Role of Rice Outermost Cell-Specific Gene 6 in Rice Breeding
By constructing OsRoc6 overexpression and knockout rice transgenic plants, and studying their role in the regulation of rice flowering time, plant height and leaf curl, the problem of insufficient research on the effect of OsRoc6 was solved, and the theoretical basis for rice breeding was provided.
Patent Information
- Application Number
- CN202211259228.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-14
- Publication Date
- 2025-04-15
- Estimated Expiration
- 2042-10-14
AI Technical Summary
In the prior art, there are few studies on the role of the outermost cell-specific gene 6 (OsROC6) in rice breeding, and there is a lack of a clear understanding of its expression and function.
The role of OsRoc6 in the regulation of rice flowering time, plant height and leaf curl by constructing T-DNA insertion mutants overexpressing OsRoc6 and CRISPR-Cas9 knockout OsRoc6 transgenic plants was studied.
It was found that OsRoc6 has a significant regulatory effect in the development of rice, and the flowering time, plant height and leaf curl of overexpression and knockout plants were significantly changed, providing the theoretical basis of OsRoc6 in rice breeding.
Smart Images
Figure CN115820667B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of crop breeding, and specifically relates to a rice outermost cell-specific gene 6 ( OsROC6 ) in rice breeding. Background Art
[0002] In recent years, the rapid development of rice functional genomics research has identified a large number of genes with important utilization value for my country's rice genetic breeding, and rice breeding is moving towards a new era of design breeding. The innovative development of rice breeding has provided an important guarantee for my country's food security, and increasing yields will remain the main focus of my country's rice breeding in the future. Therefore, we must continue to attach importance to the discovery, cloning and identification of new genes that regulate important agronomic traits of rice, provide components for design breeding, and serve the strategic needs of precision, dataization and intelligence in rice breeding in the new era.
[0003] At present, there are very few studies on the outermost cell-specific gene subfamily of the homeodomain-leucine zipper protein IV family in rice. The present invention is designed to target one of the members of this subfamily. OsRoc6 The expression and function of Rice outermost cell-specific gene 6 were studied. Summary of the invention
[0004] The object of the present invention is to provide OsRoc6 The regulatory effects on rice flowering time, plant height, and leaf curling provide a theoretical basis for rice breeding.
[0005] Said OsRoc6 The gene sequence is as follows:
[0006] Gene sequence>LOC_Os09g35760
[0007]
[0008] The present invention constructs an overexpression OsRoc6 T-DNA insertion mutants and CRISPR - Cas9 knockout OsRoc6 Transgenic plants, overexpression and knockout OsRoc6 The phenotype of rice has been initially determined. OsRoc6 Role in rice development.
[0009] The present invention is constructed by T-DNA insertion OsRoc6 Activated plants and CRISPR / Cas9 technology construction OsRoc6 The knockout transgenic plants showed the opposite phenotype, with significant changes in flowering time, plant height, and leaf curling compared to wild-type plants. GUS staining showed OsRoc6 The discovery of these results will provide OsRoc6 It provides a strong theoretical basis for its role in rice breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0010] Figure 1 for OsRoc6 Phenotypic results of T-DNA insertion mutant plants. OsRoc6 T-DNA insertion site, CRISPR / Cas9 knockout site and primer position in the gene sequence; B is OsRoc6 The expression level was increased in the T-DNA insertion mutant (AT); C and D for OsRoc6 The activated plants (AT) flowered 31 days earlier than the wild-type plants; E is OsRoc6 The activated plants (AT) are shorter than the wild-type plants; F is OsRoc6 The leaves of activated plants (AT) curled.
[0011] Figure 2 CRISPR / Cas9 knockout OsRoc6 Transgenic plant sequencing screening homozygous results. Among them: A is T0 generation CRISPR / Cas9 knockout OsRoc6 Gene sequencing of transgenic plants; B is T0 generation CRISPR / Cas9 knockout OsRoc6 Gene sequencing peaks of transgenic plants.
[0012] Figure 3 CRISPR / Cas9 knockout OsRoc6 Phenotypic results of transgenic plants (KO). A is the phenotype of the offspring plants of CR#2 and CR#9; B is the flowering time of the offspring plants of CR#2 and CR#9 delayed by 10 days; C is the height of the offspring plants of CR#2 and CR#9 increased by 7%.
[0013] Figure 4 For different periods OsRoc6 The expression pattern results of the above results. A is a 3-day-old seedling planted in MS medium; B is a 7-day-old seedling planted in MS medium; C is a rice flower in the flowering stage; and D is a rice seed in the fruiting stage. DETAILED DESCRIPTION
[0014] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples, but it should not be construed as limiting the present invention. Without departing from the spirit and substance of the present invention, the modification or replacement of the method, steps or conditions of the present invention all belong to the scope of the present invention. The experimental methods and reagents without specifying the specific conditions in the examples are all in accordance with the conventional conditions in the art.
[0015] Example 1
[0016] 1. Rice cultivation
[0017] Build in Oryza sativa cv. Dongjin OsRoc6 T-DNA insertion mutant germline 3A-06218 ( Plant Science , 2016, 252: 133–143; Journal of Plant Biology, 2017, 60(3):268-2772) and CRISPR / Cas9 knockout mutant germlines.
[0018] Seeds were germinated in MS medium (Murashig and Skoog Medium) containing 3% sucrose, and seedlings were transplanted into soil 7 days after seed germination. Plants were grown in the field or in a greenhouse (14.5 h light, 28 °C / 9.5 h dark, 22 °C, 50% humidity).
[0019] OsRoc6 T-DNA insertion site, CRISPR / Cas9 knockout site and primer position in gene sequence Figure 1 As shown in A.
[0020] The T-DNA insertion homozygous mutant plants were genotyped using the following primers:
[0021] F1:TCGCTTCCATATTTGCTGCC (Seq_2),
[0022] R1: CCACCGTGATCCTACCAACT (Seq_3) and 5'-TTGGGATCCTCTAGAGTCGAG-3' (L0.5) (Seq_4).
[0023] The CRISPR / Cas9 gene knockout site is on the sixth intron, target sequence: GTCCGAGAACCTGTCAATCC (Seq_5).
[0024] 2. RNA Extraction and Real-time Quantitative PCR Analysis
[0025] RNA was extracted from the middle 1.5 to 2 cm of the second uppermost leaf. Total RNA was extracted using RNAisoPlus (TaKaRa, Shiga, Japan; http: / / www.takarabio.com), ensuring that the 260 / 280 ratio of the RNA sample was greater than 1.8 (NanoDrop 2000; Thermo Scientific, Wilmington, DE, USA; http: / / www.nanodrop.com).
[0026] cDNA synthesis was performed using 2 μg of total RNA, Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI, USA; http: / / www.promega.com), RNasin® Ribonuclease Inhibitor (Promega), oligo (dT) 18 Primers and dNTPs.
[0027] Real-time quantitative PCR was used to detect the expression of target genes using SYBR Green I Prime Q-Master mix (GENETBIO, Daejeon, Republic of Korea) and the Rotor-Gene Q (QIAGEN, Hilden, Germany). All experiments were performed with samples from at least four different plants and repeated three times.
[0028] Gene expression changes were calculated using the ∆∆Ct method. Primer specificity was determined based on melting point curves, with OsUbi5 used as an internal reference.
[0029] OsUbi5 The primer sequences are as follows:
[0030] F: 5'-TGAAGACCCTGACTGGGAAG-3' (Seq_6) and R: 5'-CACGGTTCAACAACATCCAG-3' (Seq_7).
[0031] OsRoc6 The qRT-PCR primers are as follows:
[0032] F2: CTTCGGTGGCATGTTCGATG (Seq_8), R2: GCTACCGTCCATAGTTTGCC (Seq_9).
[0033] like Figure 1 As shown, compared with the wild-type plants, the T-DNA insertion mutant line 3A-06218 selected by genotyping OsRoc6 The expression level increased by 17 times ( Figure 1 B), the mutant plants flowered 31 days earlier ( Figure 1 CD), short plants ( Figure 1 E), leaves curled ( Figure 1 F).
[0034] 3. Vector Construction and Rice Transformation
[0035] Designed using http: / / skl.scau.edu.cn / OsRoc6 CRISPR / Cas9 gene knockout site and primer sequences, ligated to pYLCRISPR / Cas9P ubi -H vector, and then transformed into E. coli plasmid. According to the freeze-thaw method, the CRISPR / Cas9 gene knockout vector was transfected into Agrobacterium Agrobacterium tumefaciens LBA4404. Transgenic plants were cultivated by Agrobacterium transformation method.
[0036] Constructed T0 generation CRISPR / Cas9 knockout OsRoc6 Gene sequencing of transgenic plants revealed that CR#2 and CR#9 were homozygous knockout mutants (KO), because the sequencing sequences of these two groups of plants had a single gene sequence change that caused amino acid coding changes ( Figure 2 A), the sequencing peaks are clear and different from the wild type ( Figure 2 B), therefore, the offspring plants of CR#2 and CR#9 can be used for breeding.
[0037] CRISPR / Cas9 knockout OsRoc6 The offspring of transgenic plants CR#2 and CR#9 showed delayed flowering time (e.g. Figure 3 A and Figure 3 B), the phenotype of increased plant height ( Figure 3 C).
[0038] 4. GUS staining and photography
[0039] The GUS-tagged OsRoc6The mutants were sampled from three-day-old seedlings, seven-day-old seedlings, young panicles at the flowering stage, and young panicles at the fruiting stage. The samples were cut with a razor blade and placed in a GUS dye solution. After 24 hours at room temperature, chlorophyll was removed with 70% and 95% alcohols, and impurities were removed with a cleaning solution at room temperature. The samples were observed and photographed using a SZX16 stereo microscope and a DP72 camera (2).
[0040] The T-DNA insertion vector carries a GUS tag. The rice ears planted on MS medium for 3 and 7 days, at the flowering stage and at the fruiting stage were stained with GUS solution. OsRoc6 Ubiquitously expressed in the whole plant (e.g. Figure 4 A. Figure 4 B), which is highly expressed in filaments, ovaries, and stigmas during the flowering period ( Figure 4 C), the fruiting period is mainly expressed in the outermost layer of the seed ( Figure 4 D).
[0041] The present invention is constructed by T-DNA insertion OsRoc6 Activated plants and CRISPR / Cas9 technology construction OsRoc6 The knockout transgenic plants showed the opposite phenotype, with significant changes in flowering time, plant height, and leaf curling compared to wild-type plants. GUS staining showed OsRoc6 The discovery of these results will provide OsRoc6 It provides a strong theoretical basis for its role in rice breeding.
Claims
1. OsRoc6 The application of the gene in rice breeding is characterized in that: Said OsRoc6 Genes for promoting flowering in rice OsRoc6 Gene is used to regulate rice plant height, the OsRoc6 The gene is used to regulate the curling degree of rice leaves; OsRoc6 The nucleotide sequence of the gene is shown in SEQ ID NO:1.