A method for engineering regulation of mRNA translation efficiency based on ribosomal s1 protein acylation modification

Abstract

The application discloses a method for engineering regulation of mRNA translation efficiency based on ribosome S1 protein acylation modification, and belongs to the field of genetic engineering and microbial protein expression. The method comprises the following steps: regulating the translation efficiency of mRNAs by modifying the acylation site of ribosome S1 protein; dynamically regulating the recruitment and translation efficiency of specific mRNAs by screening and identifying SBS sequences with different intensities under different acylation states of ribosome S1 protein; regulating the translation efficiency of specific mRNAs by the interaction force between ribosome S1 protein and SBS sequences; and dynamically regulating the translation efficiency of specific mRNAs by dynamically adjusting the acylation level of ribosome S1 protein. The application regulates the interaction between ribosome S1 protein acylation modification and SBS sequence optimization in the translation initiation process and influences the translation efficiency, which provides a new idea for designing a novel translation regulation element and improving the expression level of mRNAs.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and microbial protein expression, and in particular to a method for regulating the translation efficiency of mRNAs based on ribosomal S1 protein acylation modification engineering. Background Technology

[0002] In prokaryotes such as *E. coli*, the ribosomal protein S1 is involved in the translation initiation of almost all conventional mRNAs. The selective binding of mRNA by ribosomes during *E. coli* translation initiation involves two parts: the highly conserved 3' end (anti-SD, aSD) of 16S rRNA is complementary to the SD sequence on the mRNA, and the interaction between the S1 protein and its binding sites on the mRNA. The S1 protein binding sites (SBS) are approximately 11 nucleotide sequences located between the promoter and the SD sequence (Shine-Dalgarno sequence), and their interaction and binding affinity with the S1 protein play a crucial role in mRNA recruitment and translation initiation. mRNA translation initiation in *E. coli* requires three steps: ribosome docking with the structural regions of the mRNA single strand, disruption of the mRNA structure, and the unfolded mRNA entering the ribosomal RNA decoding channel. The S1 protein can disrupt the secondary structure of mRNA and bind to the SBS sequence to facilitate mRNA entry. Therefore, the interaction between the S1 protein and the SBS sequence on mRNA directly affects mRNA recruitment and translation initiation, and may regulate mRNA translation efficiency.

[0003] Protein acylation, as an important post-translational modification, affects protein activity by altering protein structure and charge, and plays a role in transcriptional regulation, central metabolism, and cellular localization. The S1 protein contains numerous acetylation sites, and modifying these sites to regulate S1 protein activity could potentially become a tool for controlling mRNA translation efficiency. Currently, promoter and RBS (ribosome-binding site) sequence optimization and modification methods are widely used to enhance mRNA translation or gene expression levels. However, methods based on the interaction between the S1 protein and the RBS sequence to study the regulation of mRNA translation efficiency are rarely reported. Summary of the Invention

[0004] The purpose of this invention is to provide a method for regulating the translation efficiency of mRNAs based on ribosomal S1 protein acylation modification, in order to solve the problems existing in the prior art. By ribosomal S1 protein acylation modification and SBS sequence optimization, the interaction between S1 protein and SBS sequence during translation initiation can be regulated, and translation efficiency can be further affected. This provides a new idea for designing novel translation regulatory elements and improving the expression level of mRNA.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] This invention provides a method for regulating mRNA translation efficiency based on ribosomal S1 protein acylation modification engineering, the method comprising any one of the following (1)-(4):

[0007] (1) Modify the acylation site of ribosomal S1 protein to regulate the translation efficiency of mRNAs;

[0008] (2) By screening and identifying SBS sequences with different strengths under different ribosomal S1 protein acylation states, the recruitment and translation efficiency of specific mRNAs can be dynamically regulated.

[0009] (3) The translation efficiency of specific mRNAs is regulated by the interaction between the ribosomal S1 protein and the SBS sequence;

[0010] (4) By dynamically regulating the acylation level of ribosomal S1 protein, the translation efficiency of specific mRNAs can be dynamically controlled.

[0011] Preferably, the modification of the S1 protein acylation site includes the following modifications:

[0012] S1: By regulating the acylation level of the S1 protein, the interaction and binding affinity between the S1 protein and the upstream SBS sequence of mRNA are regulated; but not limited to this, it also includes other ways to regulate the interaction and binding affinity between the S1 protein and the SBS sequence.

[0013] S2: Acylation of the S1 protein by site-directed mutation using genetic engineering methods.

[0014] Preferably, the S1 protein acylation level includes the S1 protein acetylation level.

[0015] Preferably, the S1 protein acylation level is adjusted by changing the cell culture environment (e.g., adjusting the carbon and nitrogen nutrient balance) or optimizing the activity of intracellular acylation modifying enzymes to adjust the intracellular S1 protein acylation level.

[0016] Preferably, the site for the site-directed mutation acylation of the S1 protein includes lysine residues at positions 411 and 464 of the amino acid sequence of the S1 protein. However, it is not limited to this and can also be other sites on the amino acid sequence of the S1 protein.

[0017] Preferably, the site-directed mutagenesis acylation of the S1 protein includes: mutating lysines at positions 411 and 464 of the amino acid sequence of the S1 protein to arginine (simulating a non-acylated lysine site with an acylation level of zero) or glutamine (simulating a lysine acylation site with an acylation level of 100%).

[0018] Preferably, the SBS sequence is the binding sequence of the ribosomal S1 protein upstream of the SD sequence of mRNAs, generally around 11 nucleotides; more preferably, the SBS sequence is as shown in SEQ ID NO: 1.

[0019] Preferably, the mRNAs include fluorescent protein gene mRNAs; but not limited thereto, they also include other test gene mRNAs that may be effective.

[0020] This invention also provides an SBS sequence mutation library constructed based on ribosomal S1 protein acylation modification engineering. Based on the different binding affinities of non-acylated and acylated S1 proteins to different SBS sequences, SBS sequences of varying strengths are screened to construct the SBS sequence mutation library. The SBS sequence is shown in SEQ ID NO: 1.

[0021] The screening and identification of SBS sequences of varying intensities can be conducted from natural SBS sequences of different intensities across all microbial mRNAs, or from artificially constructed SBS sequence mutation libraries. The translation efficiency differences among all microbial mRNAs can be analyzed using acylated and non-acylated S1 proteins (such as S1-K411Q / K464Q, S1-K411R / K464R, etc.), allowing for the screening and identification of strongly or weakly expressed natural SBS sequences in both acylated and non-acylated states. Artificially constructed SBS mutation libraries can screen and identify SBS sequences of different intensities for regulating mRNA translation efficiency. Non-acylated and acylated S1 proteins exhibit different binding affinities for different SBS sequences, and their recruitment efficiencies for mRNAs containing different SBS sequences vary. Therefore, different intensities of SBS sequences can be screened using various methods to construct SBS sequence mutation libraries for use in mRNA regulation.

[0022] The present invention also provides the application of the SBS sequence mutation library in regulating the translation efficiency of mRNAs. By regulating the interaction between the S1 protein and the SBS sequence during the translation initiation process, the translation efficiency of mRNA can be regulated.

[0023] The present invention discloses the following technical effects:

[0024] This invention relates to a method for regulating mRNA translation efficiency (protein expression efficiency) based on ribosomal S1 protein acylation modification engineering and SBS sequence optimization. First, it discovers the effect of acetylation on the color enhancement function of S1 protein RNA, and further confirms that acetylation alters the affinity of S1 protein for different SBS sequences. Simultaneously, the translation intensity of target mRNAs with different SBS sequences varies significantly under different S1 protein acetylation states. Furthermore, this invention constructs a mutant library of SBS sequences based on different acylation states of S1 protein, screening a series of SBS sequences with varying intensities. By simulating acetylation at key sites of the S1 protein or altering nutritional conditions to enhance S1 protein acetylation, the translation efficiency of mRNAs containing specific SBS sequences can be dynamically regulated. Ribosomal S1 protein acylation modification and SBS sequence optimization can regulate the interaction between S1 protein and SBS sequence during translation initiation and further affect translation efficiency. Therefore, based on the interaction between S1 protein and SBS sequence, modifying the acylation sites of functional S1 protein and constructing a large number of SBS element libraries with a wide range of strengths may become a new method to regulate mRNA translation efficiency, and at the same time provide new ideas for designing novel translation regulatory elements and improving mRNA expression levels. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 AcP-catalyzed acetylation reduces the RNA color enhancement ability of S1 protein; (A) AcP-acetylated S1 protein Western blot experiment; (B) Comparison of RNA color enhancement ability of S1 protein, AcP-acetylated S1 protein and simulated site-directed mutant S1 protein; (C) Comparison of S1 protein acetylation level under different conditions.

[0027] Figure 2 To verify the binding ability of AcP-acetylated S1 protein to different SBS sequences in EMSA;

[0028] Figure 3 Testing of fluorescent protein assay elements guided by different SBS sequences in the S1 protein acetylation system;

[0029] Figure 4Testing of dual fluorescent protein assay elements guided by different SBS sequences in the S1 protein acetylation system;

[0030] Figure 5 Construction of an SBS mutant library based on S1 protein acetylation regulation: (A) Schematic diagram of SBS mutant library construction; (B) Mutant library counting, fluorescence assay, and SBS sequence analysis based on the wild-type S1 system; (C) S1 based on simulated acetylation mutations. K411,464Q The system includes mutant library counting, fluorescence assays, and SBSs sequence analysis.

[0031] (D) Base content analysis of SBSs mutant library; (E) High-intensity sequence base content analysis of SBSs mutant library;

[0032] Figure 6 Dynamic regulation of S1 protein acetylation and SBS-A sequence-guided translation of green fluorescent protein (GFP): (A) Schematic diagram of the SBS-A sequence and SBS-A (pKD236-Ptac-SBS-A-GFP) in the BL21 host cell assay system; (B) SBS-A (pKD236-Ptac-SBS-A-GFP) in BL211-S1 / S1 K411,464Q Schematic diagram of the host cell assay system; (C) Fluorescent protein intensity assay of the BL21-SBS-A assay system under a limiting nitrogen source (or with nitrogen supplementation at 10h); (D) BL21-S1 / S1 K411,464Q - Intensity testing of fluorescent proteins using the SBS-A assay system with the addition of arabinose (or IPTG added after 10 h); (E) Intensity testing of fluorescent proteins using the BL21-SBS-A assay system with normal nitrogen source concentration (or with a limiting nitrogen source introduced after 10 h); (F) Intensity testing of fluorescent proteins using the BL21-SBS-A assay system with normal nitrogen source concentration (or with a limiting nitrogen source introduced after 10 h); K411,464Q - The intensity of fluorescent proteins was tested when IPTG was added (or arabinose was added at 10h) using the SBS-A testing system. Detailed Implementation

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0035] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0036] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0037] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0038] Example 1

[0039] 1. Ribosomal S1 protein acylation modification engineering and SBS sequence optimization regulate mRNA translation efficiency

[0040] (1) Western blot analysis to identify AcP (acetyl phosphate)-catalyzed S1 protein acetylation

[0041] The purified S1 protein was quantified and then used in the AcP acetylation experiment. The reaction system is as follows:

[0042] Table 1 Reaction System

[0043] name Final concentration HEPES buffer 50mM AcP 10mM S1 protein 10μg <![CDATA[H2O]]> Up to 100μl Overall system 100μl

[0044] The mixed reaction system was incubated in a 37°C water bath for different times. The S1 protein after the reaction was directly used for subsequent Western blot experiments. For the Western blot experiment, the S1 protein was first electrophoresed on a 10% protein gel. After electrophoresis, the protein gel was transferred to a PVDF membrane at 100V for 60 min to transfer the S1 protein to the PVDF membrane. The PVDF membrane was then washed three times with 10-20 ml of TBST buffer. After washing, 10 ml of blocking buffer (5% ABV dissolved in TBST buffer) was added and the membrane was blocked for 1.5-2.5 h. After blocking, 2-5 μl of mouse acetylation antibody was added to the blocking buffer and the membrane was incubated overnight at 4°C. The blocking buffer was discarded and the membrane was washed three times with TBST buffer. After washing, 10 ml of TBST buffer was added, followed by 1-2 μl of Anti-mouse HRP. The membrane was shaken on a horizontal shaker at room temperature for 45 min. The membrane was then washed three more times with TBST buffer. After washing, the PVDF membrane was added to the chromogenic buffer and photographed using an ECL chemiluminescence analyzer.

[0045] (2) Identification of S1 protein acetylation sites by mass spectrometry

[0046] AcP-acetylated S1 protein was used for protein electrophoresis. After staining, the target band was excised and washed with 50% ethanol. The sample was then cut into 1 mm pieces. 3 Small fragments were collected and incubated in 10 mM dithiothreitol at 56 °C for 1 h. Then, 55 mM acrylamide was added to the sample, and the sample was incubated in the dark at room temperature for 45 min. The protein was digested in 50 mM ammonium bicarbonate with 10 ng / μl trypsin at 37 °C for 16 h. The digests were then extracted with 50% ACN (acetonitrile) and 5% TFA (v / v) solutions, and 75% ACN and 0.1% TFA (v / v) solutions, respectively. The peptides were further desalted using a desalting column and dissolved in 0.1% TFA (v / v) solution. The acetylation sites were then identified using mass spectrometry.

[0047] (3) Identification of S1 protein acetylation level under different conditions

[0048] To further verify the acetylation of S1 protein by AcP under in vivo conditions, the key phosphotransacetase (Pta), which metabolizes AcP in *E. coli*, was first knocked out. Using the Red homologous recombination method, a kanamycin resistance gene (Kana) containing 59 bp homologous arms upstream and downstream of the pta gene was used as a selection marker, successfully obtaining the acid transacetase knockout strain Δpta. Subsequently, the S1 protein (WT::S1 and Δpta::S1) was overexpressed in *E. coli* WT and the Pta knockout strain Δpta using the pPRoEX-rpsA plasmid. Under glucose-only carbon source conditions, Δpta, due to the knockout of Pta, theoretically could not produce AcP. However, under acetate-only carbon source conditions, Δpta, due to the knockout of Pta, theoretically could not break down AcP and accumulated large amounts of AcP. In addition, to investigate whether the S1 protein can undergo acetylation in response to external nutrients (carbon-nitrogen imbalance), the acetylation levels of the S1 protein in the WT::S1 strain under normal nitrogen source and limiting nitrogen source were compared.

[0049] S1 protein-coding gene sequence:

[0050]

[0051] S1 K411,464Q Protein-coding gene sequences:

[0052]

[0053] (4) RNA colorimetric assay to determine the effect of acetylation on the interaction between S1 protein and RNA.

[0054] S1 and point-mutated S1 protein were purified using conventional protein induction expression methods. K411A S1 K411Q S1 K411R S1 K450A S1 K450Q S1 K450R S1 K464A S1 K464Q S1 K464R The above proteins were quantified and used in RNA color enhancement experiments. For the RNA color enhancement experiment, RNA obtained by in vitro transcription (polyrC-U, whose RNA sequence is UCUUCUUCUCUCUCUUUUCCUUUUUCUCUUUCUCUUUCUCUUCUUUCCCUUCUUCUUUUCUCUUCUUCUUCUUCUUCUUCCCUUUCU ...

[0055] The RNA color enhancement reaction system is as follows:

[0056] Table 2 RNA color enhancement reaction system

[0057] name Final concentration S1 protein 2μM RNA (polyrC-U) 100~200ng / μl Tris-HCl 5mM (pH 7.4) NaCl 10mM <![CDATA[H2O]]> Up to 100μl Overall system 100μl

[0058] After the reaction system was completely mixed, it was placed at room temperature for 20 minutes. The reaction system was then added to a colorless quartz 384-well plate and the absorbance at 260 nm was measured using an ELISA reader.

[0059] (5) EMSA determination of the interaction between S1 protein and different RNA sequences

[0060] The effect of acetylation on the binding of S1 protein to different RNA sequences was verified using EMSA experiments. The EMSA experiments used biotin-labeled RNA probes (UCGGCUCGUAUAAUGUGUGGAACGCUU). UUCCAUAAAUA AAGGAGAUAUACC, underscore indicates an SBS-Up sequence; UCGGCUCGUAUAAUGUGUGGAACGCUU UUUUCUCUUUC AAGGAGAUAUACC (underlined SBS-Down sequence) was synthesized by Shanghai Ruimian Biotechnology Co., Ltd.

[0061] First, the S1 protein is acetylated with AcP-S1 protein (AcP-S1). AcAfter quantification, it was used for EMSA binding reaction.

[0062] The EMSA reaction system is as follows:

[0063] Table 3 EMSA reaction system

[0064]

[0065]

[0066] The above reaction system was incubated at 18℃ for 30 min. After incubation, it was subjected to EMSA electrophoresis. Subsequently, the PAGE gel after electrophoresis was transferred to a nylon membrane under a constant voltage of 100V for 30–60 min. The transferred nylon membrane was crosslinked at 254 nm and 120 mJ / cm² for 1.5 min, and then blocked with EMSA blocking buffer for 15–30 min. The blocked nylon membrane was then washed three times with 1× washing buffer, 5–10 min each time. 2 μl of Streptavidin-HRP Conjugate antibody was added to 15 ml of blocking buffer, and incubation was continued for 30 min. The nylon membrane was washed again with 1× washing buffer, and imaging was performed using chemiluminescence after washing.

[0067] (6) Effects of S1 protein acetylation on the translation of fluorescent proteins guided by different SBS sequences

[0068] Different SBS sequences (SBS-Up: UUCCAUAAAUA, SBS-Down: UUUUCUCUUUC) were assembled into a device containing the same promoter (modified P). tacThe promoter, ribosome binding site RBS (AAGGAG), and fluorescent protein (mCherry) were incorporated into the pCU19 test plasmid and introduced into wild-type MG1655 strain (WT) and Δpta strain (with phosphotransacetase knocked out, which can induce AcP-catalyzed S1 protein acetylation when cultured with acetate as the carbon source) via electroporation. WT-SBS-Up, WT-SBS-Down, Δpta-SBS-Up, and Δpta-SBS-Down strains were cultured in 50 ml minimal salts medium (supplemented with 500 μl sodium acetate stock solution (0.27 g / ml) and 175 μl ammonium sulfate stock solution (0.247 g / ml)). The transcriptional level of mCherry was determined by quantitative real-time PCR (using 16S rRNA as an internal reference gene). The relative transcriptional level of red fluorescent protein was determined using a two-step qPCR method with primers (RT-mcherry-F: CGCGTGATGAACTTCGAGGA, RT-mcherry-R: TCTGCTTGATCTCGCCCTTC) and (RT-16S-F: GCAGCCATGCCGCGTGTAT, RT-16S-R: CCCTCTACGAGACTCAAGCTTGCC). The fluorescence intensity of mCherry was measured using a microplate reader. The fluorescence values ​​of mCherry were measured at an excitation wavelength of 570 nm and an emission wavelength of 610 nm, and then analyzed by OD. 600 To correct for relative fluorescence intensity, the relative fluorescence intensity of the red fluorescent protein is divided by the relative transcription level.

[0069] To eliminate the influence of differences in mCherry transcription levels on the experiments, SBS-Up sequence-guided mCherry and SBS-Down sequence-guided GFP were further assembled into the same test plasmid. The constructed binary test plasmid system was then transformed into WT and Δpta, respectively, by electroporation. For fluorescence assays of the binary test plasmid, the fluorescence values ​​of mCherry were measured at an excitation wavelength of 570 nm and an emission wavelength of 610 nm, and the fluorescence values ​​of GFP were measured at an excitation wavelength of 470 nm and an emission wavelength of 510 nm.

[0070] 2. Results Analysis

[0071] (1) AcP-catalyzed acetylation at K411 and K464 sites affects the function of S1 protein.

[0072] Incubation of S1 protein with 10 mM AcP at 37°C revealed that AcP catalyzed acetylation of S1 protein in a time-dependent manner. Figure 1A), and AcP-catalyzed acetylation significantly reduces the RNA-enhancing ability of the S1 protein. Figure 1 B).

[0073] Mass spectrometry results revealed that AcP catalyzes acetylation at sites K411, K450, and K464 in the RNA-binding region of the S1 protein, acetylating site-directed mutant protein S1. K411A S1 K411Q S1 K411R S1 K450A S1 K450Q S1 K450R S1 K464A S1 K464Q and S1 K464R RNA color enhancement experiments showed that acetylation at K411 and K464 sites reduced the RNA binding ability of the S1 protein, while acetylation at K450 site had almost no effect. Figure 1 B) indicates that acetylation at K411 and K464 sites can regulate the function of the S1 protein. Furthermore, the effect of knocking out phosphoryltransacetases affecting AcP concentration in vivo on the acetylation level of the S1 protein was observed. With glucose as the carbon source, the acetylation level of the S1 protein in Δpta was significantly decreased; conversely, with acetate as the carbon source, the acetylation level of the S1 protein in Δpta was significantly increased. Figure 1 C). Furthermore, we compared the acetylation levels of S1 protein under different nitrogen source conditions; the acetylation level of S1 protein was significantly increased under nitrogen restriction conditions. Figure 1 C) indicates that acetylation of the S1 protein may serve as a signal to sense the nitrogen source environment and regulate the activity of the S1 protein during translation.

[0074] (2) AcP-catalyzed acetylation regulates the binding ability of S1 protein to different SBS sequences.

[0075] Our work enriched two conserved SBS sequences (SBS-Up: UUCCAUAAAUA, SBS-Down: UUUUCUCUUUC) that respond to S1 protein acetylation. We used EMSA to compare the binding affinity of AcP-acetylated S1 protein to RNA probes containing either the SBS-Up or SBS-Down sequences. The results showed that AcP-acetylated S1 protein bound more strongly to SBS-Up than to SBS-Down. Figure 2 Simultaneously, acetylation increases the binding of the S1 protein to the SBS-Up sequence, while conversely decreasing the binding of the S1 protein to the SBS-Down sequence. Figure 2 This suggests that the affinity of S1 protein for different SBS sequences before and after acetylation may lead to S1 protein acetylation-mediated translational regulation.

[0076] (3) AcP-catalyzed acetylation regulates the translation of fluorescent proteins containing different SBS sequences by S1 protein.

[0077] To verify the effect of S1 protein acetylation on the translation regulation of mRNAs containing different SBS sequences, SBS-Up and SBS-Down sequences enriched in upregulated and downregulated genes were assembled into fluorescent protein assay elements. Figure 3 The fluorescence intensity was measured in different S1 protein acetylation level assay systems. First, two SBS sequences were constructed into [a specific assay] containing the same P [protein]. tac The pUC19 assay element is placed in the promoter and RBS sequence, and then imported into the WT / Δpta assay system (which shows higher S1 protein acetylation levels upon addition of acetate). Figure 3 The transcriptional level of red fluorescent protein mCherry was determined using qRT-PCR, and the intensity of the fluorescent protein was measured to correct for the relative translational level of red fluorescent protein mCherry (fluorescence intensity / mRNA transcriptional level). As shown in the figure, in both the WT and Δpta testing systems, the relative translational intensity of SBS-Up-guided mCherry was higher than that of SBS-Down-guided mCherry. Figure 3 It is worth noting that, compared to the WT testing system, the SBS-Up-guided mCherry translations in the Δpta testing system exhibited higher relative translation strength. Conversely, the SBS-Down-guided mCherry translations in the Δpta testing system showed lower relative translation strength than those in the WT testing system. Figure 3 In the Δpta assay system with higher S1 protein acetylation levels, the relative translation intensity of SBS-Up-guided mCherry was higher, while the relative translation intensity of SBS-Down-guided mCherry was lower. This indicates that acetylation enhances the binding ability of S1 protein to the SBS-Up sequence, thereby increasing the translation of the fluorescent protein, while conversely, acetylation weakens the binding ability of S1 protein to the SBS-Down sequence, thereby reducing the translation of the fluorescent protein.

[0078] Since WT or Δpta assay systems exhibit genetic background differences, a dual fluorescent protein assay element was designed and assembled to eliminate the interference of these differences on the test results. Figure 4 A). SBS-Up-guided mCherry and SBS-Down-guided GFP were assembled into the same test plasmid pUC19 to eliminate differences in fluorescent protein transcription levels. The test plasmid was then introduced into the WT and Δpta assay systems, respectively. Results showed that acetylation of the S1 protein in the Δpta assay system increased the translation of SBS-Up sequence-guided red fluorescent protein mCherry, while conversely decreasing the translation of SBS-Down sequence-guided GFP. Figure 4 (B, C). In summary, acetylation of the S1 protein can increase its affinity for SBS-Up and decrease its affinity for SBS-Down, thereby promoting or inhibiting the expression of fluorescent proteins.

[0079] Example 2: Construction of an SBS mutant library in simulated S1 protein acetylated chassis cells

[0080] (1) Chassis cell preparation:

[0081] The S1 coding gene sequence was obtained by PCR. Primer sequences are as follows:

[0082] S1-F:ATGACTGAATCTTTTGCTCAACTCTTTGAAGAGT

[0083] S1-R:TTACTCGCCTTTAGCTTGCTTTGAAAGCTTC

[0084] S1 was obtained by PCR. K411,464Q Encoding gene sequence, primer sequence:

[0085] S1 K411Q -F:TTCGTGAATACAAACAAGGCGACGAAATCGCT,

[0086] S1 K411Q -R:AGCGATTTCGTCGCCTTGTTTGTATTCACGAA;

[0087] S1 K464Q -F:AGTTGACGCTCAAGGCGCAACC

[0088] S1 K464Q -R:GGTTGCGCCTTGAGCGTCAAC

[0089] Subsequently, S1 or S1 will be obtained. K411,464Q The coding gene sequence was ligated into the pPRoEX-htb plasmid via homologous recombination. pPRoEX-S1 or pPRoEX-S1 K411,464Q The plasmid was transformed into BL21 competent cells by heat shock transformation, and the correct transformants were selected to prepare electroporation competent cells.

[0090] (2) Construction of SBS mutant library:

[0091] Eleven nucleotides immediately upstream of RBS were mutated using random primers, and the same promoter and RBS-guided green fluorescent protein were constructed into the pKD236 plasmid, which was then transformed into BL21 to test the intensity of the SBS sequence.

[0092] First, using the GFP gene as a template, PCR was performed with primers for introducing the SBS mutant library to obtain the target fragment containing the SBS mutant library. The primers are as follows:

[0093] SBS-GFP-F:

[0094] TTGACAATTAATCATCGGCTCGTATAATGTGTGGAANNNNNNNNNNNAAGGAGATATACCATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTG;

[0095] GFP-R:CTATTTGTATAGTTCATCCATGCCATGTGTAATCCC.

[0096] The target fragment obtained by PCR was assembled into the pKD236 plasmid and transformed into chassis cells (containing pPRoEX-S1 or pPRoEX-S1) using electroporation (electroporation parameters: 3 kV, 4 ms). K411,464Q Plasmid BL21 competent cells). Selected transformants were screened using LB solid plates containing streptomycin resistance (100 μg / ml).

[0097] (3) SBS strength testing and sequencing:

[0098] Transformants selected from streptomycin-resistant plates were dissolved in 10 μl of sterile water. 9 μl of the bacterial suspension was inoculated into a 96-well plate containing 200 μl of liquid LB medium (pre-added with 50 μg / ml streptomycin and 48 μg / ml IPTG). The plates were incubated at 37°C for 16–24 h using a microplate shaker. 100 μl of the cultured bacterial suspension was then added to a 384-well plate for fluorescence measurement. The remaining 100 μl of the bacterial suspension was used to measure the OD using a microplate reader. 600 Divide the fluorescence value by the OD value 600 Relative fluorescence intensity was obtained to characterize the intensity of the SBS sequence. For sequencing of the SBS sequence, PCR was performed using the characteristic primers 236-F and 236-R of the pKD236 plasmid. The primers are as follows:

[0099] 236-F:5'-CAATTTCACACAGGAA ACAGACCATGTCGTAC-3';

[0100] 236-R:5'-CCGCCAGGCAAATTCTGTTTTATCAGACC-3';

[0101] Using the remaining 1 μl of bacterial culture as a template, colony PCR was performed to obtain a fragment containing SBS. The obtained fragment was sent to Shanghai Qingke Biotechnology Co., Ltd. for sequencing to obtain the SBS sequence.

[0102] (4) Sequencing results

[0103] To systematically test S1 protein acetylation-mediated translational regulation and the strength of different SBS sequences, we used pPRoEX-S1 or pPRoEX-S1... K411,464Q The pKD236-SBSs-GFP plasmid was used in BL21 chassis cells, such as... Figure 5 As shown, a wild-type S1 SBS mutant library (S1) was obtained in BL21-pPRoEX-S1 chassis cells. K411,464Q Obtaining an SBS mutant library (S1) mimicking the acetylation state of the S1 protein in chassis cells K411,464Q ()( Figure 5 A). S1 and S1 K411,464Q The SBS sequence-guided translation intensity of green fluorescent protein (GFP) in the mutant library has a wide range. Figure 5 B, C). Among them, the wild-type S1 SBS mutant library yielded a total of 172 SBS sequences. Based on the intensity of green fluorescent protein, the SBS library was further divided into high-intensity (33 sequences), medium-intensity (93 sequences), and low-intensity (46 sequences) sub-libraries. Figure 5 B, Table 4). Sequence analysis of the wild-type S1 SBS library revealed that the high-intensity SBS sub-library had higher A and T base content, while the A and T base content gradually decreased in the medium-intensity and low-intensity SBS sub-libraries. Figure 5 B). Additionally, simulating acetylation of S1 (S1) K411,464Q A total of 177 SBS sequences were obtained from the SBS library, which were further divided into high-intensity sub-libraries (28 sequences), medium-intensity sub-libraries (97 sequences), and low-intensity sub-libraries (52 sequences) based on the intensity of green fluorescent protein. Figure 5 C, Table 4), simulated acetylation of S1 (S1 K411,464Q The high-intensity SBS sublibraries have relatively high A and T base content, while the medium- and low-intensity SBS mutant libraries have significantly lower A and T base content. Figure 5 C). Compare S1 with S1 K411,464Q The SBS mutant library was found to simulate the acetylation state S1. K411,464Q The high-intensity sub-library contained higher levels of A+T+C than the high-intensity sub-library in the wild-type S1 state, while the low-intensity sub-library showed the opposite trend in A+T+C content. Figure 5 D). Furthermore, the simulated acetylation state S1 K411,464Q The high-intensity sub-library contained higher levels of A+T or T than the high-intensity sub-library in the wild-type S1 state. Figure 5E) indicates that the binding affinity of the S1 protein to different SBS sequences differs before and after acetylation, affecting the translation of fluorescent proteins. We also constructed a mutant library of SBS sequences based on different acylation states of the S1 protein, exhibiting a wide range of strengths. This mutant library provides a reference for designing novel mRNA translation regulatory elements.

[0104] Table 4 S1 and S1 K411,464Q SBS mutant library

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112] Example 3: Dynamic Regulation of Fluorescent Protein Expression by Characteristic SBS-A Sequence in Different S1 Protein Acylation States

[0113] To further verify the effect of regulation based on the interaction between S1 protein acetylation and SBS sequence on translation, the characteristic SBS-A sequence (ACUGACAUUAC, SEQ ID NO: 1) was used as an example in the SBS mutant library to test SBS-A sequence-guided green fluorescent protein (GFP) translation in different acetylation dynamic regulation systems.

[0114] SBS-A sequence testing under different nitrogen source concentrations: The SBS-A test plasmid pKD36-SBS-A-GFP was introduced into E. coli K-12MG1655 competent cells by electroporation. Correct transformants were screened using 50 μg / ml streptomycin-resistant LB agar plates. E. coli-pKD36-SBS-A-GFP was then cultured in 50 ml minimal salts medium (limiting nitrogen source: N...) LThe cells were cultured in a medium supplemented with 500 μl of glucose stock solution (0.2 g / ml) and 45 μl of ammonium sulfate stock solution (0.247 g / ml) for 8 hours. After 8 hours, 130 μl of ammonium sulfate stock solution (0.247 g / ml) was added, and the culture continued for 18 hours. The intensity of GFP was measured every 2 hours using a microplate reader at an excitation wavelength of 470 nm and an emission wavelength of 510 nm. For normal nitrogen source conditions (N), E. coli-pKD36-SBS-A-GFP was cultured in 50 ml minimal salts medium (normal nitrogen source, N: supplemented with 500 μl of glucose stock solution (0.2 g / ml) and 175 μl of ammonium sulfate stock solution (0.247 g / ml)). After 8 hours, the cells were collected by centrifugation and transferred to a limiting nitrogen source condition for further culture for 18 hours. The intensity of GFP was measured every 2 hours using an ELISA reader at an excitation wavelength of 470 nm and an emission wavelength of 510 nm.

[0115] The SBS-A sequence was tested under different S1 protein acetylation states. First, a bidirectional inducible element was constructed, and the S1 coding gene sequence was obtained by PCR. The S1 coding gene was then assembled into the pET-28a plasmid using homologous recombination (double digestion with Nde I and BamHI) to obtain the pET-28a-S1 plasmid. Subsequently, the S1 protein containing the arabinose inducible element was... K411,464Q The coding gene sequence was reverse assembled into the pET-28a-S1 plasmid using homologous recombination (dual digestion with EcoRI and HindIII) to obtain pET-28a-S1-S1. K411,464Q plasmid ( Figure 3 After being introduced into BL21 cells, the S1 protein expression was then introduced into the characteristic SBS-A sequence-guided GFP test plasmid pKD36-SBS-A-GFP. S1 protein expression was induced using 0.4 mM IPTG and 1 mM arabinose. K411 ,464Q The expression levels of the protein were consistent. The intensity of SBS-A sequence-guided green fluorescent protein (GFP) was measured using a microplate reader at an excitation wavelength of 470 nm and an emission wavelength of 510 nm when 0.4 mM IPTG or 1 mM arabinose was added.

[0116] The results showed that the characteristic SBS-A sequence is dynamically regulated at different S1 protein acetylation levels. Figure 6 A, B). Supplementation with nitrogen during culture significantly improved the translation of SBS-A sequence-guided green fluorescent protein compared to nitrogen-limited conditions. Figure 6 C). Furthermore, after transferring bacterial cells cultured under normal nitrogen source conditions to a limiting nitrogen source, the translation intensity of SBS-A-guided fluorescent proteins was significantly reduced. Figure 6E) indicates that influencing the acetylation level of the S1 protein by changing nitrogen source conditions can dynamically regulate the translation of SBS-A sequence-guided green fluorescent protein. Similarly, in S1 and S1 K411,464Q The testing system measures the intensity of SBS-A sequence-guided fluorescent proteins. Figure 6 B), as shown in the figure, adding IPTG during the mid-stage of culture to induce S1 protein expression significantly improved arabinose-induced S1 expression. K411,464Q Translation guided by SBS-A sequence ( Figure 6 D), after changing the order of adding the inducer, SBS-A sequence-guided translation was significantly reduced. Figure 6 F). The above results fully demonstrate that acetylation affects the binding of S1 protein to the SBS sequence and is the fundamental reason for regulating protein translation. By simulating acylation sites or altering the acetylation level of S1 protein under different nutritional conditions, the translation of mRNA guided by different SBS sequences can be dynamically regulated, providing a new method for improving mRNA translation efficiency.

[0117] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. An application of the SBS sequence shown in SEQ ID NO: 1 in improving the translation efficiency of mRNAs, characterized in that, The application involves improving mRNA translation efficiency by regulating the interaction between the ribosomal S1 protein and the SBS sequence during translation initiation.

Images