Nucleic acid aptamers and derivatives that specifically bind aldosterone, uses, kits

By using the SELEX method to screen for highly homologous or modified nucleic acid aptamers, the problems of expensive aldosterone detection equipment and complex antibody preparation have been solved, enabling rapid and convenient aldosterone detection and providing nucleic acid aptamers with high binding affinity and chemical stability.

CN115838727BActive Publication Date: 2026-07-10HANGZHOU BAICHEN MEDICAL LAB CO LTD +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202210692269.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-06-17
Publication Date
2026-07-10
Estimated Expiration
2042-06-17

Smart Images

  • Figure CN115838727B_ABST
    Figure CN115838727B_ABST
Patent Text Reader

Abstract

The application discloses a nucleic acid aptamer and derivatives, application and kit capable of specifically combining with aldosterone, and comprises a nucleotide sequence shown in SEQ ID No. 1, or a nucleotide sequence with high homology with the nucleotide sequence shown in SEQ ID No. 1 and capable of specifically combining with aldosterone, or a nucleotide sequence derived from the nucleotide sequence shown in SEQ ID No. 1 and capable of specifically combining with aldosterone. The application provides a nucleic acid aptamer and derivatives capable of combining with aldosterone, which have high specificity, stable chemical properties, are easy to preserve and label, and also correspondingly provides a screening method and application of the nucleic acid aptamer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, and relates to nucleic acid aptamers, especially to nucleic acid aptamers and derivatives that specifically bind aldosterone, their applications, and reagent kits. Background Technology

[0002] Aldosterone, also known as aldosterone, is a ketone with the molecular formula C64-C62. Other English names include Aldocortin, Reichstein, Aldosterol, and Aldocortene. 21 H 28 O5, with a molecular weight of 360.444, is a type of adrenocortical hormone. It is a representative mineralocorticoid with strong electrolyte metabolism. Its function is to promote sodium metabolism. + It is stored in the body while being excreted as K. + It is produced by the zona glomerulosa of the adrenal cortex and regulated by angiotensinogen secreted by the kidneys.

[0003] Aldosterone is a hormone in the human body that regulates blood volume, maintaining water and electrolyte balance by regulating the reabsorption of sodium ions by the kidneys. Aldosterone also regulates extracellular fluid volume and electrolytes. Its secretion is mediated through the renin-angiotensin system. When extracellular fluid volume decreases, it stimulates juxtaglomerular cells to secrete renin, activating the renin-angiotensin-aldosterone system. Increased aldosterone secretion leads to increased renal reabsorption of sodium ions, which in turn increases water reabsorption, resulting in increased extracellular fluid volume. Conversely, when extracellular fluid volume increases, the opposite mechanism reduces aldosterone secretion, decreasing renal reabsorption of sodium ions and water, and further decreasing extracellular fluid volume. Decreased serum sodium and increased serum potassium also stimulate the adrenal cortex, increasing aldosterone secretion.

[0004] Currently, there are many methods for detecting aldosterone, such as immunoassay, gas chromatography, and high-performance liquid chromatography. While chromatographic methods offer high sensitivity and accurate results, they require expensive equipment, demand high-quality materials, and require purification processes, making rapid and convenient detection difficult. Furthermore, current immunoassay methods rely on antibody-based test kits. Although some offer rapid and simple detection, antibody preparation is complex, costly, and prone to batch-to-batch variations, presenting certain limitations.

[0005] Nucleic acid aptamers are DNA or RNA molecules isolated through systematic evolution of exponentially enriched ligands (SELEX) technology. They can bind with high affinity and specificity to other targets such as proteins, metal ions, small molecules, peptides, and even whole cells, thus showing broad prospects in biochemical analysis, environmental monitoring, basic medicine, and new drug synthesis.

[0006] Compared with antibodies, nucleic acid aptamers have advantages such as smaller molecular weight, better stability, easier modification, no immunogenicity, shorter production cycle, and can be synthesized artificially, eliminating a series of processes such as animal immunization, feeding, protein extraction and purification. Therefore, nucleic acid aptamers are a very ideal molecular probe.

[0007] The SELEX method, which screens nucleic acid aptamers that bind to specific small molecules and applies them to the detection of these molecules, is currently being widely studied. However, no nucleic acid aptamers for aldosterone have been published or applied; therefore, there is a need in this field for nucleic acid aptamers with high binding affinity for aldosterone. Summary of the Invention

[0008] To overcome the shortcomings of the prior art, the present invention aims to provide a nucleic acid aptamer and its derivatives that are highly specific, chemically stable, easy to preserve and label, and capable of binding aldosterone. The invention also provides a screening method and application for the nucleic acid aptamer.

[0009] To achieve the above objectives, the present invention adopts the following technical solution:

[0010] In a first aspect, the present invention provides a nucleic acid aptamer that specifically binds to aldosterone, comprising the nucleotide sequence shown in SEQ ID No. 1; or, a nucleotide sequence that has high homology with the nucleotide sequence shown in SEQ ID No. 1 and is capable of specifically binding to aldosterone; or a nucleotide sequence that is derived from the nucleotide sequence shown in SEQ ID No. 1 and is capable of specifically binding to aldosterone.

[0011] As a preferred embodiment of the present invention, the high homology refers to at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% homology with the nucleotide sequence shown in SEQ ID Nos.1.

[0012] As a preferred embodiment of the present invention, the nucleic acid aptamer comprises a nucleotide sequence complementary to the nucleotide sequence and maintains the affinity.

[0013] As a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid aptamer includes base modifications and maintains the affinity.

[0014] As a preferred embodiment of the present invention, the base modification is thiomodification, phosphorylation, methylation, amylation, thiolation, selenium-substituted oxygen modification, or isotope linkage modification.

[0015] Those skilled in the art should understand that, as an improvement to the above technical solution, a certain position on the nucleotide sequence of the above nucleic acid aptamer can be modified, for example, by phosphorylation, methylation, aminoation, thiolation, replacing oxygen with sulfur, replacing oxygen with selenium, or linking isotopes, provided that the nucleic acid aptamer sequence obtained after such modification has the desired properties, for example, it can have the same or higher affinity for binding aldosterone as the original parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.

[0016] As a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid aptamer contains a marker and maintains the affinity.

[0017] As a preferred embodiment of the present invention, the marker is a fluorescent marker, a radioactive marker, a therapeutic marker, a biotin marker, a digoxigenin marker, a nanoluminescent material marker, a small peptide marker, an siRNA marker, or an enzyme marker.

[0018] Those skilled in the art should understand that, as an improvement to the above technical solution, fluorescent substances, radioactive substances, therapeutic substances, biotin, digoxigenin, nanoluminescent materials, small peptides, siRNA, or enzyme labels can be attached to the nucleotide sequence of the above nucleic acid aptamer, provided that the nucleic acid aptamer sequence obtained after such modification has the desired properties. For example, it can have an affinity for binding aldosterone equal to or higher than that of the original parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.

[0019] In other words, the above nucleic acid aptamer sequences, whether partially substituted or modified, all have the same or similar molecular structure, physicochemical properties and functions as the original nucleic acid aptamers, and can all be used for binding with aldosterone.

[0020] As a general technical concept, the nucleic acid aptamer described in this invention may also include any one of the following three sequences:

[0021] (1) A nucleotide sequence with more than 60% homology to the nucleotide sequence of the nucleic acid aptamer described in all the aforementioned technical solutions (for example, the aforementioned nucleic acid aptamer sequence may have some complementary nucleotides deleted or added), preferably, the homology to the nucleotide sequence shown in SEQ ID Nos.1 may be more than 70%, more than 80%, more than 85%, more than 90%, more than 95%, or more than 99%;

[0022] (2) A nucleotide sequence capable of hybridizing with the nucleotide sequences of the nucleic acid aptamers described in all the aforementioned technical solutions under stringent conditions;

[0023] (3) An RNA sequence transcribed from the nucleotide sequence of the nucleic acid aptamer described in all the aforementioned technical solutions;

[0024] Among them, the nucleotide sequences in (1)-(3) above can all specifically bind aldosterone.

[0025] Secondly, the present invention also provides a nucleic acid aptamer derivative that specifically binds to aldosterone, wherein the nucleic acid aptamer derivative is a thiophosphate backbone derived from the nucleotide sequence backbone of the above-mentioned nucleic acid aptamer, or a corresponding peptide nucleic acid modified from the above-mentioned nucleic acid aptamer.

[0026] All of the above-mentioned derived nucleic acid aptamers or other derivatives have molecular structures, physicochemical properties and functions that are basically the same or similar to the original nucleic acid aptamers.

[0027] Thirdly, the present invention also provides the application of the above-mentioned nucleic acid aptamer or nucleic acid aptamer derivative that specifically binds to aldosterone for the detection of aldosterone. The nucleic acid aptamer or its derivative of the present invention can be used to detect the aldosterone content in the blood of a subject.

[0028] Fourthly, the present invention also provides a kit for detecting aldosterone, comprising the above-mentioned nucleic acid aptamers or nucleic acid aptamer derivatives that specifically bind to aldosterone.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] 1) Compared with antibodies, nucleic acid aptamers have advantages such as smaller molecular weight, better stability, easier modification, no immunogenicity, shorter production cycle, and can be synthesized artificially, eliminating a series of processes such as animal immunization, feeding, protein extraction and purification. Therefore, nucleic acid aptamers are a very ideal molecular probe. However, no nucleic acid aptamers for aldosterone have been published or used. Therefore, there is a demand in this field for nucleic acid aptamers with high binding affinity for aldosterone.

[0031] 2) This invention provides a nucleic acid aptamer and its derivatives that are highly specific, chemically stable, easy to preserve and label, and can bind aldosterone. It also provides a screening method and application of the nucleic acid aptamer. Attached Figure Description

[0032] Figure 1 It is a simulated secondary structure of the sequence shown in SEQ ID No.1 of this invention.

[0033] Figure 2 This is a graph showing the isothermal titration microcalorimetry detection results of the experimental group of this invention.

[0034] Figure 3This is a graph showing the isothermal titration microcalorimetric detection results of the control group of the present invention.

[0035] Figure 4 This is the mass spectrum of the control group of this invention.

[0036] Figure 5 This is the mass spectrum of experimental group 1 of this invention.

[0037] Figure 6 This is the mass spectrum of experimental group 2 of this invention.

[0038] Figure 7 This is the mass spectrum of experimental group 3 of the present invention.

[0039] Figure 8 This is the mass spectrum of experimental group 4 of this invention.

[0040] Figure 9 This is the mass spectrum of experimental group 5 of the present invention.

[0041] Figure 10 This is the mass spectrum of experimental group 6 of this invention.

[0042] Figure 11 This is a linear curve obtained by fitting the mass spectrometry data of this invention. Detailed Implementation

[0043] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0044] Example 1

[0045] Screening of ssDNA aptamers for specific aldosterone

[0046] 1. Synthesize the random single-stranded DNA library and primers shown in the following sequences:

[0047] Random single-stranded DNA library:

[0048] Lib-QGT-80nt:

[0049] ATTGGCACTCCACGCATGGN(40N)CCTATGCGTGCTACCGTGAA

[0050] "40N" indicates a sequence consisting of 40 arbitrary nucleotide bases linked together.

[0051] This library was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0052] Primer information is shown in Table 1, synthesized by General Biotech.

[0053] Table 1. Primers and their sequences

[0054]

[0055] In this sequence, S represents the forward primer, A represents the reverse primer, the complementary sequence of S1 is denoted as S1CS, the 20 A's in the sequence represent the polyA tail composed of 20 adenosine nucleotides (A), "Spacer 18" represents the 18-atom hexaethylene glycol intermediate arm, and biotin is a biotin modification.

[0056] The structural formulas for most of the three "Spacer 18" types are shown in Equation I below.

[0057] The “Spacer 18” structure used in the above A2-ployA primer is shown in Formula I.

[0058]

[0059] Primers were prepared into 100 μM stock solutions using DPBS buffer (NaCl: 8 g / L, KCl: 0.2 g / L, Na2HPO4: 1.15 g / L, KH2PH4: 0.2 g / L, CaCl2: 0.1 g / L, MgCl2·6H2O: 0.1 g / L; pH 7.4) and stored at -20℃ for later use.

[0060] 2. Screening of aldosterones using a magnetic bead trapping method to fix the library

[0061] The library was immobilized using magnetic beads, and screening was conducted using a small molecule competitive binding method. A total of 9 rounds of screening were performed. The screening process is detailed below. Figure 1 .

[0062] The specific filtering method is as follows:

[0063] 2.1 Library Dissolution:

[0064] Take the biosynthesized library powder and centrifuge at 12000 rpm for 10 min. Add DPBS buffer to dilute the library to 10000 nM 130 μL, vortex to mix, and then centrifuge at 12000 rpm for 5 min. Add 26 μL of 100 μM S1CS primer dissolved in DPBS to the library, mix the primers and library thoroughly, and then centrifuge at 14000 rpm for 2 min.

[0065] 2.2. Library and primer matching:

[0066] The library and complementary primer mixture was aliquoted into PCR tubes and placed in a PCR instrument for slow renaturation. The PCR instrument was programmed as follows: 95℃ for 10 min, slow cooling to 60℃ at a rate of 0.1℃ / s; 60℃ for 1 min; slow cooling to 25℃ at a rate of 0.1℃ / s. A small amount of the renaturated library and complementary primer mixture was measured using UV (A260) to determine the concentration as C1.

[0067] 2.3. Take 1000 μL of streptavidin magnetic beads (purchased from Invitrogen, Dynabeads). TM M-270 streptavidin (catalog number: 65306) was used to wash the magnetic beads four times with 200 μL of DPBS each time. The beads were hooked with a magnet, and the supernatant was removed. (During the final wash, the magnetic beads were temporarily stored in a small amount of DPBS to prevent them from drying out.)

[0068] 2.4. After renaturation, add the library and complementary primer mixture to the magnetic beads from step 2.3, mix well, and shake on a rotary shaker at room temperature for 60 minutes. Use a magnet to hold the magnetic beads in place, collect the supernatant, and measure a small amount of the supernatant to obtain the UV (A260) concentration, yielding the value C2. Based on the measured concentration, the library coupling efficiency to the magnetic beads can be calculated. Library immobilization efficiency = (C1-C2) / C1. The first round of library immobilization efficiency should be greater than 50%, and subsequent rounds should have an immobilization efficiency greater than 85%, continuing the screening process. To ensure the success rate of the experiment, it is crucial to ensure that the library is immobilized on the magnetic beads in each round. The immobilization rate has requirements: greater than 50% in the first round, and greater than 85% in subsequent rounds due to the smaller library size. This step also contributes to successful screening.

[0069] 2.5. Library Washing: The magnetic beads obtained in the previous step are washed, with 400 μL of wash buffer (DPBS) added to each bead. After suspending the beads, they are incubated at room temperature for 2 minutes, and then the beads are attracted by a strong magnet. This washing process is repeated 4 times. A new EP tube is used for each wash. Immediately afterwards, the beads are subjected to a longer wash, i.e., 200 μL of wash buffer is added, the beads are suspended, and they are incubated on a shaker for 20 minutes. Then, the beads are attracted by a strong magnet, and the supernatant is discarded. (From the second round of screening onwards, only 200 μL of wash buffer is used in this step, and the incubation time is the same as the target elution time in 2.6).

[0070] 2.6. Target elution:

[0071] Aldosterone (molecular formula C21H28O5, relative molecular weight 360.44, molecular structure as shown in Formula II) was dissolved in methanol to 5 mM, and 4 μL was added to 196 μL of DPBS, i.e., diluted 50 times to 100 μM. After mixing, the entire solution was added to the SA magnetic beads obtained in step 2.5, and incubated on a shaker for 20 min. The magnetic beads were then hooked with a magnet, and the supernatant was collected into an EP tube, denoted as Elution.

[0072]

[0073] 3. Preparation of secondary libraries

[0074] 3.1 Amplification of Double-Stranded Nucleic Acids: Using the nucleic acid molecules in Elution as templates, PCR (ePCR) was performed for amplification. The method is as follows: Add all the template Elution to 2 ml of PCR mix and mix well. Divide the mixture into 100 μL / tube portions and add them to PCR tubes. The amplification conditions are as follows: 95℃ pre-denaturation for 2 minutes, 95℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 30 seconds, for a total of 25 cycles. Store at 4℃. The PCR mix formulation is shown in Table 2.

[0075] Table 2. ePCR mix formulation

[0076] reagents Total volume 1000μL ddH2O 866μL <![CDATA[10* pfμ enzymes bμffer ]]> 100μL <![CDATA[ dNTPmix (10mM)]]> 20μL Forward primer S1FAM (100μm) 5μL Reverse primer A2-polyA (100 μM) 5μL <![CDATA[ Pfμ enzymes 4μL (20μ)

[0077] 3.2 The amplification product was concentrated with n-butanol:

[0078] Collect all ePCR products into 15ml conical centrifuge tubes, add 2 volumes of n-butanol, and vortex to mix thoroughly; centrifuge at 9000rpm for 10 minutes at room temperature using a benchtop centrifuge; discard the upper phase (n-butanol) to obtain concentrated PCR amplification products.

[0079] 3.3 Preparation of single chains:

[0080] TBE / urea denaturing buffer was added to the concentrated PCR product at a volume ratio of 1:1. The mixture was boiled for 10 minutes to completely denature the DNA. All samples were then subjected to urea-denaturing polyacrylamide gel electrophoresis at 400V until bromophenol blue reached the bottom of the gel, separating the elongated FAM-labeled strands from the reversed strands. The formulation of the 7M urea-denaturing polyacrylamide gel is shown in Table 3.

[0081] Table 3. Formulation of modified polyacrylamide gel

[0082] Element Dosage Urea 3.78g 40% polyacrylamide 1.8ml 5*TBE 1.8ml ddH2O 2.25ml 100% APS 60μL TEMED 15μL

[0083] Gel excision and recovery of FAM-labeled strands: Place the gel on a plastic membrane. Ex (nm): 495, Em (nm): 517. Detect the desired FAM-labeled ssDNA, i.e., the target band. Use a clean blade to directly cut off the target band. Transfer the cut gel strip to a 1.5ml EP tube and break it up to form a fragmented gel. Add 1.2ml DPBS and mix well. Boil in a water bath for 10 minutes to transfer the ssDNA from the gel to a solution. Centrifuge at 12000rpm for 2 minutes, collect the supernatant, and transfer it to a 15ml centrifuge tube. Add 1ml DPBS to the fragmented gel again, repeat the boiling and centrifugation process, and collect the supernatant. Transfer all the supernatant to the same 15ml centrifuge tube. Add 12ml n-butanol to the 15ml centrifuge tube, invert to mix, and centrifuge at 9000rpm for 5 minutes. After centrifugation, the solution will separate into layers. Remove the upper layer and recover the lower layer containing the FAM fluorescent single-stranded library. The obtained DNA single strands were dialyzed overnight at 4°C using a 3.5KD dialysis bag and can then be used as a library for the next round of screening.

[0084] 4. Multiple rounds of screening:

[0085] In the subsequent 2-9 rounds of screening, each operation used the secondary library obtained from the previous operation as the starting nucleic acid library. The library was fixed using the following concentrations and volumes: library volume 700 nM * 100 μL; complementary primer CS-biotin volume 1400 nM * 100 μL; SA magnetic beads volume 100 μL. After the 9th round of screening, the obtained products were analyzed by high-throughput sequencing to finally obtain the nucleic acid aptamers.

[0086] In the screening method, the experiment progressively increases the screening pressure to enhance the enrichment of nucleic acid aptamers and shorten the screening process. This increased screening pressure includes reducing the amount of single-stranded DNA library used, the amount of aldosterone small molecules as a target, and the incubation time of the magnetic beads that immobilize the library, while increasing the washing time and number of washes in step 2.5.

[0087] 5. After high-throughput sequencing analysis, the enriched library products were compared for homology, and several sequences were selected. These sequences were then synthesized by Shanghai Sangon Biotech and their affinity was verified.

[0088] In subsequent testing, a sequence with a very strong binding ability was identified and named aldosterone 21 (QGT-21).

[0089] The specific sequence is SEQ ID No. 1:

[0090] ATTGGCACTCCACGCATAGGCAGCTGGGTCGTGAAGACACTGCAAAGCCTGCTCACGTACCCTATGCGTGCTACCGTGAA

[0091] Its simulated secondary structure is as follows Figure 1 As shown, ΔG = -12.41 kcal / mol.

[0092] Example 2

[0093] Determination of the affinity between aldosterone aptamers and aldosterone using isothermal titration microcalorimetry (ITC):

[0094] ITC is based on the principle of heat detection and detects interactions:

[0095] Basic experimental model: The "ligand" is placed in the titration needle, and the "macromolecule" is placed in the sample cell. The heat of reaction is measured. The test solution and the control solution are titrated separately with aldosterone diluent, and the change in heat during the titration is detected. The instrument used is a PEAQ-ITC from Malvern Instruments Ltd., UK.

[0096] 1. Dilute the synthesized nucleic acid aptamer (QGT-21) and control sequence (QGT-CTL-SEQ ID No. 5) from General Chemical Company to 23.2 μM with DPBS, then take 200 μL of each, add 192 μL of DPBS and 8 μL of methanol, mix thoroughly, and the final concentration of the aptamer is 11.6 μM, 400 μL.

[0097] The control sequence (QGT-CTL-SEQ ID No. 5) is shown below:

[0098] ATTGGCACTCCACGCATAGGACTGTCAACGACTATGCTAAGAGGCCGAAGCACCACTTTCCCTATGCGTGCTACCGTGAA.

[0099] 2. Dilute aldosterone to 200 μM with DBPS. The dilution method is to add 2 μL of 1 mM aldosterone (dissolved in methanol) to 98 μL of DPBS and mix thoroughly.

[0100] 3. Perform titration: titrate the nucleic acid aptamers with aldosterone.

[0101] The results are as follows: Figure 3 As shown, during the titration process between the control sequence and aldosterone, the caloric content was low and there was no significant caloric change, so the instrument could not fit the parameters; for example... Figure 2 As shown, there is a significant heat change during the titration process between QGT-21 and aldosterone, confirming that the two substances are bound together. The specific parameters obtained from this binding are automatically fitted by PEAQ-ITC based on the heat of titration.

[0102] Example 3

[0103] Applications of aldosterone aptamers in mass spectrometry detection:

[0104] General procedure: A highly specific, high-affinity aldosterone aptamer is biotinylated via a C7 or C6 indirect arm and then non-covalently coupled to a streptavidin-modified vector. After washing and blocking, a specific aldosterone-coupled vector is obtained. This vector is used for mass spectrometry pretreatment to enrich the analyte for detection.

[0105] The specific carrier is streptavidin-modified magnetic beads, namely SA magnetic beads (purchased from Invitrogen, Dynabeads). TM MyOne TM Carboxylic Acid (item number: 65001)

[0106] Specific steps:

[0107] 1. Biotin-modified single-stranded DNA with the following sequence was synthesized at General Biotech:

[0108] The specific sequence of 5'-biotin-SEQ ID No. 1:

[0109] Biotin-ATTGGCACTCCACGCATAGGCAGCTGGGTCGTGAAGACACTGCAAAGCCTGCTCACGTACCCTATGCGTGCTACCGTGAA.

[0110] 2. Dissolution: Take out the modified primer powder synthesized by General Biotech and centrifuge at 12000 rpm for 10 min. Add DPBS buffer to dissolve, then dilute with DPBS to a final concentration of 600 nM 1000 μL, vortex to mix, and set aside for use.

[0111] 3. Refolding treatment: The diluted solution obtained in step 2 is dispensed into a PCR instrument for refolding. The PCR program is: 95℃ for 10 min, 4℃ for 5 min; thereby forming the aptamer into the desired structure.

[0112] 4. Pipette 700 μL of 10 mg / ml streptavidin magnetic beads (purchased from Invitrogen, Dynabeads) TM MyOne TM Carboxylic Acid (catalog number: 65001) was used to wash the magnetic beads four times with 1000 μL of DPBS each time. The beads were then hooked with a magnet to remove the supernatant. (During the final wash, the magnetic beads were temporarily stored in a small amount of DPBS to prevent them from drying out.) The resulting magnetic bead solution was then aliquoted into two portions: one 600 μL (experimental group) and one 100 μL (control group) for later use.

[0113] 5. Add 1000 μL of the aptamer liquid obtained in step 3 after the renaturation process to the magnetic beads obtained in step 4, mix well, and shake on a rotary table at room temperature for 60 min.

[0114] 6. Washing and Adsorption: Using a magnet to pick up the magnetic beads from the experimental group obtained in the previous step, remove the supernatant and wash again. Each time, add 1000 μL of wash buffer (DPBS) to the magnetic beads, mix at room temperature for 1 min, then pick up the beads with a magnet, let stand at room temperature for 1 minute, remove the supernatant, and repeat the washing operation 5 times. Finally, add 600 μL of DPBS, mix well and bring to a final volume. Aliquot the resulting magnetic bead solution into 6 equal portions, each 100 μL. To prevent inconsistent wear and tear on the magnetic beads during washing, the control group magnetic beads were also washed 5 times with 100 μL of DPBS.

[0115] 7. Dilute the aldosterone standard with DPBS to concentrations of 20 nM (300 μL) and 50 nM, 100 nM, 150 nM, 200 nM, and 250 nM (150 μL each).

[0116] 8. Take the control group magnetic beads and the magnet fishing magnetic beads obtained in step 6, remove the supernatant, add 150 μL of 20 nM aldosterone standard diluted with DPBS, mix well, shake on a rotary vibrator at room temperature for 20 min, remove the supernatant, and rinse the magnetic beads twice with 200 μL of DPBS. Simultaneously, add 150 μL each of 20 nM, 50 nM, 100 nM, 150 nM, 200 nM, and 250 nM to the aliquoted control group magnetic beads obtained in step 6, mix well, and label them as experimental groups 1-6. Shake on a rotary vibrator at room temperature for 20 min, remove the supernatant, and rinse each experimental group magnetic bead twice with 200 μL of DPBS.

[0117] 9. Elute each of the magnetic beads obtained in the previous step with 200 μL of methanol. After mixing, incubate at room temperature for 10 min, then use a strong magnet to adsorb the magnetic beads, collect the supernatant, label it, and analyze the aldosterone content using mass spectrometry.

[0118] This embodiment utilizes aldosterone standards and aldosterone aptamer magnetic beads prepared using the aptamer from Example 1 for the enrichment and purification of aldosterone samples. The aldosterone retained by the aptamer binding on the magnetic beads was eluted with methanol, and the concentration of aldosterone was detected by mass spectrometry. The main purpose is to test the enrichment ability of the aptamer-magnetic bead complex, providing a template for future applications.

[0119] The detection data obtained by mass spectrometry are summarized in Table 4:

[0120] Table 4. Summary of Test Data

[0121] name Mass spectrometry data control group 9580.563 Experimental group 1 106624.8 Experimental group 2 255091.6 Experimental group 3 352619.9 Experimental group 4 474563.7 Experimental group 5 568121.4 Experimental group 6 687179.9

[0122] See Figure 4 The control group: the mass spectrometry data was 9580.563, which is the value of non-specific adsorption binding.

[0123] See Figure 5 Experimental group 1: The mass spectrometry data obtained was 106624.8.

[0124] There was a significant difference between the control group and experimental group 1. Under the same concentration of aldosterone, the aptamers on the magnetic beads coupled with aptamers could specifically bind to aldosterone, thus enriching the beads. This proves that the aptamers in Example 1 can play an enrichment role.

[0125] See Figure 5-10 The mass spectra of experimental groups 2-6 show obvious peak shapes, and the mass spectrometry data obtained exhibit significant linearity. The concentration of added aldosterone and the enriched eluted mass spectrometry data were fitted together (see Table 5). Figure 11 As shown.

[0126] Table 5. Fitted Data

[0127]

[0128] The linear curve obtained in this implementation case, R 2 The linearity tends to 1, indicating good linearity. This embodiment can be applied to mass spectrometry.

[0129] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent changes made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention. sequence list <110> Hangzhou Baichen Medical Laboratory Co., Ltd. Hangzhou Baichen Medical Equipment Co., Ltd. <120> Nucleic acid aptamers and derivatives that specifically bind aldosterone, applications, and kits <141> 2022-06-17 <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> 80 <212> DNA <213> Artificial Sequence <400> 1 attggcactc cacgcatagg cagctgggtc gtgaagacac tgcaaagcct gctcacgtac 60 cctatgcgtg ctaccgtgaa 80 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 attggcactc cacgcatagg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 ttcacggtag cacgcatagg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 cctatgcgtg gagtgccaat 20 <210> 5 <211> 80 <212> DNA <213> Artificial Sequence <400> 5 attggcactc cacgcatagg actgtcaacg actatgctaa gaggccgaag caccactttc 60 cctatgcgtg ctaccgtgaa 80

Claims

1. A nucleic acid aptamer that specifically binds to aldosterone, characterized in that, The nucleotide sequence is shown in SEQ ID No.

1.

2. The nucleic acid aptamer that specifically binds to aldosterone according to claim 1, characterized in that, The nucleotide sequence of the nucleic acid aptamer contains base modifications and maintains affinity.

3. The nucleic acid aptamer that specifically binds to aldosterone according to claim 2, characterized in that, The base modification includes thiolation, phosphorylation, methylation, amylation, thiolation, selenium-substituted oxygen modification, or isotope linkage modification.

4. The nucleic acid aptamer that specifically binds to aldosterone according to claim 1, characterized in that, The marker is a fluorescent marker, a radioactive marker, a biotin marker, a digoxigenin marker, a nanoluminescent material marker, a small peptide marker, an siRNA marker, or an enzyme marker.

5. A nucleic acid aptamer derivative that specifically binds to aldosterone, characterized in that, The nucleic acid aptamer derivative is a thiophosphate backbone derived from the nucleotide sequence backbone of the nucleic acid aptamer according to any one of claims 1-4, or a corresponding peptide nucleic acid modified from the nucleic acid aptamer according to any one of claims 1-4.

6. The application of a nucleic acid aptamer that specifically binds to aldosterone as described in any one of claims 1-4 or a nucleic acid aptamer derivative as described in claim 5 in the preparation of a kit for detecting aldosterone.

7. A kit for detecting aldosterone, characterized in that, Includes the nucleic acid aptamer that specifically binds to aldosterone as described in any one of claims 1-4 or the nucleic acid aptamer derivative as described in claim 5.

Citation Information

Patent Citations

  • Method for rapidly screening aptamer based on exonuclease degradation rate

    CN115927535A