A plant growth promoting Agrobacterium and its application

Abstract

The present invention relates to a plant growth-promoting Agrobacterium and its application, wherein the plant growth-promoting Agrobacterium is Agrobacterium larrymoorei, which has been deposited in the General Microbiological Center of China Microbiological Culture Collection Administration on May 9, 2022, with a deposit number of CGMCC No. 24856. The plant growth-promoting Agrobacterium of the present invention is isolated from the rhizosphere soil of corn. The plant growth-promoting Agrobacterium can promote the growth of dicotyledonous plant lettuce and monocotyledonous plant wheat. Compared with the prior art, the plant growth-promoting Agrobacterium larrymoorei of the present invention has a nitrogen fixation effect, can effectively increase the nitrogen in wheat and lettuce, has a significant promoting effect on the growth of wheat and lettuce, and is expected to be widely used in the field of microbial fertilizers.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and in particular to a plant growth-promoting Agrobacterium and its application. Background Art

[0002] According to statistics, due to the large-scale application of chemical fertilizers, chemical nutrients have accumulated in the cultivated soil, and problems such as soil acidification and secondary salinization have become increasingly prominent. The soil microecological balance has been seriously damaged, pathogens have accumulated in large quantities, plant growth is weak, and diseases are prevalent, which has posed a serious threat to the ecological environment and food safety of farmland. Improving the current production technology model of excessive application of chemical fertilizers and pesticides in agricultural production, improving soil structure, increasing the number and activity of beneficial microorganisms in the soil, promoting plant growth, increasing the utilization rate of fertilizers in the soil, and improving the soil's fertilizer supply capacity have become important directions for the current and future development of my country's agriculture. It is very necessary to restore a good farmland ecological environment, achieve harmonious coexistence and common development between agricultural production and nature, and promote the sustainable development of agricultural ecology, economy, and society.

[0003] Microbial fertilizers are a type of specific products containing living microorganisms. They are used in agricultural production to obtain specific fertilizer effects, in which the living microorganisms in the products play a key role. At present, microbial fertilizer products are generally divided into two categories: one is microbial fertilizers in a narrow sense, which refers to the increase in the supply of plant nutrients through the life activities of microorganisms, including the total supply of plant nutrients in the soil and production environment, leading to the improvement of plant nutritional status and thus increasing yields. The representative of this type of microbial fertilizer is rhizobium fertilizer; the other is microbial fertilizers in a broad sense, which refers to the life activities of microorganisms in which not only the supply of plant nutrients can be increased, but also plant growth hormones can be produced, promoting the absorption and utilization of nutrients by plants or antagonizing the pathogenic effects of certain pathogenic microorganisms, reducing crop diseases and insect pests and indirectly increasing crop yields. Compared with chemical fertilizers, microbial fertilizers have the following advantages: they do not destroy the soil structure; they protect the ecology, do not pollute the environment, and are non-toxic and harmless to humans and animals; they have a lasting fertilizer effect; they increase crop yields and improve crop quality; they are low-cost and economical.

[0004] Plant growth promoting rhizobacteria (PGPR) are a type of microorganisms that can colonize in the rhizosphere of plants at high density. They can inhibit plant pathogens and harmful rhizosphere microorganisms, promote plant growth and increase crop yields. As an important resource library for biofertilizers and biopesticides, the research and application of PGPR has played a pivotal role. Researching and developing microbial fertilizers from the perspective of resource recycling is more practical for comprehensive resource utilization and environmental protection.

[0005] Studies have found that Agrobacterium is also a plant rhizosphere growth-promoting bacterium. Most Agrobacterium can infect the roots of dicotyledonous plants and promote the proliferation of roots or stems, but are not easy to infect monocotyledonous plants. According to relevant literature reports (DOI: 10.3976 / j.issn.1002-4026.2017.04.005), Agrobacterium K1026 has no obvious effect on the growth of monocotyledonous plant wheat. Summary of the invention

[0006] One of the purposes of the present invention is to provide a plant growth promoting Agrobacterium

[0007] The second object of the present invention is to provide the application of the plant growth-promoting Agrobacterium.

[0008] To achieve the above-mentioned purpose, the present invention provides a plant growth-promoting Agrobacterium and its application.

[0009] The purpose of the present invention can be achieved by the following technical solutions:

[0010] One of the technical solutions of the present invention is to provide a plant growth-promoting Agrobacterium. The plant growth-promoting Agrobacterium has been deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on May 9, 2022, with the deposit address being No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number being CGMCC No. 24856, and is named Agrobacterium larrymoorei.

[0011] Furthermore, the colony characteristics of the plant growth-promoting Agrobacterium are as follows: after being cultured on LB plate culture medium for 24 hours, the colonies are round, with a smooth, moist, raised surface, white and transparent, and regular edges.

[0012] Furthermore, the 16S rDNA sequence of the plant growth-promoting Agrobacterium is shown as SEQ ID No.1.

[0013] Furthermore, the technical solution also provides a bacterial agent containing the plant growth-promoting Agrobacterium.

[0014] Furthermore, the composition of the microbial agent includes sterile water and plant growth-promoting Agrobacterium, and the ratio of sterile water to plant growth-promoting Agrobacterium is 100mL:1g.

[0015] The second technical solution of the present invention is to provide an application of the plant growth-promoting Agrobacterium or bacterial agent as described in one of the technical solutions.

[0016] Furthermore, the plant growth-promoting Agrobacterium or the bacterial agent is used in promoting plant growth.

[0017] Furthermore, the plant is an angiosperm.

[0018] Furthermore, the angiosperms are lettuce and wheat.

[0019] Furthermore, the plant growth-promoting Agrobacterium or the bacterial agent acts on the roots of the plant.

[0020] Furthermore, the plant growth-promoting Agrobacterium or the bacterial agent is used in the preparation of biological fertilizer.

[0021] Compared with the prior art, the beneficial effect of the present invention is that the Agrobacterium larrymoorei of the present invention has a nitrogen fixation effect, can effectively increase the nitrogen in the monocotyledonous plant wheat and the dicotyledonous plant lettuce, has a significant promoting effect on the growth of the monocotyledonous plant wheat and the dicotyledonous plant lettuce, and is expected to be widely used in the field of microbial fertilizers. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a picture of the colony morphology of Agrobacterium Larrimoreii on LB solid medium.

[0023] Figure 2 These are the experimental group and control group pictures of lettuce in Example 2.

[0024] Figure 3 These are pictures of the wheat potted experimental group and the control group in Example 3.

[0025] Figure 4 These are the experimental group and control group pictures of wheat in Example 3.

[0026] Among them, Ck was the control group and 23002 was the experimental group.

[0027] Biomaterial Deposit Information

[0028] The plant growth-promoting bacteria described in the present invention have been deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on May 9, 2022. The deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is: CGMCC No. 24856, and it is named Agrobacterium larrymoorei. DETAILED DESCRIPTION

[0029] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0030] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0031] Embodiment 1:

[0032] Isolation and identification of Agrobacterium Larrimoreii:

[0033] The specific separation method is as follows:

[0034] (1) The five-point sampling method was used to collect corn rhizosphere soil from a corn planting base in Suihua City, Heilongjiang Province, and the collected corn rhizosphere soil was pretreated by passing through a sieve with a pore size of 2 mm;

[0035] (2) Add 90 mL of sterile water and about 20 glass beads to 10 g of corn rhizosphere soil after the above pretreatment, shake it on a shaker at 150 r / min for 10 min, and let it stand to obtain a soil concentration of 10 -1 g / mL of mother solution;

[0036] (3) Take 1 mL of the supernatant of the mother solution in step (2) and add it to 9 mL of sterile water to obtain a soil concentration of 10 -2 g / mL dilution, and so on, and then 3-9 times gradient dilution to obtain a soil concentration of 10 -3 -10 -10 g / mL dilution;

[0037] (4) Spread each dilution in step (3) on an ACCC55 medium plate for culture, and spread each dilution on three ACCC55 medium plates as a parallel experiment. Pick the grown colonies and re-inoculate them on the ACCC55 medium plate and culture them at 28° C. for 4 days. Repeat this process several times to screen out nitrogen-fixing single colonies.

[0038] (5) The nitrogen-fixing single colony in step (4) was inoculated on LB solid medium for purification and culture at 30°C for 24 hours, and the purified colony was sequenced for 16S rDNA. The primer F (SEQ ID No. 2) was AGAGTTTGATCCTGGCTCAG, and the primer R (SEQ ID No. 3) was TACGGYTACCTTGTTACGACTT. The 16S rDNA sequence is shown in SEQ ID No. 1. Figure 1 As shown, after culturing on LB plate medium for 24 hours, the colonies were round, smooth, moist, raised, white and transparent, with regular edges.

[0039] Among them, the formula of ACCC55 culture medium is as follows: sucrose 10.0g, sodium chloride 0.2g, calcium carbonate 1.0g, potassium dihydrogen phosphate trihydrate 0.5g, magnesium sulfate heptahydrate 0.2g, agar 18.0g, distilled water 1000mL, pH adjusted to 7.4-7.6. After high-temperature sterilization at 121℃ for 15min, pour into a plate for use.

[0040] The formula of LB solid medium is as follows: 5g yeast extract, 10g tryptone, 10g NaCl, 18.0g agar, 1000mL distilled water, pH adjusted to about 7.0. Sterilize at 121℃ for 15min and pour into a plate for later use.

[0041] Embodiment 2:

[0042] Potted experiment of lettuce:

[0043] The seeds of rapeseed were cultured in a seedling tray and seedlings were raised under natural conditions for 1 week. The rapeseed seedlings with the same growth were selected as the experimental subjects of the potted culture experiment. The rapeseed seedlings were transplanted into a cup filled with an equal amount of soil, and an equal amount of water (control group) and bacterial suspension (experimental group) were added to the rapeseed on two fixed days a week. In this embodiment, Tuesday and Friday were selected to add 100 mL of water or bacterial suspension to the rapeseed, and the rapeseed was cultured continuously for 1 month. After the culture was completed, the rapeseed was harvested and weighed to calculate the growth rate, and the total nitrogen and total phosphorus indicators in the rapeseed were detected.

[0044] The bacterial suspension was prepared as follows:

[0045] The formula of LB liquid medium is as follows: 5 g yeast extract, 10 g tryptone, 10 g NaCl, 1000 mL distilled water, pH adjusted to about 7.0. Sterilize at 121°C for 15 min for use.

[0046] Agrobacterium larrymoorei was inoculated into LB liquid medium, cultured at 30°C and 220 rpm for 2 days, and then centrifuged to obtain bacterial masses. 1 g of bacterial masses was suspended in 100 mL of sterile water to obtain a bacterial suspension.

[0047] like Figure 2 As shown in Table 1, the growth rate of the experimental group is higher than that of the control group, which is twice that of the control group.

[0048] Table 1 Growth of rapeseed

[0049]

[0050] The lettuce was ground and dried, and passed through a 0.25-0.5 mm sieve. 0.1-0.2 g of the sieved lettuce was weighed and placed in a 100 mL digestion tube. The lettuce was first moistened with water, and 5 mL of concentrated sulfuric acid was added and slowly heated. The concentrated sulfuric acid was decomposed and white smoke was emitted, and the temperature was gradually increased. When the solution was all brown-black, 300 g / L of hydrogen peroxide was added dropwise, and then heated to a slight boil for 10-20 min. After cooling slightly, 300 g / L of hydrogen peroxide was added again. This was repeated 2-3 times until the solution was colorless or clear. The solution was fixed to 100 mL with deionized water, filtered, and the filtrate was taken to determine the N and P elements. The results are shown in Table 2. The total nitrogen content and total phosphorus content in the experimental group were higher than those in the control group, and the total nitrogen content in the experimental group was more than twice that of the control group.

[0051] Table 2 Determination of total nitrogen and total phosphorus in lettuce

[0052]

[0053] Embodiment 3:

[0054] Wheat pot experiment:

[0055] The wheat seeds were cultured in a seedling tray, and the seedlings were raised under natural conditions for 1 week, and the wheat seedlings with the same growth were selected as the experimental subjects of the potted culture experiment. The wheat seedlings were transplanted into a cup with an equal amount of soil, and an equal amount of water and bacterial suspension were added to the wheat for two fixed days a week. In this embodiment, Tuesday and Friday were selected to add 100 mL of water or bacterial suspension to the wheat, and the wheat was cultured continuously for 3 months. After the cultivation was completed, the wheat was harvested, and the total nitrogen and total phosphorus indicators in the wheat were detected.

[0056] The bacterial suspension was prepared as follows:

[0057] The formula of LB liquid medium is as follows: 5 g yeast extract, 10 g tryptone, 10 g NaCl, 1000 mL distilled water, pH adjusted to about 7.0. Sterilize at 121°C for 15 min for use.

[0058] Agrobacterium larrymoorei was inoculated into LB liquid medium, cultured at 30°C and 220 rpm for 2 days, and then centrifuged to obtain bacterial masses. 1 g of bacterial masses was suspended in 100 mL of sterile water to obtain a bacterial suspension.

[0059] like Figure 3 The wheat potted plants shown in the figure show that the growth of wheat in the experimental group is significantly better than that in the control group. Figure 4 As shown in Table 3, the wheat root system of the experimental group is significantly more developed than that of the control group. As shown in Table 3, the growth rate of the experimental group is significantly higher than that of the control group, which is 3 times that of the control group.

[0060] Table 3 Wheat growth

[0061]

[0062] The wheat was ground and dried, and passed through a 0.25-0.5 mm sieve. 0.1-0.2 g of the sieved wheat was weighed and placed in a 100 mL digestion tube. The wheat was first moistened with water, and 5 mL of concentrated sulfuric acid was added and slowly heated. The concentrated sulfuric acid was decomposed and white smoke was emitted, and the temperature was gradually increased. When the solution was all brown-black, 300 g / L of hydrogen peroxide was added dropwise, and then heated to a slight boil for 10-20 min. After cooling slightly, 300 g / L of hydrogen peroxide was added again. This was repeated 2-3 times until the solution was colorless or clear. The solution was fixed to 100 mL with deionized water, filtered, and the filtrate was taken to determine the N and P elements. The results are shown in Table 4. The total nitrogen content and total phosphorus content in the experimental group were higher than those in the control group, and the total nitrogen content in the experimental group was more than twice that of the control group.

[0063] Table 4 Determination of total nitrogen and total phosphorus in wheat

[0064]

[0065] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

[0066] SEQ ID No.1

[0067]

Claims

1. A plant growth promoting Agrobacterium, characterized in that It was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on May 9, 2022. The deposit address is: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is: CGMCC No. 24856, and it is named Agrobacterium Larrimorei ( Agrobacterium larrymoorei .

2. A bacterial agent containing the plant growth-promoting Agrobacterium as claimed in claim 1.

3. The bacterial agent according to claim 2, characterized in that The composition of the microbial agent includes sterile water and plant growth-promoting Agrobacterium, and the ratio of sterile water to plant growth-promoting Agrobacterium is 100 mL: 1 g.

4. A use of the plant growth-promoting Agrobacterium according to claim 1 or the bacterial agent according to claim 2 in promoting plant growth, characterized in that: The plants are lettuce and wheat.

5. The use according to claim 4, characterized in that: The plant growth-promoting Agrobacterium or the bacterial agent acts on the roots of the plant.

6. Use of the plant growth-promoting Agrobacterium according to claim 1 or the bacterial agent according to claim 2 in the preparation of biological fertilizer.

Images