromycin-resistant monoclonal cells. The results showed that the monoclonal cells had obvious red fluorescent signals Figure 9

[0133] The human DNA fragment knocked into the mouse chromosome 10 is the long arm of human chromosome 21, with a theoretical length of about 33.5 Mbp; the fusion cells can be stably passaged, and the inserted genes can be detected in the cells after passage.

[0134] Although the present application has been described in detail above with general description and specific embodiments, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, are within the scope of the present application claimed.

[0135] References:

[0136] 1. Bellis, M., Gérard, A., Charlieu, J. P., ​​B., Brun, M. E., Viegas-Pequignot, E., Carter, D. A., and Roizès, G. (1991). Construction and characterization of a partial library of yeast artificial chromosomes from human chromosome 21. DNA Cell Biol. 10, 301-310.

[0137] 2. Bruggemann, M., Caskey, H. M., Teale, C, Waldmann, H., Williams, G. T., Surani, M. A., and Neuberger, M. S. (1989). A repertoire of monoclonal antibodies with human heavy chains from transgenic mice. Proc. Natl. Acad. Sci. U. S. A. 86, 6709-6713.

[0138] 3. Carter, P. J. (2006). Potent antibody therapeutics by design. Nat. Rev. Immunol. 6, 343-357.

[0139] 4. Davisson, M. T., Schmidt, C, and Akeson, E. C. (1990). Segmental trisomy of murine chromosome 16: a new model system for studying Down syndrome. Prog. Clin Biol. Res. 360, 263-280.

[0140] 5. Devoy, A., Bunton-Stasyshyn, R. K., Tybulewicz, V. L., Smith, A. J., and Fisher, E. M. (2011). Genomically humanized mice: technologies and promises. Nat. Rev. Genet. 13, 14-20.

[0141] 6. Driscoll, D. A., and Gross, S. (2009). Clinical practice. Prenatal screening for aneuploidy. N. Engl. J. Med. 360, 2556-2562.

[0142] 7. Green, L. L., Hardy, M. C., Maynard-Currie, C. E., Tsuda, H., Louie, D. M., Mendez, M. J., Abderrahim, H., Noguchi, M., Smith, D. H., Zeng, Y., et al. (1994). Antigen-specific human monoclonal antibodies from mice engineered with human Ig heavy and light chain YACs. Nat. Genet. 7, 13-21.

[0143] 8. Hernandez, D., Mee, P. J., Martin, J. E., Tybulewicz, V. L., and Fisher, E. M. (1999). Transchromosomal mouse embryonic stem cell lines and chimeric mice that contain freely segregating segments of human chromosome 21. Hum. Mol. Genet. 8, 923-933.

[0144] 9. Hwang, W. Y., and Foote, J. (2005). Immunogenicity of engineered antibodies. Methods 36, 3-10.

[0145] 10. Kazuki, Y., Gao, F.J., Li, Y., Moyer, A.J., Devenney, B., Hiramatsu, K., Miyagawa-Tomita, S., Abe, S., Kazuki, K., Kajitani, N., et al. (2020). A non-mosaic transchromosomic mouse model of down syndrome carrying the long arm of human chromosome 21. Elife 9, e56223.

[0146] 11. Kazuki, Y., Kimura, M., Nishigaki, R., Kai, Y., Abe, S., Okita, C., Shirayoshi, Y., Schulz, T.C., Tomizuka, K., Hanaoka, K., et al. (2004). Human chromosome 21q22.2-qter carries a gene(s) responsible for downregulation of mlc2a and PEBP in Down syndrome model mice. Biochem. Biophys. Res. Commun. 317, 491-499.

[0147] 12. Korenberg, J.R., Chen, X.N., Schipper, R., Sun, Z., Gonsky, R., Gerwehr, S., Carpenter, N., Daumer, C., Dignan, P., Disteche, C., et al. (1994). Down syndrome phenotypes: the consequences of chromosomal imbalance. Proc. Natl. Acad. Sci. U.S.A. 91, 4997-5001.

[0148] 13. Lee, E.C., Liang, Q., Ali, H., Bayliss, L., Beasley, A., Bloomfield-Gerdes, T., Bonoli, L., Brown, R., Campbell, J., Carpenter, A., et al. (2014). Complete humanization of the mouse immunoglobulin loci enables efficient therapeutic antibody discovery. Nat. Biotechnol. 32, 356-363.

[0149] 14. Lonberg, N. (2005). Human antibodies from transgenic animals. Nat. Biotechnol. 23, 1117-1125.

[0150] 15. Lonberg, N., Taylor, L.D., Harding, F.A., Trounstine, M., Higgins, K.M., Schramm, S.R., Kuo, C.C., Mashayekh, R., Wymore, K., McCabe, J.G., et al. (1994). Antigen-specific human antibodies from mice comprising four distinct genetic modifications. Nature 368, 856-859.

[0151] 16. Macdonald, L.E., Karow, M., Stevens, S., Auerbach, W., Poueymirou, W.T., Yasenchak, J., Frendewey, D., Valenzuela, D.M., Giallourakis, C.C., Alt, F.W., et al. (2014). Precise and in situ genetic humanization of 6 Mb of mouse immunoglobulin genes. Proc. Natl. Acad. Sci. U.S.A. 111, 5147-5152.

[0152] 17. Moriwaki, T., Abe, S., Oshimura, M., and Kazuki, Y. (2020). Transchromosomic technology for genomically humanized animals. Exp. Cell Res. 390, 111914.

[0153] 18. Murphy, A.J., Macdonald, L.E., Stevens, S., Karow, M., Dore, A.T., Pobursky, K., Huang, T.T., Poueymirou, W.T., Esau, L., Meola, M., et al. (2014). Mice with megabase humanization of their immunoglobulin genes generate antibodies as efficiently as normal mice. Proc. Natl. Acad. Sci. U.S.A. 111, 5153-5158.

[0154] 19. Sago, H., Carlson, E.J., Smith, D.J., Kilbridge, J., Rubin, E.M., Mobley, W.C., Epstein, C.J., and Huang, T.T. (1998). Ts1Cje, a partial trisomy 16 mouse model for Down syndrome, exhibits learning and behavioral abnormalities. Proc. Natl. Acad. Sci. U.S.A. 95, 6256-6261.

[0155] 20. Scheer, N., and Wilson, I.D. (2016). A comparison between genetically humanized and chimeric liver humanized mouse models for studies in drug metabolism and toxicity. Drug Discov. Today 21, 250-263.

[0156] 21. Tomizuka, K., Shinohara, T., Yoshida, H., Uejima, H., Ohguma, A., Tanaka, S., Sato, K., Oshimura, M., and Ishida, I. (2000). Double trans-chromosomic mice: maintenance of two individual human chromosome fragments containing Ig heavy and kappa loci and expression of fully human antibodies. Proc. Natl. Acad. Sci. U.S.A. 97, 722-727.

[0157] 22. Weiss, M. C, and Green, H. (1967). Human-mouse hybrid cell lines containing partial complements of human chromosomes and functioning human genes. Proc. Natl. Acad. Sci. U.S.A. 58, 1104-1111.

[0158] 23. Zhu, F., Nair, R. R., Fisher, E. M. C, and Cunningham, T. J. (2019). Humanising the mouse genome piece by piece. Nat. Commun. 10, 1845. SEQUENCE LISTING <110> China Agricultural University <120> Methods of heterochromosomal directed transfer <130> KHP211120265.0 <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 285 <212> DNA <213> Simian vacuolating virus 40 (SV40) <400> 1 gagtgtgcaa agaaaatgtc tgctaactgc gcttgctgtg cttactgagg atgaagcatg 60 aaaatagaaa attatacagg aaagatccac ttgtgtgggt tgattgctac tgcttcgatt 120 gctttagaat gtggtttgga cttgatcttt gtgaaggaac cttacttctg tggtgtgaca 180 taattggaca aactacctac agagatttaa agctctaaac taaatataaa atttttaagt 240 gtataatgtg ttaaactact gattctaatt gtttgtgtat tttag 285 <210> 2 <211> 3679 <212> DNA <213> Artificial Sequence <400> 2 tcgtgaggct ccggtgcccg tcagtgggca gagcgcacat cgcccacagt ccccgagaag 60 ttggggggag gggtcggcaa ttgaaccggt gcctagagaa ggtggcgcgg ggtaaactgg 120 gaaagtgatg tcgtgtactg gctccgcctt tttcccgagg gtgggggaga accgtatata 180 agtgcagtag tcgccgtgaa cgttcttttt cgcaacgggt ttgccgccag aacacaggta 240 agtgccgtgt gtggttcccg cgggcctggc ctctttacgg gttatggccc ttgcgtgcct 300 tgaattactt ccacctggct gcagtacgtg attcttgatc ccgagcttcg ggttggaagt 360 gggtgggaga gttcgaggcc ttgcgcttaa ggagcccctt cgcctcgtgc ttgagttgag 420 gcctggcctg ggcgctgggg ccgccgcgtg cgaatctggt ggcaccttcg cgcctgtctc 480 gctgctttcg ataagtctct agccatttaa aatttttgat gacctgctgc gacgcttttt 540 ttctggcaag atagtcttgt aaatgcgggc caagatctgc acactggtat ttcggttttt 600 ggggccgcgg gcggcgacgg ggcccgtgcg tcccagcgca catgttcggc gaggcggggc 660 ctgcgagcgc ggccaccgag aatcggacgg gggtagtctc aagctggccg gcctgctctg 720 gtgcctggcc tcgcgccgcc gtgtatcgcc ccgccctggg cggcaaggct ggcccggtcg 780 gcaccagttg cgtgagcgga aagatggccg cttcccggcc ctgctgcagg gagctcaaaa 840 tggaggacgc ggcgctcggg agagcgggcg ggtgagtcac ccacacaaag gaaaagggcc 900 tttccgtcct cagccgtcgc ttcatgtgac tccacggagt accgggcgcc gtccaggcac 960 ctcgattagt tctcgagctt ttggagtacg tcgtctttag gttgggggga ggggttttat 1020 gcgatggagt ttccccacac tgagtgggtg gagactgaag ttaggccagc ttggcacttg 1080 atgtaattct ccttggaatt tgcccttttt gagtttggat cttggttcat tctcaagcct 1140 cagacagtgg ttcaaagttt ttttcttcca tttcaggtgt cgtgaagcta gcgccaccat 1200 ggtgagcaag ggcgaggagc tgttcaccgg ggtggtgccc atcctggtcg agctggacgg 1260 cgacgtaaac ggccacaagt tcagcgtgtc cggcgagggc gagggcgatg ccacctacgg 1320 caagctgacc ctgaagttca tctgcaccac cggcaagctg cccgtgccct ggcccaccct 1380 cgtgaccacc ctgacctacg gcgtgcagtg cttcagccgc taccccgacc acatgaagca 1440 gcacgacttc ttcaagtccg ccatgcccga aggctacgtc caggagcgca ccatcttctt 1500 caaggacgac ggcaactaca agacccgcgc cgaggtgaag ttcgagggcg acaccctggt 1560 gaaccgcatc gagctgaagg gcatcgactt caaggaggac ggcaacatcc tggggcacaa 1620 gctggagtac aactacaaca gccacaacgt ctatatcatg gccgacaagc agaagaacgg 1680 catcaaggtg aacttcaaga tccgccacaa catcgaggac ggcagcgtgc agctcgccga 1740 ccactaccag cagaacaccc ccatcggcga cggccccgtg ctgctgcccg acaaccacta 1800 cctgagcacc cagtccgccc tgagcaaaga ccccaacgag aagcgcgatc acatggtcct 1860 gctggagttc gtgaccgccg ccgggatcac tctcggcatg gacgagctgt aaggaggg 1920 cagaggaagt ctgctaacat gcggtgacgt cgaggagaat cctggcccaa tggccaagcc 1980 tttgtctcaa gaagaatcca ccctcattga aagagcaacg gctacaatca acagcatccc 2040 catctctgaa gactacagcg tcgccagcgc agctctctct agcgacggcc gcatcttcac 2100 tggtgtcaat gtatatcatt ttactggggg accttgtgca gaactcgtgg tgctgggcac 2160 tgctgctgct gcggcagctg gcaacctgac ttgtatcgtc gcgatcggaa atgagaacag 2220 gggcatcttg agcccctgcg gacggtgccg acaggtgctt ctcgatctgc atcctgggat 2280 caaagccata gtgaaggaca gtgatggaca gccgacggca gttgggattc gtgaattgct 2340 gccctctggt tatgtgtggg agggctaagg atccctagag ctcgctgatc agcctcgact 2400 gtgccttcta gttgccagcc atctgttgtt tgcccctccc ccgtgccttc cttgaccctg 2460 gaaggtgcca ctcccactgt cctttcctaa taaaatgagg aaattgcatc gcattgtctg 2520 agtaggtgtc attctattct ggggggtggg gtggggcagg acagcaaggg ggaggattgg 2580 gaagagaata gcaggcatgc tggggagcgg ccgcaaagct tgggcttgaa catcgagcgc 2640 cagggctccg taaagctact agagcacagg cggtgcccca acgtcctggg gcctctccac 2700 taataacggc tacttccaat tgattggacg cgccatcttg cctgccttat gcatattcag 2760 cggtgaactg aatattcatg aacgaggccc gtcccgtccc tccctccttc cccccacccc 2820 cggaacccgc tccggaggac ccgaagggcc ccgccttcat taccgatgcg taggacaaac 2880 cattttcccg atgtgtgtgg ggggatacta atgagagact ttagctgaaa aatgagcctg 2940 aactccgaag ctgagtaaaa atggcctaac tttatcctcc gttctgtaag tcctcggttt 3000 gagtgcacgg gaaacccgaa aggaggacga caggaccagg acattctcct cctcctgtcg 3060 cgtcagaaag aacacccaac cagggagccg gagccctagc gtcaacaact ccgccgcgcg 3120 cgctccgtgt aggccggtgc gggcggcccc gtagcgcaag ggagggcggg aaaggaaggg 3180 gcgggacaca agggcgaatc tataaagggc gtcactcagc cagttctctc ctcagaagcg 3240 ccgagagcgc gaccgggacg gttggagaag aaggtggctc ccggaagggg gagagacaaa 3300 ctgccgtaac ctctgccgtt caggatccgt gcagccaata tgaccgagta caagcccacg 3360 gtgcgcctcg ccacccgcga cgacgtcccc agggccgtac gcaccctcgc cgccgcgttc 3420 gccgactacc ccgccacgcg ccacaccgtc gatccggacc gccacatcga gcgggtcacc 3480 gagctgcaag aactcttcct cacgcgcgtc gggctcgaca tcggcaaggt aagtgcttct 3540 tccttaaatc ctggtgttga tgcaatgtac tgcaaacaat ggcctgagtg tgcaaagaaa 3600 atgtctgcta actgcataac ttcgtatagc atacattata cgaagttatg cttgctgtgc 3660 ttactgagga tgaagcatg 3679 <210> 3 <211> 5567 <212> DNA <213> Artificial Sequence <400> 3 gagtgtgcaa agaaaatgtc tgctaactgc ataacttcgt atagcataca ttatacgaag 60 ttatgcttgc tgtgcttact gaggatgaag catgaaaata gaaaattata caggaaagat 120 ccacttgtgt gggttgattg ctactgcttc gattgcttta gaatgtggtt tggacttgat 180 tttctcctct gctgctgctg ctgctgctgg ctgctgctgg ctgctgctgg ctgctgctgg 60 tttaaagctc taaactaaat ataaaatttt taagtgtata atgtgttaaa ctactgattc t 300 aattgtttgt gtattttagg tgtgggtcgc ggacgacgg cgccgcggtg gcggtctgga c 360 cacgccggag agcgtcgaag cgggggcggt gttcgccgag atcggcccgc gcatggccga 420 gttgagcggt tcccggctgg ccgcgcagca acagatggaa ggcctcctgg cgccgcaccg 480 gcccaaggag cccgcgtggt tcctggccac cgtcggcgtc tcgcccgacc accagggcaa 540 gggtctgggc agcgccgtcg tgctccccgg agtggaggcg gccgagcgcg ccggggtgcc 600 cgccttcctg gagacctccg cgccccgcaa cctccccttc tacgagcggc tcggcttcac 660 cgtcaccgcc gacgtcgagg tgcccgaagg accgcgcacc tggtgcatga cccgcaagcc 720 cggtgcctga gcgggactct ggggttcgaa atgaccgacc aagcgacgcc caacctgcca 780 tcacgagatt tcgattccac cgccgccttc tatgaaaggt tgggcttcgg aatcgttttc 840 cgggacgccg gctggatgat cctccagcgc ggggatctca tgctggagtt cttcgcccac 900 cctaggggga ggctaactga aacacggaag gagacaatac cggaaggaac ccgcgctatg 960 acggcaataa aaagacagaa taaaacgcac ggtgttgggt cgtttgttcg gcgcgcctaa 1020 tcgtgaggct ccggtgcccg tcagtgggca gagcgcacat cgcccacagt ccccgagaag 1080 ttggggggag gggtcggcaa ttgaaccggt gcctagagaa ggtggcgcgg ggtaaactgg 1140 gaaagtgatg tcgtgtactg gctccgcctt tttcccgagg gtgggggaga accgtatata 1200 agtgcagtag tcgccgtgaa cgttcttttt cgcaacgggt ttgccgccag aacacaggta 1260 agtgccgtgt gtggttcccg cgggcctggc ctctttacgg gttatggccc ttgcgtgcct 1320 tgaattactt ccacctggct gcagtacgtg attcttgatc ccgagcttcg ggttggaagt 1380 gggtgggaga gttcgaggcc ttgcgcttaa ggagcccctt cgcctcgtgc ttgagttgag 1440 gcctggcctg ggcgctgggg ccgccgcgtg cgaatctggt ggcaccttcg cgcctgtctc 1500 gctgctttcg ataagtctct agccatttaa aatttttgat gacctgctgc gacgcttttt 1560 ttctggcaag atagtcttgt aaatgcgggc caagatctgc acactggtat ttcggttttt 1620 ggggccgcgg gcggcgacgg ggcccgtgcg tcccagcgca catgttcggc gaggcggggc 1680 ctgcgagcgc ggccaccgag aatcggacgg gggtagtctc aagctggccg gcctgctctg 1740 gtgcctggcc tcgcgccgcc gtgtatcgcc ccgccctggg cggcaaggct ggcccggtcg 1800 gcaccagttg cgtgagcgga aagatggccg cttcccggcc ctgctgcagg gagctcaaaa 1860 tggaggacgc ggcgctcggg agagcgggcg ggtgagtcac ccacacaaag gaaaagggcc 1920 tttccgtcct cagccgtcgc ttcatgtgac tccacggagt accgggcgcc gtccaggcac 1980 ctcgattagt tctcgagctt ttggagtacg tcgtctttag gttgggggga ggggttttat 2040 gcgatggagt ttccccacac tgagtgggtg gagactgaag ttaggccagc ttggcacttg 2100 atgtaattct ccttggaatt tgcccttttt gagtttggat cttggttcat tctcaagcct 2160 cagacagtgg ttcaaagttt ttttcttcca tttcaggtgt cgtgaagcta gcgtcgacgc 2220 caccatggcg ggagacgtgg agtccaaccc agggcccatg gtgagcaagg gcgaggaggt 2280 catcaaagag ttcatgcgct tcaaggtgcg catggagggc tccatgaacg gccacgagtt 2340 CGAGATCGAG GGCAGGGCGA GGGCCGCCCC CTACGAGGGC ACCCAGACCG CCAAGCTGAA 2400 GTTGGCGGAG GCGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC GCGGCGGCGG 1200 CAGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC 1260 CAGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC 1260 CAGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC 1260 CAGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC 1260 CAGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC 1260 CAGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC 1260 CAGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC 1260 CAGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC 1260 CAGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC 1260 CAGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC GCGGCGGCGG CGGCGGCGGC 1260 CGAGTT CGAG ATCGAGGGCG AGGGC GAGGGC CCCCCTAC GAG GGC ACCC AGACC GC CAA 3120 GCTGAAGGTG ACCAAGGGCG GCCCCCTGCC CTTCGCCTGG GACATCCTGT CCCCCCAGTT 3180 CATGTACGGC TCCAAGGCGT ACGTGAAGCA CCCCGCCGAC ATCCCCGATT ACAAGAAGCT 3240 GTCCTTCCCC GAGGGCTTCA AGTGGGAGCG CGTGATGAAC TTCGAGGACG GCGGTCTGGT 3300 GACC GTGACCC AGGACTCCT CCCTGCAGGA CGGCACGCTG ATCTACAAGG TGAAGATGCG 3360 CGGCACCAAC TTCCCCCCC GACGGCCCCGT AATGCAGAAG AAGACC ATGGGCTGGGAGG C 3420 CTCCACC GAGCGCCTGTAC CCCGC GACGGC GTGCTGAAG GGC GAGATCC ACCAGGCCT 3480 GAAGCTGAAG GACGGCGGCC ACTACCTGGT GGAGTTCAAG ACCATCTAC ATGGCCAAGAA 3540 GCCC GTGCAACT GCCCGCTACT ACTACGTGGACACCAAGCTGGACATCACC TTC CCAAA 3600 CGAGGACTAC ACCATCGTGG AACAGTACGA GC GCTCCGAGG GC C GCCACCACCT GTTCCT 3660 GTACGGCATGGACGAGCTGTACAAGTAATGAGTCGACCCCCTCTCCCTCCCCCCCCCTA 3720 ACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCG GTGTGCGTTTGTCTATATGTTATTTT 3780 ccaccatatt gccgtctttt ggcaatgtga gggcccggaa acctggccct gtcttcttga 3840 cgagcattcc taggggtctt tcccctctcg ccaaaggaat gcaaggtctg ttgaatgtcg 3900 tgaaggaagc agttcctctg gaagcttctt gaagacaaac aacgtctgta gcgacccttt 3960 gcaggcagcg gaaccccca cctggcgaca ggtgcctctg cggccaaaag ccacgtgtat 4020 aagatacacc tgcaaaggcg gcacaacccc agtgccacgt tgtgagttgg atagttgtgg 4080 aaagagtcaa atggctctcc tcaagcgtag tcaacaaggg gctgaaggat gcccagaagg 4140 taccccattg tatgggaatc tgatctgggg cctcggtgca catgctttac atgtgtttag 4200 tcgaggttaa aaaacgtcta ggccccccga accacggggga cgtggttttc ctttgaaaaa 4260 cacgatgata agcttgccac aacccgtacc aaagatggat agatccggaa agcctgaact 4320 caccgcgacg tctgtcgaga agtttctgat cgaaaagttc gacagcgtct ccgacctgat 4380 gcagctctcg gagggcgaag aatctcgtgc tttcagcttc gatgtaggag ggcgtggata 4440 tgtcctgcgg gtaaatagct gcgccgatgg tttctacaaa gatcgttatg tttatcggca 4500 ctttgcatcg gccgcgctcc cgattccgga agtgcttgac attggggaat tcagcgagag 4560 cctgacctat tgcatctccc gccgtgcaca gggtgtcacg ttgcaagacc tgcctgaaac 4620 cgaactgccc gctgttctgc agccggtcgc ggaggccatg gatgcgatcg ctgcggccga 4680 tcttagccag acgagcgggt tcggcccatt cggaccgcaa ggaatcggtc aatacactac 4740 atggcgtgat ttcatatgcg cgattgctga tccccatgtg tatcactggc aaactgtgat 4800 ggacgacacc gtcagtgcgt ccgtcgcgca ggctctcgat gagctgatgc tttgggccga 4860 ggactgcccc gaagtccggc acctcgtgca cgcggatttc ggctccaaca atgtcctgac 4920 ggacaatggc cgcataacag cggtcattga ctggagcgag gcgatgttcg gggattccca 4980 atacgaggtc gccaacatct tcttctggag gccgtggttg gcttgtatgg agcagcagac 5040 gcgctacttc gagcggaggc atccggagct tgcaggatcg ccgcggctcc gggcgtatat 5100 gctccgcatt ggtcttgacc aactctatca gagcttggtt gacggcaatt tcgatgatgc 5160 agcttgggcg cagggtcgat gcgacgcaat cgtccgatcc ggagccggga ctgtcgggcg 5220 TACACAAATC G CCCGCAGAAG CGCGGCCGT CTGGACCGAT GGCTGTGTAG AAGTACTCGC 5280 CGATAGTGGAA ACCGACGCCC CAGC ACTC GTCCGAGGGC AAAGGAATAGG GATCCCTAGA 5340 GCTCGCTGAT CAGCCTCGAC TGTGCCTTCT AGTTGCCAGC CATCTGTTGT T TGCCCCTCC 5400 CCC GTGCCTT CCTTGAC CCT GGAAGGTGCC ACTCCC ACTG TCCTTTCCTA AT AAAATGAG 5460 GAAATTGCATC GCATTGTCTG AGTAGGTGTC ATTCTATTC TGGGGGGTGG GGTGGGGCAG 5520 GACAGCAAGG GGGAGATTGG GAAGAGAAT AGCAGGCATG CTGGGGA 5567

Claims

1. A recombination translocation screening system mediating the directed transfer of heterologous chromosomes, characterized in that, This includes recipient cell gene editing vectors and donor cell gene editing vectors; The recipient cell gene editing vector comprises a gene editor 1 targeting the telomere location on the recipient cell chromosome and Donor DNA 1; the Donor DNA 1 consists of the following elements: promoter - 5' drug resistance gene - containing lox Functional introns of the P sequence; The donor cell gene editing vector comprises a gene editor 2 targeting the centromere region of the donor cell chromosome and Donor DNA 2; the Donor DNA 2 consists of the following elements: containing lox The functional intron of the P sequence - 3' drug resistance gene - polyA sequence; The 5' and 3' drug resistance genes are formed by artificially splitting a complete drug resistance gene into two parts. These split 5' and 3' drug resistance genes can undergo Cre / recombinase reactions. lox P-site specific recombination, thereby restoring drug resistance function; The gene editor is a targeting vector based on CRISPR-Cas9 technology. Gene editor 1 contains sgRNA that targets the telomere position of the recipient cell chromosome, and gene editor 2 contains sgRNA that targets the centromere position of the donor cell chromosome.

2. The system according to claim 1, characterized in that, The location where the drug resistance gene is split is determined by following the principles of RNA splicing and referring to conserved sequence information near the splice site, selecting sites with base sequences of AAGG or CAGG.

3. The system according to claim 1, characterized in that, The drug resistance gene is neo or puro .

4. The system according to claim 1, characterized in that, The functional intron is the SV40LT intron, with the sequence shown in SEQ ID No:

1.

5. The system according to claim 1, characterized in that, The promoter is the Pol II promoter.

6. The system according to any one of claims 1-5, characterized in that, The recipient cells and donor cells are from different species.

7. The system according to claim 6, characterized in that, The recipient cells are derived from mice or pigs, and the donor cells are derived from humans.

8. The system according to claim 6, characterized in that, The recipient cells and donor cells are stem cell lines derived from the corresponding species, including induced pluripotent stem cells.

Images