Preparation method of DNA / agarose gel and application thereof in removing heavy metals

Abstract

This invention belongs to the field of heavy metal removal technology. When using DNA as an adsorbent to remove pollutants from water, it is necessary to modify the DNA or substrate to load the DNA onto the substrate, which is a complex process. To address this problem, this invention provides a method for preparing a DNA / agarose gel. Agarose is heated in water until melted. Before cooling and solidification, a functional nucleic acid long chain containing repetitive functional sequences is added. After solidification, the agarose forms a three-dimensional network structure. The functional nucleic acid long chain has very low migration rate in the agarose, or even cannot pass through the high-concentration agarose voids, thus being immobilized within the three-dimensional network of agarose. The DNA / agarose gel prepared by this invention can be applied to heavy metal removal. This method is simple to operate and does not require additional modification of the agarose or DNA to achieve the immobilization purpose, truly realizing low-cost and highly specific removal of heavy metal pollutants.

Description

Technical Field

[0001] This invention belongs to the field of heavy metal removal technology, specifically relating to the preparation method of DNA / agarose gel and its application in removing heavy metals. Background Technology

[0002] The environmental damage and pollution caused by various heavy metal ions has become a global problem, seriously threatening public health. Water, as the direct route of entry into the human body, makes drinking water safety extremely important. More and more scientists are dedicated to developing technologies for removing heavy metal ions from wastewater. Methods such as chemical precipitation and ion exchange inevitably cause secondary pollution due to the use of chemical reagents. Membrane separation and electrochemical treatment methods are costly, and their adsorption capacity and removal efficiency are relatively low, failing to achieve ideal heavy metal removal results.

[0003] Adsorption methods have advantages over the above methods, including low cost, simple design, and strong operability. Many low-cost adsorbents already exist and can be regenerated through desorption processes for reuse, such as activated carbon and carbon nanotubes. However, these adsorbents all suffer from insufficient specificity. To solve this problem, scientists have used DNA that can specifically bind to targets as novel adsorbents. Nucleic acid aptamers are a new type of single-stranded DNA / RNA molecule used for molecular recognition. They can bind to target molecules with high affinity and specificity. In addition, their sequence designability allows them to be used to remove different types of pollutants from water and are widely used in diagnostic, analytical, and therapeutic medicine (Dunn MR, Jimenez RM, Chaput JC J. Analysis of aptamer discovery and technology[J]. Nature Reviews Chemistry,2017,1(10):1-16).Kim et al. used streptavidin agarose resin with arsenic-specific DNA aptamers to remove arsenic from groundwater (Kim M, Um HJ, Bang S, et al. Arsenic removal from vietnamese groundwater using the arsenic-binding DNA aptamer[J]. Environmental science & technology, 2009, 43(24): 9335-9340.); others used aptamers immobilized on graphene oxide nanomaterials via π-π interactions to highly selectively remove hormones (Chergui S, Rhili K, Poorahong S, et al. Graphene oxide membrane immobilized aptamer as a highly selective hormone removal[J]. Membranes, 2020, 10(9): 229.); Hu et al. used CNBr (cyanogen bromide) activated agarose to immobilize 5'-amino-modified DNA aptamers to remove trace amounts (ng / L) of drugs from drinking water (Hu X, Mu L, Zhou Q, et al. Ssdna The above method has the advantage of balancing high adsorption efficiency and good specificity, and can also adsorb trace molecules in water. However, it still requires the preparation of complex nanomaterials or modification of the materials and aptamers, which increases the cost and preparation difficulty of practical applications. In view of the many shortcomings of the current heavy metal removal technology, it is of great significance to develop a low-cost, high-efficiency, highly specific and non-polluting heavy metal removal method that does not require any modification. Summary of the Invention

[0004] When using DNA as an adsorbent to remove pollutants from water, the DNA or substrate needs to be modified to load the DNA onto the substrate. This method is complex and costly. To address this issue, this invention provides a method for preparing DNA / agarose gel and its application in removing heavy metals. This invention uses agarose as a substrate, which is heated to melt and then cooled to solidify, forming a three-dimensional network structure. Utilizing the characteristic that long-chain DNA has very low migration rate in agarose, or even cannot pass through the high-concentration agarose pores, if nucleic acid aptamers or DNAzyme aggregates with target-specific binding ability are added before the agarose solidifies (at approximately 60°C), the aggregates can be immobilized in the agarose for pollutant removal. These functional nucleic acid aggregates can be generated by RCA amplification. Utilizing the characteristic that RCA products are large-molecule tandem repeat sequences, target recognition sites can be generated exponentially, increasing the affinity for the target and achieving highly efficient adsorption of pollutants. This method is simple to operate and achieves fixation without additional modification to agarose or DNA, truly realizing low-cost and highly specific removal of heavy metal pollutants. It is of great significance for the application of nucleic acid aptamers and DNAzymes in separating pollutants from water. Due to the high stability and sequence designability of DNA, it can achieve specific removal of different pollutants under various environments and temperatures, showing great application potential.

[0005] To achieve the above-mentioned objectives of this invention, the following technical solution is adopted:

[0006] On one hand, the present invention provides a method for preparing DNA / agarose gel, wherein agarose is heated in water until melted, and before cooling and solidification, a functional nucleic acid long chain is added. The functional nucleic acid long chain contains repeating functional sequences. After the agarose solidifies, a three-dimensional network structure is formed. The functional nucleic acid long chain has a very low migration rate in the agarose or even cannot pass through the high concentration of agarose gaps, thus being fixed in the three-dimensional network of agarose.

[0007] Furthermore, before the agarose cools and solidifies, long chains of functional nucleic acids are added and stirred to disperse them in the agarose.

[0008] Furthermore, before the agarose cools and solidifies (58–62°C), long chains of functional nucleic acids are added.

[0009] In the above scheme, agarose is used as the substrate, and functional nucleic acid long chains are used as the adsorbent material. Agarose is a linear polymer in structure, which melts upon heating and solidifies upon cooling to form a three-dimensional network structure.

[0010] The functional nucleic acids mentioned are mainly of two types. One type is RNA or DNA aptamers (usually 20-80 nucleotides) that can fold into unique three-dimensional conformations and are called "chemical antibodies." These nucleic acid aptamers can bind to targets with high specificity and high affinity through van der Waals forces, hydrogen bonds, electrostatic interactions, etc. The other type is DNA molecules with catalytic functions, called DNAzymes. Their activity can be activated by specific targets. This selective binding ability to metal ions makes their application in heavy metal removal possible. In this invention, the functional nucleic acid long chain is further defined as a nucleic acid aptamer with target-specific binding ability or a DNA molecule with catalytic function.

[0011] Furthermore, the functional nucleic acid long chain is a single-stranded or hybridized chain. In some embodiments of the present invention, the removal rate of dsDNA is greater than that of ssDNA, presumably because the structure is more stable after hybridization to form a double strand. However, regardless of the form, the removal rate is higher than 89%, reaching a maximum of 99.85%. Therefore, it can be said that a high adsorption rate can be achieved regardless of whether the functional nucleic acid aggregates hybridize or not.

[0012] Methods for preparing functional long nucleic acid chains include, but are not limited to, rolling circle amplification (RCA). Preferably, RCA can exponentially generate target recognition sites, increasing affinity for the target and achieving efficient adsorption. The preparation method of the hybridized strand is as follows: two long DNA chains are prepared using RCA technology. One is a single-stranded DNA containing a repeating functional sequence, with complementary regions on both sides of the functional sequence. The other is the complementary strand of the single-stranded DNA, which pairs with the complementary regions on both sides of the functional sequence. The position on the complementary strand opposite to the functional sequence is a reserved region. The two long DNA chains are hybridized. The resulting double-stranded DNA has a stable secondary structure, and the functional sequence forms a protrusion at the reserved region. When both hybridized strands are long chains of RCA products, the generation of byproducts can be effectively avoided. The length of the reserved region is 1–5 nt, and in some embodiments of the present invention, it is 3 nt.

[0013] Furthermore, the complementary regions on both sides of the functional sequence are 20 bp to ensure that the two long DNA chains can bind stably.

[0014] Furthermore, in rolling circle amplification, the molar ratio of primer to template is 1:1.

[0015] Furthermore, the hybridization of the two long DNA chains occurs in Mg 2+ It is carried out under the condition that it exists.

[0016] On the other hand, the present invention provides the application of the DNA / agarose gel prepared by the above method in the removal of heavy metals.

[0017] Furthermore, the DNA / agarose gel is shredded to increase the contact area, then immersed in a solution contaminated with heavy metals, and used at room temperature to mix at 20-120 rpm to remove the gel fragments from the solution.

[0018] Furthermore, a small amount of Na was added to the solution contaminated with heavy metals. + or Mg 2+ This can increase the removal effect. Na is preferred. + 0.01–300 mM, Mg 2+ The concentration is 0.5–3 mM; more preferably Na. + The concentration of Mg ranges from 0.01 to 200 mM. 2+ The concentration is 0.5–2 mM. As demonstrated in the embodiments of the present invention, Na… + 200mM or Mg 2+ The removal effect of mixed agarose is best when the concentration is 2 mM.

[0019] Furthermore, the pH of the heavy metal-contaminated solution is adjusted to 5–11 to improve the removal performance of the DNA / agarose gel. In some embodiments of the present invention, the removal rate can reach 99% within the pH range of 5–11. More preferably, the pH is 5–7.

[0020] This invention demonstrates that the presence of a small amount of salt ions in the system can increase the removal effect, and that DNA / agarose gel exhibits good removal performance over a wide pH range.

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0022] (1) This invention utilizes the principle that long-chain DNA has a very low migration rate in agarose or even cannot pass through the gaps of high-concentration agarose. It only requires adding nucleic acid aptamers or DNAzyme aggregates with target-specific binding ability before agarose solidification to achieve the fixation of functional nucleic acid aggregates in agarose. No additional modification to DNA or agarose is required, resulting in lower costs.

[0023] (2) This method can break up the solidified DNA / agarose gel to increase the contact area. It only needs to be immersed in the target solution for incubation. Through the interaction between functional nucleic acid and target, it can achieve specific and efficient adsorption of heavy metal ions in water. After removing the gel fragments, the pollutants can be removed. The operation is simple.

[0024] (3) The functional nucleic acids used in this method can be nucleic acid aptamers with affinity for the target and DNAzymes. These chemically stable nucleic acid elements can specifically recognize and bind to a target, selectively remove pollutants, and DNA has sequence designability. Through sequence design, specific removal of different pollutants can be achieved under various environments and temperatures, which has great application potential.

[0025] (4) The functional nucleic acid aggregates used in this method can be generated by RCA amplification. Taking advantage of the characteristic that RCA products are tandem repeat sequences, target recognition sites can be generated exponentially, increasing the affinity for the target and significantly improving the heavy metal removal efficiency.

[0026] (5) This invention mainly involves agarose, functional nucleic acids with high affinity for the target, buffer solution and a small amount of salt ions. Apart from that, it does not involve any chemical reagents or nanomaterials. It will not cause secondary pollution and does not require sophisticated instruments, thus having high practical application value. Attached Figure Description

[0027] Figure 1 This is a schematic diagram illustrating the principle of immobilizing DNA in agarose according to the present invention.

[0028] Figure 2 A schematic diagram illustrating the preparation, hybridization, and functional nucleic acid monomers of functional nucleic acid aggregates;

[0029] Figure 3 Schematic diagram of the design concept for removing heavy metals from aqueous solution using RCA products / agarose gel;

[0030] Figure 4 This is a sequence design diagram of the aptamer and DNAzyme monomer of Example 1;

[0031] Figure 5 Example 1 shows the results of AM / AG and B hybridization and restriction endonuclease digestion.

[0032] Figure 6 The image shows the preparation and electrophoresis results of the RCA product / agarose mixed gel in Example 1.

[0033] Figure 7 To remove Pb from aqueous solution from RCA products in single-stranded and hybridized states in Example 1 using an agarose gel. 2+ Renderings;

[0034] Figure 8 Example 1: RCA product / agarose mixed gel at different concentrations of Na + Adsorption of Pb 2+ Resulting image;

[0035] Figure 9Example 1: RCA product / agarose mixed gel at different concentrations of Mg 2+ Adsorption of Pb 2+ Result image

[0036] Figure 10 Example 1: Adsorption of Pb by RCA product / agarose mixed gel at different pH values 2+ Resulting image;

[0037] Figure 11 This is a sequence design diagram of the aptamer and DNAzyme monomer of Example 2;

[0038] Figure 12 Example 2: Removal of Cd from aqueous solution of RCA products in single-stranded and hybridized states using agarose gel. 2+ Renderings;

[0039] Figure 13 This is a sequence design diagram of the DNAzyme monomer of Example 3 of the present invention;

[0040] Figure 14 To remove Cr from aqueous solution of RCA products in single-stranded and hybridized states using an agarose gel in Example 3 of this invention. 3+ Renderings. Detailed Implementation

[0041] The present invention will be further described in detail below with reference to specific embodiments.

[0042] All oligonucleotide sequences used in the following examples were synthesized by Sangon Biotech (Qingdao). Agarose was purchased from Biowest (France). All reagents used, including ligases, exonucleases, polymerases, and restriction endonucleases, were commercially available.

[0043] The functional nucleic acid aggregates prepared in the following examples were all prepared using the rolling circle amplification method. Figure 2 -a) is a schematic diagram of the template and helper splint for rolling circle amplification. Figure 2 -b) is a schematic diagram of the rolling circle amplification process.

[0044] The sequence design of the aptamer and DNAzyme monomer in the following examples is as follows: Figure 2 As shown in -c), the two sequences of the aptamer or DNAzyme monomer are named A and B, respectively. A and B each have complementary regions of a certain length on their left and right sides (a and b are complementary to a' and b', respectively), ensuring stable binding of the two long chains. The protruding region in the middle of sequence A is a region capable of adsorbing Pb. 2+The functional nucleic acid sequence of B contains a 3nt reserved region in the middle, in addition to the region complementary to A. This is to provide space for the protruding part of A, allowing it to better bind to the target. After rolling circle amplification, the length of the adjacent complementary region doubles, such as... Figure 2 As shown in -d).

[0045] Example 1: Removal of lead ions from DNA / agarose gel

[0046] 1. Preparation of DNA / Agarose Gel

[0047] (1) Sequence design of aptamers and DNA zyme monomers

[0048] The sequence containing aptamer M4-16 was named AM. Figure 4 -a), the sequence containing the GR 5 DNAzyme is named AG( Figure 4 -b). AM and AG have only one complementary chain B, therefore only three RCA long chains need to be prepared. In addition to the 20 nt complementary pair with A, the B sequence has an extra 3 nt in the middle to provide space for the protruding portion of A, allowing it to better bind Pb. 2+ To verify successful hybridization of the two RCA chains, restriction endonuclease HpyCH4V cleavage sites were designed in the complementary regions of A / B. Figure 4 (underline sequence).

[0049] (2) Preparation of functional nucleic acid aggregates:

[0050] Phosphorylation of the template loop precursor chain. In a 1×PNK Buffer A system, the complementary sequences ssDNA A'-M, A'-G, B' of the designed aptamer or DNAzyme monomer were added to the system at an appropriate concentration (50 μM), along with 6 times the concentration of ssDNA, 10 U PNK (10 U / μL), and then incubated at 37 °C for 8 h to complete the phosphorylation of the 5' end of the ssDNA.

[0051] Template loops were then prepared using the splint method. A looping auxiliary strand, either A'-sp(7+7) or B'-sp(7+7), was used during preparation. In a 1×T4 DNA Buffer system, 5 μM of 5' phosphorylated circularizing strand (p-ssDNA) and 15 μM of auxiliary circularizing strand were added. The mixture was incubated at 90°C for 3 min in a PCR instrument, then cooled to 25°C at a rate of 0.1°C / s and held for 15 min. Finally, 10 U of T4 DNA ligase was added, and the mixture was incubated at 25°C for 3 h.

[0052] To obtain polymers of aptamers and DNAzyme monomers, rolling circle amplification (RBA) was employed. Using A'-sp(7+7) or B'-sp(7+7) primers, Phi29 DNA polymerase was used to perform rolling circle amplification on the previously prepared template circles cA'-M, cA'-G, and cB'. The primer molar concentration was 1:1 with the template molar concentration, and the final concentration was 1 μM. 1 mM dNTPs and 6 U of Phi29 DNA polymerase were added to 1×Phi29 Buffer for amplification. The mixture was incubated at 30°C for 1 h. The amplified products were designated A or B.

[0053] In 10mM Mg 2+ Under the given conditions, the amplified RCA products A and B were incubated at 90℃ for 3 min, then cooled to 25℃ at a rate of 0.1℃ / s and incubated for 20 min to achieve complete hybridization. Enzyme digestion was performed using the designed restriction endonuclease HpyCH4V. 5 μL of the hybridization product was added to 1×CutSmart Buffer and 2.5 U of HpyCH4V (with TG↓CA restriction site) and reacted at 37℃ for 3 h. The digestion status was then checked using 8% PAGE.

[0054] like Figure 5 As shown, comparing lanes 3 and 4, and lanes 7 and 8, the hybrid products of AM and B, after digestion with HpyCH4V, produced bands of varying lengths, indicating that AM and B can hybridize in 10mM Mg2+. 2+ The presence of HpyCH4V indicates that the substrate was completely digested and hybridized with AG and B. After digestion, no substrate remained at the gel wells, and only a few bands were observed below, indicating that the substrate was completely digested by HpyCH4V and AG and B had completely hybridized.

[0055] (3) Preparation of RCA product / agarose gel

[0056] The previously obtained hybridization products can be used to prepare RCA product / agarose gels. 0.2 g of agarose and 20 mL of 0.5×TBE are heated to 60 °C, and then different amounts of RCA hybridization products (50 pmol, 100 pmol) and 10 μL of Gelred staining solution (1000×) are added. The agarose is allowed to cool and solidify. To verify the fixation effect, electrophoresis is performed at 200 V for 1 h, followed by imaging on a gel imaging system to observe the fixation status.

[0057] The results are as follows Figure 6 As shown, the color of the agarose deepens with increasing DNA concentration, indicating successful preparation of the RCA product / agarose mixed gel. Furthermore, no change in gel staining after 1 hour of electrophoresis indicates that the RCA product did not dissolve from the 1% agarose solution, and the RCA product was successfully immobilized in 1% agarose, ready for subsequent experiments.

[0058] 2. Removal of Pb from aqueous solution using DNA / agarose gel. 2+

[0059] The mixed gel fragments containing 10 pmol RCA hybridization product were immersed in 8 mL of solution containing 0.5 μM Pb. 2+ In a Tris-HCl (pH 8) buffer solution (ten times the national standard), the solution was mixed at 70 rpm for 12 h at room temperature. Gel fragments were removed from the solution, and the supernatant was collected. Pb in the supernatant was analyzed using a double hairpin circular DNAzyme-mediated double-cycle assay. 2+ The concentration. The removal percent is calculated using the following formula:

[0060] Where C o For the initial concentration, C e This represents the concentration after removal.

[0061] Figure 7 The results showed that when agarose gels prepared using single-chain RCA products and hybridized RCA products adsorbed Pb... 2+ Compared to the control group using only agarose gel, the adsorption rate was increased by nearly 40%–50%, reaching 99%, achieving highly efficient adsorption of Pb in aqueous solution. This indicates that the nucleic acid elements in this method play a crucial role in the adsorption of Pb. 2+ Its specific adsorption effect.

[0062] 3. Effect of salt ions on removal efficiency

[0063] (1) Na + Effect of concentration on removal

[0064] Six experimental groups were set up, containing 0, 10 mM, 50 mM, 100 mM, 200 mM, and 500 mM Na, respectively. + Adsorption experiments were conducted under specific conditions, and the Pb concentration in the supernatant was determined using a fluorescence amplification method. 2+ Content, measured by the magnification factor (FF) after 40 minutes of fluorescence amplification. B ) / (F0-F B To determine the adsorption effect (the smaller the magnification, the better the adsorption effect), such as... Figure 8 .Depend on Figure 8 It can be seen that Na in aqueous solution + When the concentration of Pb is 200 mM, the Pb concentration in the supernatant is... 2+ The minimum remaining amount indicates that Na... +The optimal adsorption performance of the RCA product / agarose mixed gel was observed at a concentration of 200 mM. It is worth noting that in practical applications, the ion concentration in drinking water does not reach 200 mM, while the mixed gel exhibits the best adsorption performance at Na+ concentrations. + It exhibits good adsorption performance even at concentrations of 0–100 mM or up to 500 mM, making it suitable for practical applications. However, for applications involving the separation of specific target analytes in water, and where a higher adsorption rate is desired, a small amount of salt ions in the buffer solution can optimize the performance of the DNA / agarose mixed gel.

[0065] (2) Mg 2+ Effect of concentration on removal

[0066] The experiment consisted of five experimental groups, containing 0, 10 mM, 50 mM, 100 mM, and 200 mM Mg, respectively. 2+ Adsorption experiments were conducted under specific conditions, and the Pb concentration in the supernatant was determined using a fluorescence amplification method. 2+ Content, measured by the magnification factor (FF) after 40 minutes of fluorescence amplification. B ) / (F0-F B To determine the adsorption effect (the smaller the magnification, the better the adsorption effect), such as... Figure 9 As shown in the figure, Mg in the aqueous solution 2+ When the concentration of Pb is 2 mM, the Pb concentration in the supernatant is... 2+ The fluorescence growth rate was the lowest, indicating that Mg... 2+ The adsorption performance of the RCA product / agarose mixed gel was optimal at a concentration of 2 mM. Furthermore, a comparison of the two ions showed that Mg... 2+ The effect on removal is greater than that on Na + The larger value is likely due to the same concentration of Mg. 2+ The charge it carries is greater than that of Na + many.

[0067] 4. Effect of pH on removal

[0068] This experiment consisted of 7 experimental groups, with the previously optimized ionic conditions of 200 mM Na. + 2mM Mg 2+ Then, the pH of the buffer solution was adjusted to 5, 6, 7, 8, 9, 10, and 11 respectively for testing, and the results are as follows. Figure 10 As shown, Figure 10 -A represents the fluorescence amplification factor of the supernatant after removal at different pH values ​​(a smaller amplification factor indicates a better adsorption effect). Figure 10 -B represents the removal rate calculated at different pH values.

[0069] Depend on Figure 10-B indicates that the adsorption efficiency is greater than 98% within the pH range of 5–11, demonstrating that the RCA product / agarose mixed gel exhibits high performance over a wide pH range. The system contains Pb. 2+ Minor differences in concentration can only be explained by the amplification of the fluorescence signal. Figure 10 -A indicates that at pH 5–7, the Pb content in the supernatant is... 2+ The concentration increases with increasing pH, indicating that within the pH range of 5–7, the higher the pH, the lower the removal efficiency. At pH 7–11, the Pb concentration in the supernatant… 2+ The small difference in concentration indicates that an alkaline environment is less favorable for the removal reaction.

[0070] Table 1. Oligonucleotide single-stranded sequences used in Example 1

[0071]

[0072] Note: The bolded italicized parts are ribonucleotides, and the rest are deoxyribonucleotides; the underlined parts are the active sites of functional nucleic acids.

[0073] Example 2: Removal of heavy metal cadmium ions by DNA / agarose gel

[0074] 1. Preparation of DNA / Agarose Gel

[0075] (1) Sequence design of aptamers and DNA zyme monomers

[0076] The two sequences of the aptamer or DNAzyme monomer have complementary regions of 11 bp on each side, and an adjacent complementary region of 22 bp after RCA, ensuring stable binding of the two long chains. The central protrusion region is for adsorbing Cd. 2+ The functional nucleic acid sequence with the ability to carry the aptamer Cd2-2 is named A-Cd22. Figure 11 -a), the sequence containing the BN-Cd16 DNAzyme is named A-Cd16 ( Figure 11 -b). Meanwhile, their complementary sequences were named B-Cd22 and B-Cd16, respectively. To verify the successful hybridization of the two RCA chains, restriction endonuclease HpyCH4V cleavage sites were designed in the complementary regions of A / B. Figure 11 (underline sequence).

[0077] (2) Preparation of functional nucleic acid aggregates:

[0078] In a 1×PNK Buffer A system, the complementary sequences ssDNA A'-Cd22, A'-Cd16, B'-Cd22, and B'-Cd16 of the designed aptamer and DNAzyme monomer were added to the system at an appropriate concentration (50 μM). After adding 6 times the concentration of ssDNA ATP and 10 U PNK (10 U / μL), the system was incubated at 37 °C for 8 h to complete the 5'-phosphorylation of ssDNA.

[0079] Template loops were then prepared using the splint method. The preparation required auxiliary loops A'-Cd22sp(7+7), B'-Cd22sp(7+7), A'-Cd16sp(7+7), and B'-Cd16sp(7+7). In a 1×T4 DNA Buffer system, 5 μM of the 5' phosphorylated circularizing strand (p-ssDNA) and its corresponding auxiliary circularizing strand (splint) were added. The mixture was incubated at 90°C for 3 min in a PCR instrument, then cooled to 25°C at a rate of 0.1°C / s and held for 15 min. After adding 10 U of T4 DNA ligase, the mixture was incubated at 25°C for 3 h.

[0080] To obtain polymers of aptamers and DNAzyme monomers, rolling circle amplification (RBA) was employed. Primers A'-Cd22sp(7+7), B'-Cd22sp(7+7), A'-Cd16sp(7+7), and B'-Cd16sp(7+7) were used, and Phi29 DNA polymerase was used to perform RBA amplification on the previously prepared template circles cA'-Cd22, cA'-Cd16, cB'-Cd22, and cB'-Cd16. The primer-template ratio was 1:1, with a final concentration of 1 μM. 1 mM dNTPs and 6 U of Phi29 DNA polymerase were added to 1×Phi 29 Buffer for RBA amplification. The mixture was incubated at 30°C for 1 h. The amplified products were named A-Cd22, B-Cd22, A-Cd16, and B-Cd16.

[0081] In 10mM Mg 2+ Under the given conditions, the amplified RCA products A and B were incubated at 90℃ for 3 min, then cooled to 25℃ at a rate of 0.1℃ / s and incubated for 20 min to achieve full hybridization.

[0082] (3) Preparation of RCA product / agarose gel

[0083] Heat 0.2 g agarose and 20 mL 0.5 × TBE at high temperature, then cool to 60 °C and add different amounts (50 pmol, 100 pmol) of RCA hybridization product (A+B) and 10 μL Gelred staining solution (1000 ×). Allow the agarose to cool and solidify.

[0084] 2. Removal of Cd from aqueous solution using DNA / agarose gel. 2+

[0085] Gel fragments containing 10 pmol of RCA hybridization product were immersed in 8 mL of solution containing 1 μM Cd. 2+ The solution was mixed in Tris-HCl (pH=8) buffer at 70 rpm for 12 h at room temperature. Gel fragments were removed from the solution, and the residual heavy metal Cd in the supernatant was detected. 2+ The concentration.

[0086] Figure 12 The results showed that agarose gels prepared using single-chain RCA products and hybridized RCA products adsorbed Cd. 2+ At that time, compared with the control group that only used agarose gel, the adsorption rate was nearly 90%, which can achieve the adsorption of Cd in aqueous solution. 2+ Highly efficient adsorption.

[0087] Table 2 shows the oligonucleotide single-stranded sequences used in Example 2.

[0088]

[0089] Note: The underlined part is the active site of the functional nucleic acid.

[0090] Example 3 DNA / Agarose Gel for Heavy Metal Cr 3+ removal

[0091] 1. Preparation of DNA / Agarose Gel

[0092] 1) Sequence design of aptamers and DNAzyme monomers

[0093] Literature review revealed that there is currently no Cr-specific DNAzyme. Most studies currently use Ce13d DNAzymes for Cr ion detection. In this process, lanthanide ions such as Ce can be masked using phosphate buffer. Therefore, this study selected Ce13d for Cr detection. 3+ Adsorption. The Ce13d DNAzyme monomer sequences were named A-Cr and B-Cr ( Figure 13 The chain consists of two chains, A and B, with complementary regions of 11+10 bp. The adjacent complementary region after RCA is 21 bp, ensuring stable binding of the two long chains. The central protrusion region adsorbs Cr. 3+ The functional nucleic acid sequence was designed to allow for successful hybridization of the two RCA chains. To further verify successful hybridization of the two RCA chains, a restriction endonuclease HpyCH4V cleavage site was also designed in the complementary region of A / B. Figure 13 (Underline)

[0094] 2) Preparation of functional nucleic acid aggregates:

[0095] In a 1×PNK Buffer A system, the complementary sequences ssDNA A'-Cr and B'-Cr of the designed functional nucleic acid monomers were added to the system at an appropriate concentration (50 μM). After adding 6 times the concentration of ssDNA ATP and 10 U PNK (10 U / μL), the system was incubated at 37 °C for 8 h to complete the 5'-phosphorylation of ssDNA.

[0096] Template loops were then prepared using the splint method. Circulation aids A'-Crsp(7+7) and B'-Crsp(7+7) were used during preparation. In a 1×T4 DNA Buffer system, 5 μM of 5' phosphorylated circularizing strand (p-ssDNA) and 15 μM of auxiliary circularizing strand were added. The mixture was incubated at 90°C for 3 min in a PCR instrument, then cooled to 25°C at 0.1°C / s and held for 15 min. Finally, 10 U of T4 DNA ligase was added, and the mixture was incubated at 25°C for 3 h.

[0097] To obtain the DNAzyme monomer polymer, rolling circle amplification (RBA) was used. Primers A'-Crsp(7+7) and B'-Crsp(7+7) were used, and Phi29 DNA polymerase was employed to perform RBA amplification on the previously prepared template circles cA'-Cr and cB'-Cr. The primer molar ratio to template molar ratio was 1:1, with a final concentration of 1 μM for both. 1 mM dNTPs and 6 U of Phi29 DNA polymerase were added to 1×Phi29 Buffer for RBA amplification. The mixture was incubated at 30°C for 1 h, and the amplification products were named A-Cr and B-Cr.

[0098] In 10mM Mg 2+ Under the given conditions, the amplified RCA products A-Cr and B-Cr were mixed and incubated at 90℃ for 3 min, then cooled to 25℃ at a rate of 0.1℃ / s and incubated for 20 min to achieve full hybridization.

[0099] (3) Preparation of RCA product / agarose gel

[0100] Heat 0.2 g agarose and 20 mL 0.5 × TBE at high temperature, then cool to 60 °C and add different amounts (50 pmol, 100 pmol) of RCA hybridization product (A+B) and 10 μL Gelred staining solution (1000 ×). Allow the agarose to cool and solidify.

[0101] 2. Removal of Cr from aqueous solution using DNA / agarose gel. 3+

[0102] Gel fragments containing 10 pmol of RCA hybridization product were immersed in 8 mL of solution containing 1 μM Cr. 3+ The gel was mixed in Tris-HCl (pH=8) buffer at 70 rpm for 12 h at room temperature. Gel fragments were removed from the solution, and the supernatant was analyzed for Cr using a double hairpin circular DNAzyme-mediated double-cycle assay. 3+ The concentration.

[0103] Figure 14 The results showed that when agarose gels prepared using single-chain RCA products and hybridized RCA products adsorbed Cr... 3+ Compared to using agarose gel alone, the adsorption rate is significantly improved, enabling the adsorption of Cr in aqueous solutions. 3+ Highly efficient adsorption.

[0104] Table 3 shows the oligonucleotide single-stranded sequences used in Example 3.

[0105]

[0106] Note: The underlined part is the active site of the functional nucleic acid.

[0107] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. An application of a DNA / agarose gel in heavy metal removal, characterized in that, The method for preparing DNA / agarose gel is as follows: agarose is heated in water until melted, and before cooling and solidification, functional nucleic acid long chains are added. The functional nucleic acid long chains are nucleic acid aptamers with specific binding ability to heavy metal ions or DNA molecules with catalytic function that can specifically bind heavy metal ions. After the agarose solidifies, a three-dimensional network structure is formed. The functional nucleic acid long chains have a very low migration rate in agarose or even cannot pass through the high concentration of agarose gaps, thus being fixed in the three-dimensional network of agarose. The functional nucleic acid long chain is a single-stranded or hybridized chain. The single-stranded chain is a tandem repeat sequence prepared using rolling circle amplification (RoBAM). The hybridized chain is prepared by: using RoBAM to prepare two long-stranded DNAs, one being a single-stranded DNA containing a repeating functional sequence with complementary regions on both sides of the functional sequence, and the other being the complementary strand of the single-stranded DNA. The complementary strand pairs with the complementary regions on both sides of the functional sequence, with each complementary region being 20 bp to ensure stable binding between the two long-stranded DNAs. The position on the complementary strand opposite to the functional sequence is a reserved region. The two long-stranded DNAs are hybridized, and the resulting double-stranded DNA has a stable secondary structure, with the functional sequence forming a protrusion at the reserved region. When removing heavy metal Pd 2+ When using nucleic acid aptamers with the sequence GTATGCAGTAGGGAGGGTGGGTGGGATATGTCAATG or DNA molecules with catalytic function with the sequence GTATGCAGTAGAAGTAGCGCCGCCGTATGTCAATG; When removing heavy metal Cd 2+ When using nucleic acid aptamers with the sequence GTATGCATGGTCTCAGGACGACGGGTTCACAGTCCGTTGTCGGTGTCATATG or DNA molecules with catalytic function with the sequence GTATGCATGCATTCGATAGTTAAAGGTGTCAATGT; When removing heavy metal Cr 3+ At that time, a catalytically functional DNA molecule with the sequence GTATGCATGGTAGGTCAAAGGTGGGTGCGAGTTTTTACTCGTTGTGTCAGATG was used.

2. The application according to claim 1, characterized in that, In rolling circle amplification, the primer to template concentration ratio is 1:

1.

3. The application according to claim 1, characterized in that, The DNA / agarose gel is shredded to increase the contact area, then immersed in a solution contaminated with heavy metals, and used at room temperature with 20-120 rpm to mix and remove the gel fragments from the solution.

4. The application according to claim 1, characterized in that, Add a small amount of Na to the solution contaminated with heavy metals. + or Mg 2+ To increase the removal effect, the Na + The concentration of Mg ranges from 0.01 to 300 mM. 2+ It ranges from 0.5 to 3 mM.

5. The application according to claim 1, characterized in that, Adjust the pH of the heavy metal contaminated solution to 5–11 to improve the removal performance of the DNA / agarose gel.

Images