A method of inducing transdifferentiation of fibroblasts into kidney epithelial cells

By employing a bicistronic retroviral vector and a dual-selective antibiotic strategy, and utilizing a combination of four factors—Hnf1β, Emx2, Pax8, and Hnf4α—fibroblasts were directly reprogrammed into renal tubular epithelial cells. This approach addresses the low efficiency and ethical concerns of existing technologies, achieving highly efficient renal epithelial cell preparation and providing technical support for the treatment of acute renal ischemia-injury.

CN115851600BActive Publication Date: 2026-06-26THE SECOND AFFILIATED HOSPITAL OF NAVAL MEDICAL UNIVERSITY PLA
2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
THE SECOND AFFILIATED HOSPITAL OF NAVAL MEDICAL UNIVERSITY PLA
Filing Date
2022-07-06
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing methods for transdifferentiating fibroblasts into renal epithelial cells rely on totipotent or pluripotent cells, which raise ethical concerns and tumorigenic risks. Furthermore, these methods have low reprogramming efficiency and are difficult to meet the needs of clinical applications.

Method used

Using a bicistronic retroviral vector combined with dual-selective antibiotics, four transcription factors—Hnf1β, Emx2, Pax8, and Hnf4α—were combined to directly reprogram fibroblasts into renal tubular epithelial cells. Puromycin and blasticin were used for selection to improve transdifferentiation efficiency.

Benefits of technology

It significantly improves the transdifferentiation efficiency of renal epithelial cells, simplifies the reprogramming process, is suitable for widespread laboratory applications, and provides technical support for the treatment of acute renal ischemia injury.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0003732366910000011
    Figure HDA0003732366910000011
  • Figure HDA0003732366910000012
    Figure HDA0003732366910000012
  • Figure HDA0003732366910000013
    Figure HDA0003732366910000013
Patent Text Reader

Abstract

The present application relates to the field of cell reprogramming, and in particular to a method for inducing fibroblast transdifferentiation into kidney epithelial cells by using a double-stranded retrovirus vector combined with a double selection antibiotic screening strategy. The present application first applies a double-stranded retrovirus vector, and adds a Puromycin and Blasticin double-antibiotic screening strategy, to induce four transcription factors Hnf1beta, Emx2, Pax8 and Hnf4alpha to reprogram embryonic fibroblasts into kidney tubular epithelial cells within two weeks. The establishment of the technical system of the present application will provide strong technical support for obtaining kidney tubular epithelial cells in vitro.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of cell reprogramming technology, specifically, to a highly efficient method for inducing fibroblasts to transdifferentiate into renal epithelial cells using a bicistronic retroviral vector combined with a dual-selection antibiotic screening strategy. Background Technology

[0002] In recent years, several mature strategies for transdifferentiating pluripotent stem cells (PSCs) toward the kidney have been established. Embryonic stem cells or induced pluripotent stem cells (iPSCs) can be induced to differentiate into kidney-like cell characteristics under conditions of growth factors or small molecule compounds. These strategies aim to recapitulate the in vivo kidney differentiation process and generate kidney-like organoids containing nephrons, endothelial cells, and interstitial cells. However, these methods rely on totipotent or pluripotent cells and complex differentiation conditions. Furthermore, the use of human embryonic stem cells raises ethical concerns, and the tumorigenic risk of iPSCs limits their clinical application. A new study shows that the expression of four specific transcription factors—Hnf1β, Emx2, Pax8, and Hnf4α—is sufficient to transdifferentiate mouse and human fibroblasts into induced renal epithelial cells (iRECs), which exhibit epithelial cell morphological, transcriptional, and functional characteristics. iRECs generated through direct reprogramming are most similar to proximal tubular cells, but gene expression profiles indicate heterogeneity in tubular cell types. The underlying mechanisms of kidney reprogramming are not fully understood, and the reprogramming efficiency of the four transcription factors is relatively low. Therefore, the combination strategies of transcription factors need further improvement, and a deeper understanding of the reprogramming mechanisms will contribute to our further understanding of kidney reprogramming. Summary of the Invention

[0003] The purpose of this invention is to provide a method for transdifferentiating fibroblasts into renal tubular epithelial cells. To optimize the direct reprogramming of fibroblasts into renal tubular epithelial cells, this invention employs a bicistronic retroviral vector and a dual-selective antibiotic strategy to induce renal reprogramming. Our research shows that the optimized four-factor combination significantly improves the transdifferentiation efficiency of renal epithelial cells (10%-15%). Furthermore, the three-factor combination excluding Hnf4a also activates the fate of renal epithelial cells, and the transdifferentiation efficiency is even higher than the previously reported four-factor combination (26%). Mechanistically, we found that Hnf1β can activate the expression of endogenous Hnf4a transcriptional levels, thereby regulating the three-factor induction of renal reprogramming lacking Hnf4a. We believe that this improved renal epithelial cell reprogramming protocol will offer great promise for the future repair and treatment of acute renal ischemia-induced injury.

[0004] A first aspect of the present invention provides a method for inducing fibroblasts to transdifferentiate into renal epithelial cells, comprising the following steps:

[0005] S1. Construction of reverse transcription packaging plasmids;

[0006] The reverse transcription packaging plasmid carries four reprogramming factors, and the combination of the four reprogramming factors is selected from any of the following:

[0007] Hnf1β-P2A-Emx2-Puromycin+Hnf4α-P2A-Pax8-Blasticin

[0008] (H1E-Puro+H4P-BSD, abbreviated as H1EH4P)

[0009] Hnf1β-P2A-Hnf4α-Puromycin+Emx2-P2A-Pax8-Blasticin

[0010] (H1H4-Puro+EP-BSD, abbreviated as H1H4EP)

[0011] Hnf1β-P2A-Pax8-Puromycin+Hnf4α-P2A-Emx2-Blasticin

[0012] (H1P-Puro+H4E-BSD, abbreviated as H1PH4E);

[0013] Alternatively, the reverse transcription packaging plasmid carries three reprogramming factors, and the combination of the three reprogramming factors is selected from any of the following:

[0014] Hnf1β-Puromycin+Emx2-P2A-Pax8-Blasticin

[0015] (H1β-Puro+EP-BSD, abbreviated as H1EP),

[0016] Hnf1β-Puromycin+Hnf4α-P2A-Pax8-Blasticin

[0017] (H1β-Puro+H4P-BSD, abbreviated as H1H4P),

[0018] Hnf4α-Puromycin+Emx2-P2A-Pax8-Blasticin

[0019] (H4α-Puro+EP-BSD, abbreviated as H4EP),

[0020] Hnf1β-Puromycin+Hnf4α-P2A-Emx2-Blasticin

[0021] (H1β-Puro+H4E-BSD, abbreviated as H1H4E);

[0022] S2, retroviral packaging;

[0023] S3, after being packaged by retroviruses, infects fibroblasts and induces fibroblasts to transdifferentiate into renal epithelial cells.

[0024] Furthermore, the fibroblasts are obtained from the embryos of pregnant mice at 12.5 to 14 days of gestation, and mouse embryonic fibroblasts (MEF) are extracted from them.

[0025] Furthermore, the method for preparing mouse embryonic fibroblasts is as follows: The cell membrane outside the embryo is carefully removed, the head and internal organs are removed, the tissue is minced with scissors, 1 mL of 0.05% trypsin is added, and the tissue is transferred to a 15 mL centrifuge tube. The tissue is digested in a 37°C water bath, mixing every 5 minutes. After digestion for approximately 15 minutes, the digestion is terminated by adding DMEM medium containing 10% FBS. The completely digested primary embryonic fibroblasts are then cultured in culture flasks for subsequent experiments.

[0026] Furthermore, the method for constructing the reverse transcription packaging plasmid in step S1 includes the following steps:

[0027] Three bicistronic retroviral vector prototypes isolated from the 2A polypeptide cleavage site (P2A) were constructed in the retroviral backbone plasmid pMXs. A dual antibiotic selection strategy using puromycin and blasticin was employed in these prototypes. The cDNA fragments of the four transcription factors were obtained by PCR (the cDNA sequences of EMX2, Hnf1β, Hnf4α, and Pax8 are shown in SEQ ID NO. 18–SEQ ID NO. 19). As shown in NO.21, three types of BSD bicistronic vectors (Emx2-P2A-Pax8-Blasticin (EP-BSD), Hnf4α-P2A-Pax8-Blasticin (H4P-BSD), and Hnf4α-P2A-Emx2-Blasticin (H4E-BSD)) were obtained by homologous recombination and ligation into bicistronic vectors. Additionally, Hnf1β-P2A-Emx2-Puromycin (H1E-Puro) and Hnf1β-P2A-Puromycin (H1E-Puro) were also obtained. Three types of BSD bicistronic vectors, namely P2A-Hnf4α-Puromycin (H1H4-Puro) and Hnf1β-P2A-Pax8-Puromycin (H1P-Puro), were selected from previously constructed bicistronic vectors to create three four-factor reprogramming combinations: H1E-Puro+H4P-BSD (H1EH4P), H1H4-Puro+EP-BSD (H1H4EP), and H1P-Puro+H4E-BSD (H1PH4E). Figure 3 ).

[0028] The nucleotide sequence of Hnf1β-P2A-Emx2 is shown in SEQ ID NO.22;

[0029] The nucleotide sequence of Hnf4α-P2A-Pax8 is shown in SEQ ID NO.23;

[0030] The nucleotide sequence of Hnf1β-P2A-Hnf4α is shown in SEQ ID NO.24;

[0031] The nucleotide sequence of Emx2-P2A-Pax8 is shown in SEQ ID NO.25;

[0032] The nucleotide sequence of Hnf1β-P2A-Pax8 is shown in SEQ ID NO.26;

[0033] The nucleotide sequence of Hnf4α-P2A-Emx2 is shown in SEQ ID NO.27.

[0034] Three bicistronic retroviral vectors isolated from the 2A polypeptide cleavage site (P2A) were constructed in the retroviral backbone plasmid pMXs. A dual antibiotic selection strategy using puromycin and blasticin was implemented in these vectors. The cDNA fragments of the four transcription factors were obtained by PCR and then ligated into the bicistronic vector vectors using homologous recombination to obtain Emx2-P2A-Pax8-Blasticin (EP-BSD), Hnf4α-P2A-Pax8-Blasticin (H4P-BSD), and Hnf4α-P2A-Emx2-Blasticin. Three types of bicistronic vectors, including sticin (H4E-BSD), were used. These three types of bicistronic vectors were selected to construct two single-factor plasmids: Hnf1β-Puromycin (H1β-Puro) and Hnf4α-Puromycin (H4α-Puro). Four three-factor reprogramming combinations were then established: H1β-Puro+EP-BSD (H1EP), H1β-Puro+H4P-BSD (H1H4P), H4α-Puro+EP-BSD (H4EP), and H1β-Puro+H4E-BSD (H1H4E). Figure 11 A).

[0035] Primers were designed using homologous recombination (primer sequences are shown in SEQ ID NO.1 to SEQ ID NO.17). The target fragment was amplified by PCR using KOD Plus neo and KOD FX. A Promega DNA recovery kit was used. If the amplified PCR product was specific, it could be directly recovered. Then, the following steps were performed: recombination, transformation, plating, colony PCR identification, culture, plasmid extraction, plasmid sequencing, and plasmid expression detection.

[0036] Furthermore, the retroviral packaging method in step S2 includes the following steps:

[0037] Plate PlateE cells into 10cm dishes. After the cells reach a suitable density (50-60%), transfect them using Lipofiter transfection reagent from Hanheng Biotechnology. Mix the transfection reagent with Opti-MEM and let stand for 5 min. Mix the plasmid with Opti-MEM, then mix the transfection reagent and plasmid together gently. Let stand at room temperature for 20 min and add the mixture to the cells. Replace the medium with fresh medium 6-8 h after transfection, adding 1% BSA and 1× Hepes. Observe the cells. 48 h after transfection, collect the supernatant, and the virus particles are released into the supernatant. Transfer the supernatant to a 15mL centrifuge tube, centrifuge at 1000rpm at room temperature for 5 min, and filter using a 0.45μm filter. Transfer the filtrate to a new centrifuge tube and add 4×PEG8000 virus concentrate. Mix well and let stand overnight at 4℃. Take 200μL of the virus supernatant for titer determination. Centrifuge the virus using a horizontal rotor at 1500g for 30 min at 4℃ and discard the supernatant.

[0038] Furthermore, the method for inducing fibroblast transdifferentiation into renal epithelial cells in step S3 includes the following steps:

[0039] MEF cells from Ksp-Cre;mTmG mice aged E12.5 to E14 days were prepared for transdifferentiation experiments; cells were digested with trypsin and counted, and seeded in 12-well plates at 4×10⁶ cells / well. 4 MEF cells were cultured; after cell adhesion, reprogramming factor virus was added; 4 μg / mL Polybrene was added to the culture medium to promote viral transport into the cells; when performing transdifferentiation experiments with bicistronic transcription factor virus, the amount of transcription factor virus used was approximately 12 μL; after 48 h of viral infection, the culture medium was replaced with fresh medium; 60-72 h of viral infection, selection was performed using Puromycin and Blastidin S; during the first three days of selection, the concentration of Puromycin used was 2 μg / ml, and the concentration of Blastidin S used was 20 μg / ml; subsequently, the concentrations of Puromycin and Blastidin S were reduced by half to maintain culture; the GFP expression of MEF cells was continuously observed to track the transdifferentiation of MEF cells into renal tubular epithelial cells.

[0040] The advantages of this invention are:

[0041] 1. The key to this invention lies in how to directly reprogram embryonic fibroblasts into renal tubular epithelial cells using a simple and efficient method, so that they can be transplanted under suitable medical conditions in the future to treat acute renal ischemia-injury. This invention is the first to utilize a bicistronic retroviral vector and incorporates a dual antibiotic selection strategy using Puromycin and Blasticin, inducing the reprogramming of embryonic fibroblasts into renal tubular epithelial cells by inducing four transcription factors—Hnf1β, Emx2, Pax8, and Hnf4α—within two weeks. The establishment of this invention's technical system will provide strong technical support for obtaining renal tubular epithelial cells in vitro.

[0042] 2. The molecular markers of renal tubular epithelial cells cultured using the culture induction method of the present invention are largely consistent with those of primary renal tubular epithelium.

[0043] 3. The induced reprogramming method of the present invention is simple and does not require special materials and equipment, and can be widely used in the laboratory.

[0044] 4. This invention uses mice as experimental subjects. Mice are closely related to humans in terms of pedigree. The renal tubular epithelial cells obtained by inducing reprogramming in human clinical practice will provide strong support for transplantation therapy for acute renal ischemia injury. Attached Figure Description

[0045] Figure 1 : Schematic diagram of Ksp-Cre tool mice and mTmG reporter gene strain mice. (A) Ksp-Cre mice are mated with mTmG mice to produce offspring Ksp-Cre; mTmG mouse embryos are used for renal tubular epithelial cell reprogramming experiments. (B) The mTmG reporter gene strain has loxP sites flanking TdTomato(mT) and expresses strong red fluorescence in all tissues and cell types. When crossed with mice expressing Cre recombinase, the offspring have the mT box knocked out in tissues expressing Cre and express downstream membrane-localized EGFP(mG).

[0046] Figure 2 : Flowchart of retroviral packaging and collection for infecting mouse fibroblasts. Experimental procedure for iRECs reprogramming using retroviral vectors. Retroviruses containing four iRECs reprogramming transcription factors were prepared to infect MEF cells of Ksp / Cdh16-Cre;Rosa26-Loxp-tdTomato-Loxp-EGFP reporter mice, which specifically express EGFP in renal tubular epithelial cells.

[0047] Figure 3The optimized four-factor combination improves MEF transdifferentiation into renal tubular epithelial cells. Four reprogramming transcription factors, Hnf1β, Emx2, Hnf4α, and Pax8, were isolated via P2A sequence separation and combined with resistance screening using puromycin and blastcin, to construct three combinations of bicistronic retroviral vectors: H1EH4P, H1H4EP, and H1PH4E.

[0048] Figure 4 Renal tubular epithelial cell reprogramming factors can be effectively expressed in MEF cells. (A) MEF cells were infected with Hnf1b, Emx2, Hnf4a, and Pax8 retroviruses, and protein expression was detected by Western blot. (B) Retroviruses expressing GFP were prepared, and MEF cells were infected for 72 hours. After cell digestion, the efficiency of GFP virus infection in MEF cells was detected by flow cytometry.

[0049] Figure 5 Transfection with Hnf1b, Emx2, Hnf4a, and Pax8 alone was insufficient to transdifferentiate MEF cells into renal tubular epithelial cells. (A) Fluorescence microscopy observation of GFP expression in MEF cells after infection with the four-factor virus. Some cells in the four-factor-infected MEF cells expressed GFP, while no cells in the control group expressed GFP. (B) Flow cytometry was used to detect the transdifferentiation efficiency of MEF cells into renal tubular epithelial cells. The flow cytometry plot shows the transdifferentiation efficiency of MEF cells induced by infection with the four transcription factors in a cocktail format. (C) Bar graph of transdifferentiation efficiency.

[0050] Figure 6 Immunofluorescence analysis of transdifferentiation of fibroblasts into renal epithelial cells induced by four factors. Analysis of fluorescence images of iRECs induced by H1EH4P, H1H4EP, and H1PH4 at 2 weeks after transfection.

[0051] Figure 7 Western blot and qPCR were used to detect the expression levels of HNF1B, EMX2, HNF4A, and PAX8 in the four-factor combination. (A) Western blot was used to detect the expression levels of HNF1B, EMX2, HNF4A, and PAX8 in the H1EH4P, H1H4EP, and H1PH4E combinations. (B) The expression levels of HNF1B, EMX2, HNF4A, and PAX8 in the four-factor combination were statistically analyzed. (C, D) qPCR was used to detect the expression levels of Hnf1b, Emx2, Hnf4a, Pax8, and Cdh16 in cells infected with the four-factor combination for 10 and 15 days.

[0052] Figure 8The four-factor combination can effectively improve the transdifferentiation efficiency of MEF into renal tubular epithelial cells. (A, B) Flow cytometry plots show the transdifferentiation efficiency of MEF two weeks after infection with the three combinations of viruses. (C) Bar chart shows the transdifferentiation efficiency of MEF into renal tubular epithelial cells after 2, 3 and 5 weeks of induction by the four-factor combination.

[0053] Figure 9 The expression of kidney-related genes after H1EH4P overexpression in MEF cells at 0, 3, 9, and 13 days was investigated. (AC) qPCR was used to detect the expression of kidney-related transcription factors, kidney functional proteins, and developmental-related protein genes in MEF cells infected with H1EH4P over time.

[0054] Figure 10 RNA-seq was used to investigate gene transcriptional changes in MEF cells infected with H1EH4P, H1H4EP, and H1PH4E. (A) After 12 days of culture, RNA was extracted from MEF cells infected with H1EH4P, H1H4EP, and H1PH4E for RNA-seq. The bar chart shows the number of upregulated and downregulated genes compared to MEF. (B, C) GO enrichment analysis was performed on the upregulated and downregulated genes of H1EH4P overexpression compared to MEF.

[0055] Figure 11 The three-factor combination induced the transdifferentiation of MEF cells into renal tubular epithelial cells. (A) Schematic diagram of the three-factor combination. One transcription factor was removed, and screening was still performed using Puromycin and Blastidin S. (B) MEF cells were infected with the three factors and cultured for 2 weeks. The transdifferentiation was observed by fluorescence microscopy and flow cytometry. (C) Bar chart showing the transdifferentiation efficiency of MEF cells induced by H1EP, H1HP, H4EP, and H1H4E at different time points. (D, E) Western blot analysis of the expression of Hnf1b, Emx2, Hnf4a, and Pax8 in MEF cells infected with H1EP, H1HP, H4EP, and H1H4E, with H1EH4P as a control.

[0056] Figure 12 Morphological images and clonogenic capacity assays of renal tubular epithelial cells induced by H1EP, H1H4P, and H1EH4P. (A) Morphological images of renal tubular epithelial cells and MEF induced by H1EP, H1H4P, and H1EH4P under bright field. (B) Clonogenic assay of renal tubular epithelial cells and MEF induced by H1EP, H1H4P, and H1EH4P, with crystal violet staining. (C) Statistical graph of the number of renal tubular epithelial cells and MEF clonates induced by H1EP, H1H4P, and H1EH4P.

[0057] Figure 13Induced renal tubular epithelial cells were sorted and RNA-seq was performed to investigate their gene expression. (A) Heatmap showing gene expression in MEF, primary renal tubular epithelial cells, and H1EP, H1H4P, and H1EH4P-induced renal tubular epithelial cells. (B) Expression of epithelial cell marker genes, tight junction-related genes, and kidney-related transporters in MEF, primary renal tubular epithelial cells, and H1EP, H1H4P, and H1EH4P-induced renal tubular epithelial cells. (C) Volcano plot showing the number of genes upregulated and downregulated by 2-fold and more than 2-fold in H1EP-induced renal tubular epithelial cells compared to MEF. (D) Left panel shows the expression of some upregulated genes in MEF, H1EP, H1H4P, and H1EH4P-induced renal tubular epithelial cells. Right panel shows the expression of the corresponding genes in different segments of the adult mouse kidney. (E) Expression of different marker genes in H1EP-induced renal tubular epithelial cells of mice.

[0058] Figure 14 Expression of renal marker genes in induced renal tubular epithelial cells. (A) qPCR verification of the expression of renal-related transcription factors and transporters in induced and primary renal tubular epithelial cells. (B) Western blot detection of the expression of Epcam, E-cadherin, and CDH16 in induced renal tubular epithelial cells. (CF) Immunostaining detection of the expression of Epcam, E-cadherin, ATP1A1, AQP1, and Vimentin in H1EP-induced renal tubular epithelial cells and MEF.

[0059] Figure 15 Overexpression of H1EP activates endogenous Hnf4a expression in MEF. (A) Western blot was used to detect H1EP overexpression and HNF4a expression in MEF. H1EH4P was used as a control. (B) The expression level of endogenous HNF4a was quantified by bar chart. (C) qPCR was used to detect Hnf4a expression in MEF after H1EP overexpression.

[0060] Figure 16Hnf1b positively regulates Hnf4a transcription. (A) Hnf1b, Emx2, and Pax8 were overexpressed in MEF cells, and HNF4a expression was detected by Western blot. (B) Hnf1b, Emx2, and Pax8 were overexpressed individually in MEF cells, and Hnf4a expression was detected by qPCR. (C) H1EP was expressed in MEF cells, with Hnf1b carrying a FLAG-tag. ChIP experiments were performed using a FLAG antibody, and ChIP-PCR was used to detect the binding of HNF1B to the Hnf4a promoter region. (D) ChIP-qPCR was used to detect the binding of HNF1B to the Hnf4a promoter region. (E) Luciferase assays were used to detect the transcriptional regulation of Hnf4a by Hnf1b. Hnf1b can promote the transcriptional activity of the Hnf4a promoter. When the HNF1B binding site is missing, the transcriptional promotion activity of HNF1B decreases.

[0061] Figure 17 Overexpression of H1EP in MEFs combined with HNF4A inhibitors reduced transdifferentiation efficiency. (A) MEFs treated with HNF4A inhibitors and H1EP overexpression were observed under fluorescence microscopy, and transdifferentiation efficiency was analyzed by flow cytometry. (B) Western blot analysis was performed on the expression of HNF1B, EMX2, HNF4A, and PAX8 in MEFs treated with HNF4A inhibitors.

[0062] Figure 18 : Induced renal tubular epithelial cells possess certain renal tubular epithelial cell functions. (A) After cisplatin treatment of MEF and induced renal tubular epithelial cells for 18 h, DAPI staining was performed, and cell death was detected by flow cytometry. (B) After cisplatin treatment of MEF and induced renal tubular epithelial cells, cell death was detected at different time points. (C) Under the condition of combined treatment with cisplatin and cimetidine, the death of MEF and induced renal tubular epithelial cells was detected. (D) Schematic diagram of mouse kidney remodeling experiment: mouse kidneys were decellularized, and induced renal tubular epithelial cells were injected into them and cultured. They were able to autonomously form tubular structures. (E) Partially reconstructed mouse kidneys were fixed, dehydrated, embedded, and sectioned. The ability of induced renal tubular epithelial cells to autonomously form tubular structures was detected by co-staining the epithelial cell marker gene Epcam with GFP. Detailed Implementation

[0063] The specific implementation methods provided by the present invention will be described in detail below with reference to the embodiments.

[0064] Example 1:

[0065] I. Experimental Methods

[0066] A. Preparation and culture of primary embryonic fibroblasts

[0067] Pregnant mice at 12.5 to 14 days of gestation were used to extract mouse embryonic fibroblasts. The cell membranes of the embryos were carefully removed using two curved forceps, and the head and internal organs were removed. The tissue was minced with scissors, and 1 mL of 0.05% trypsin was added. The tissue was transferred to 15 mL centrifuge tubes and digested in a 37°C water bath, mixing every 5 minutes. After approximately 15 minutes of digestion, the digestion was terminated by adding medium containing 10% FBSDMEM. The fully digested primary embryonic fibroblasts were then seeded into culture flasks for subsequent experiments.

[0068] B. Construction of reverse transcription packaging plasmids

[0069] We constructed three bicistronic retroviral vector prototypes isolated from the 2A polypeptide cleavage site (P2A) in the retroviral backbone plasmid pMXs, and added a dual antibiotic selection strategy of puromycin and blasticin to the prototypes. The cDNA fragments of the four transcription factors were obtained by PCR (the cDNA sequences of EMX2, Hnf1β, Hnf4α, and Pax8 are shown in SEQ ID NO.18~SEQ ID NO.18, respectively). As shown in NO.21, by linking to bicistronic vectors via homologous recombination, we obtained three types of BSD bicistronic vectors: Emx2-P2A-Pax8-Blasticin (EP-BSD), Hnf4α-P2A-Pax8-Blasticin (H4P-BSD), and Hnf4α-P2A-Emx2-Blasticin (H4E-BSD), as well as three types of BSD bicistronic vectors: Hnf1β-P2A-Emx2-Puromycin (H1E-Puro), Hnf1β-P2A-Hnf4α-Puromycin (H1H4-Puro), and Hnf1β-P2A-Pax8-Puromycin (H1P-Puro). We selected three types of bicistronic elements that were successfully constructed previously and combined them to establish three four-factor reprogramming combinations: H1E-Puro+H4P-BSD (H1EH4P), H1H4-Puro+EP-BSD (H1H4EP), and H1E-Puro+H4E-BSD (H1PH4E).

[0070] The nucleotide sequence of Hnf1β-P2A-Emx2 is shown in SEQ ID NO.22.

[0071] The nucleotide sequence of Hnf4α-P2A-Pax8 is shown in SEQ ID NO.23;

[0072] The nucleotide sequence of Hnf1β-P2A-Hnf4α is shown in SEQ ID NO.24;

[0073] The nucleotide sequence of Emx2-P2A-Pax8 is shown in SEQ ID NO.25;

[0074] The nucleotide sequence of Hnf1β-P2A-Pax8 is shown in SEQ ID NO.26;

[0075] The nucleotide sequence of Hnf4α-P2A-Emx2 is shown in SEQ ID NO.27.

[0076] Similarly, to improve reprogramming efficiency, we constructed three bicistronic retroviral vector prototypes isolated from the 2A polypeptide cleavage site (P2A) in the retroviral backbone plasmid pMXs. We also added a dual antibiotic screening strategy of Puromycin and Blasticin to the prototypes. After obtaining the cDNA fragments of the four transcription factors by PCR, we ligated them into the bicistronic vector prototypes using homologous recombination. We obtained three types of bicistronic vector prototypes: Emx2-P2A-Pax8-Blasticin (EP-BSD), Hnf4α-P2A-Pax8-Blasticin (H4P-BSD), and Hnf4α-P2A-Emx2-Blasticin (H4E-BSD). We selected these three types of bicistronic elements and simultaneously constructed two single-factor plasmids, including Hnf1β-Puromycin (H1β-Puro) and Hnf4α-Puromycin (H4α-Puro), to create four three-factor reprogramming combinations: H1β-Puro+EP-BSD (H1EP), H1β-Puro+H4P-BSD (H1H4P), H4α-Puro+EP-BSD (H4EP), and H1β-Puro+H4E-BSD (H1H4E).

[0077] Primers were designed using homologous recombination. The target fragment was amplified by PCR using KOD Plus neo and KOD FX. A Promega DNA recovery kit was used. If the amplified PCR product was specific, it could be directly recovered. Then, the following steps were performed: recombination, transformation, plating, colony PCR identification, culture, plasmid extraction, plasmid sequencing, and plasmid expression detection.

[0078] C. Retrovirus Packaging and Preparation

[0079] Plate PlateE cells into 10cm dishes. After the cells reach a suitable density (50-60%), transfect them using Hanheng Biotechnology's Lipofiter transfection reagent. Mix the transfection reagent with Opti-MEM and let stand for 5 min. Mix the plasmid with Opti-MEM, then mix the transfection reagent and plasmid together gently. Let stand at room temperature for 20 min, then add the mixture to the cells. Replace the medium with fresh medium 6-8 h after transfection, adding 1% BSA and 1x Hepes. Observe the cells. 48 h after transfection, collect the supernatant; virus particles are released into the supernatant. Transfer the supernatant to a 15mL centrifuge tube, centrifuge at 1000 rpm for 5 min at room temperature, and filter using a 0.45μm filter. Transfer the filtrate to a new centrifuge tube and add 4×PEG8000 virus concentrate. Mix well and incubate overnight at 4°C. Take 200μL of the virus supernatant for titer determination. Centrifuge the virus using a horizontal rotor at 1500g for 30 min at 4°C, and discard the supernatant.

[0080] D. Inducing MEF transdifferentiation into renal tubular epithelial cells

[0081] MEF cells from Ksp-Cre;mTmG mice aged E12.5 to E14 days were prepared for transdifferentiation experiments. Cells were digested with trypsin and counted, then seeded at 4 × 10⁶ cells / well in 12-well plates. 4 MEF cells were cultured. After cell adhesion, a reprogramming factor virus was added. 4 μg / mL Polybrene was added to the culture medium to promote viral transport into the cells. For bicistronic transdifferentiation experiments, approximately 12 μL of the transcription factor virus was used. 48 hours after viral infection, the culture medium was replaced with fresh medium. 60-72 hours after viral infection, selection was performed using Puromycin and Blastidin S. During the first three days of selection, the concentration of Puromycin was 2 μg / mL, and the concentration of Blastidin S was 20 μg / mL. Subsequently, the concentrations of Puromycin and Blastidin S were reduced by half for maintenance culture. GFP expression in MEF cells was continuously observed to track their transdifferentiation into renal tubular epithelial cells.

[0082] E. Flow cytometry analysis and cell sorting

[0083] Cultured cells were digested into a single-cell suspension. Cells cultured in well plates or culture dishes were first washed with PBS, and then digested with 0.05% trypsin in an incubator. After 3 min of digestion, twice the volume of PBS was added, and the cells were gently blown off the bottom and transferred to 15 mL centrifuge tubes pre-filled with fresh culture medium. The tubes were centrifuged at 800 rpm for 3 min. After centrifugation, the supernatant was discarded, and the cells were resuspended in an appropriate volume of culture medium or FACS buffer. The cells were then filtered through a 40 μm cell filter. After staining with primary and secondary antibodies, the cells were ready for analysis. In our experiments, mice were bred from Gt(ROSA)(ACTB-tdTomato,-EGFP)Luo / J(mTmG) transgenic mice and Cre strain mice (Ksp-Cre / +(B6.Cg-Tg(Cdh16-cre)91Igr / J) initiated from kidney epithelial cells. The target cell population was specifically labeled with GFP, and no further staining was required before analysis.

[0084] F. Cell decellularization of mouse kidneys and cell retransplantation

[0085] Human cadaver kidneys from adult wild-type mice were washed 10 times with 10 U / mL heparinized PBS, then digested in 1% SDS for three to five days until decellularization was observed, and cultured in 1% Triton X-100 for 24 hours. Subsequently, the kidneys were washed with penicillin / streptomycin and 100 μg / mL Primocin (Invivogen), followed by sterilization with a 3 kGry dose of Co60 irradiation. Kidney samples were placed in centrifuge tubes and sent to an irradiation company for sterilization. The kidneys were then injected with 10 kGry of PBS using a 25G needle. 6 The iREC cells were implanted into the organ scaffold and then cultured in DMEM medium for 14 days.

[0086] G, 3D cell culture

[0087] Cells were digested with trypsin, passed through a 50 μm cell filter, and counted. Ten thousand cells were resuspended at a 1:1 ratio in 100 μL of growth factor-reduced matrix gel and seeded in 8-well slides. The Matrigel was allowed to polymerize at 37 °C for 15 min, followed by the addition of renal epithelial growth medium. Cells were imaged when spheroidization was evident. For immunofluorescence staining, cells were fixed in 4% PFA at room temperature for 30 min, followed by incubation at 4 °C for 30 min.

[0088] The adult mice mentioned were obtained from adult (age ≥ 6 weeks) C57 / BL6J mice.

[0089] H. Chromatin Immunoprecipitation

[0090] Prepare approximately five 10cm dish cell cultures for the experiment. For cross-linking, prepare a fresh 18.5% formaldehyde solution. Weigh out PFA powder, add 1N KOH solution and distilled water, and heat in a microwave oven until dissolved. Add 0.46mL of 18.5% formaldehyde to 8mL of culture medium, resulting in a final formaldehyde concentration of 1%. Place on a shaker for slow cross-linking for 10min. To terminate cross-linking, use 10×glycine, resulting in a final glycine concentration of 0.125M. Incubate at room temperature for 5min.

[0091] Cells are collected using a cell scraper from the culture dish. They are then transferred to 15 mL centrifuge tubes with PBS. After centrifugation, the PBS is discarded. The cell pellet can be flash-frozen in liquid nitrogen and stored at -80°C, or used directly for subsequent experiments. Genomic DNA is lysed and sonicated. Chromatin immunoprecipitation of relevant transcription factors is typically performed, removing the cytoplasm first. The nuclear fraction is used for subsequent sonication experiments. The protease inhibitor DTT is added to the cell lysis buffer. Sonication is usually performed using 15 mL centrifuge tubes. A platform contact sonicator is used. Samples are fixed in a beaker containing an ice-water mixture. The sonication program needs to be determined through trial and error. The sonicator is set to 30%-40% power. Cell samples are collected at different time points. After DNA extraction, the DNA size is determined by gel electrophoresis. A size of 200-500 bp is suitable for subsequent experiments. Once the appropriate sonication time is determined, the same sonication system is used for subsequent experiments. After sonication, the cells are centrifuged at 10000g-15000g for 10 min at 4°C to remove insoluble matter. After sonication, the solution can be flash-frozen in liquid nitrogen and then frozen at -80°C. Immunoprecipitation is used to bind the target protein and its cross-linked DNA to prepare magnetic beads. The beads are washed with cell lysis buffer, centrifuge tubes are placed on a magnetic rack, the liquid is removed, and this process is repeated once. Different magnetic beads are selected according to the antibody species. Protein G-conjugated magnetic beads show high affinity for both mouse and rabbit antibodies. The antibody is incubated with the magnetic beads, diluted in 3% BSA and added to the beads, along with a negative control antibody (negative control IgG of the same species as the target antibody) and a positive control antibody (RNA polymerase II antibody). Incubation is performed overnight at 4°C. The antibody is recovered, and the cell lysis buffer after sonication is added to the magnetic beads for rotational binding at 4°C. After sonication, a small amount of liquid is taken to extract DNA, its concentration is determined, and approximately 10 μg of sonicated genomic DNA is added for binding, or at least 1 × 10⁻⁶ is added. 6Immunoprecipitation was performed on the chromatin after cell sonication. 10% of the supernatant was used as input. After overnight incubation, the centrifuge tubes were placed on a magnetic rack, the liquid was aspirated, and the magnetic beads were washed sequentially with low-salt wash buffer, high-salt wash buffer, LiCl wash buffer, and TE buffer. The protein-DNA complex was eluted. Elution buffer was prepared, containing 10 μL of 20% SDS, 20 μL of 1M NaHCO3, and 170 μL of sterile deionized water per 200 μL of elution buffer. 100 μL of elution buffer was added to each sample, incubated at room temperature for 15 min, centrifuged, and the supernatant was collected. This process was repeated once. To decrosslink the protein and DNA, 8 μL of 5M NaCl was added to each tube, and the tubes were incubated at 65°C for 4-5 hours or overnight. 1 μL of ribonuclease A was added, and the tubes were digested at 37°C for 30 minutes. 4 μL of 0.5M EDTA, 8 μL of 1M Tris-HCl, and 1 μL of proteinase K were added, and the tubes were incubated at 45°C for 1-2 hours. The enriched DNA was extracted, and the immunoprecipitated DNA was extracted using a centrifugation column. We used the Promega DNA purification and recovery kit, following the manufacturer's instructions. The immunoprecipitation effect was assessed by PCR gel electrophoresis or Q-PCR. Using the JASPAR online tool, we predicted the binding sites of transcription factors on their target genes, selected multiple predicted binding sites, and designed multiple primer pairs near these sites. Genomic DNA was first used as a template to test the specificity of the designed primers. Highly specific primers were used to detect the immunoprecipitated DNA, and Chip-PCR or Chip-Q-PCR experiments were performed. Simultaneously, the immunoprecipitation effect of the positive control antibody was assessed to help determine the completeness of the experimental system.

[0092] I. Luciferase Reporter Gene Assay

[0093] The corresponding gene promoter region sequence was cloned into the luciferase reporter gene plasmid, and approximately 4000 bp of the upstream sequence of the Hnf4a gene was cloned into the PGL3-basic plasmid. The luciferase reporter gene plasmid was transfected into 293T cells individually and co-transfected with transcription factors. Cells were harvested 24-48 hours later for detection. Detection was performed using a Promega luciferase assay kit. Cells were washed with PBS, lysed with lysis buffer, and incubated on a shaker for 15 min or subjected to repeated freeze-thaw cycles at -80°C to aid lysis. The lysis buffer was transferred to centrifuge tubes and centrifuged at 12000 rpm for 2 min. The reaction substrate and stop reaction solution were prepared. Readings were taken using a microplate reader. After setting the luciferase detection program in the software, the sample was added to an opaque plate, the substrate was added, and the mixture was shaken to mix. The reading was taken quickly, and the stop reaction solution was added again for a second reading. The initial reading was the luciferase value, and the second reading was the Renilla luciferase value.

[0094] J. Western blot experiment

[0095] Clean the glass plate, let it dry, and then clamp it on the gel casting stand. Prepare the lower gel layer by adding the lower gel solution and buffer to a beaker, adding APS, mixing well, pouring it into the glass plate, and adding anhydrous ethanol to flatten the lower gel layer. The lower gel layer should solidify in about 20 minutes. After discarding the ethanol, add the upper gel solution. Collect cells, add an appropriate volume of RIPA to lyse the cells, add the protease inhibitor DTT, and lyse on ice for 30 minutes. Add protein loading buffer, cook on a sample cooker for 10-15 minutes, centrifuge at 12000 rpm for 2 minutes, and use a protein sampler tip to spot the protein sample into the wells. Determine the transfer time based on the position of bromophenol blue in the protein gel and the protein marker. Prepare for transfer when the protein sample reaches the bottom of the protein gel. Semi-dry transfer and wet transfer methods can be used. For proteins larger than 100 kDa, use the wet transfer method. Prepare the transfer buffer. The transfer buffer used for wet transfer contains Tris-HCl and glycine. PVDF membranes need to be activated with methanol before use. Prepare a wet transfer sandwich and perform transfer in ice water. Generally, a constant current of 260mA is used for transfer, adjusting the transfer time according to the size of the target protein. After transfer, block with 5-8% skim milk. Blocking conditions are usually 1 hour at room temperature, or overnight at 4°C. After blocking, wash the membrane with PBS to remove the milk. Dilute the antibody with 3% BSA according to the instructions. Primary antibody incubation conditions are overnight at 4°C or 2-3 hours at 37°C. After primary antibody incubation, wash the membrane three times with PBST solution. Use secondary antibody according to the species of the primary antibody. The secondary antibody dilution is 3% BSA at a dilution ratio of 1:5000, incubated at room temperature for 1-2 hours. After secondary antibody incubation, wash the membrane three times with PBST solution. We use horseradish peroxidase-conjugated secondary antibody for incubation, adding the reaction substrate during detection. We used Shenger Bio's ECL chemiluminescence solution. After mixing solution A and solution B, we dropped the solution onto the membrane and took pictures using a chemiluminescence imaging system.

[0096] K-Trizol RNA extraction

[0097] A 6-well plate contains approximately 1 × 10⁶ cells. 7 Add 1 mL of Trizol to each cell, transfer the liquid to a 1.5 mL centrifuge tube, lyse on ice for 30 min, and centrifuge at 12000 rpm for 20 min at 4°C. Alternatively, the centrifuge tube can be directly frozen at -80°C for subsequent RNA extraction. Observe for precipitation, transfer the supernatant to a new centrifuge tube, add 1 / 5 volume of chloroform, invert to mix, and let stand for 5 min to separate the layers. Centrifuge at 12000 rpm at 4°C for at least 15 min. Collect the aqueous phase and transfer it to a new centrifuge tube. Add 1 / 5 volume of chloroform again, repeat the treatment once more, and let stand to separate the layers.

[0098] Centrifuge at 12000 rpm, 4℃ for at least 5 min. Transfer the upper aqueous phase to a new centrifuge tube, add an equal volume of isopropanol, invert to mix, and precipitate RNA at -20℃ for 30 min or overnight. Centrifuge at 12000 rpm for 20 min.

[0099] After centrifugation, a white precipitate was observed. The supernatant was discarded, and the precipitate was washed with 75% ethanol. The centrifuge was then performed at 12000 rpm, 4°C, for at least 5 minutes. The 75% ethanol solution was prepared using DEPC-prepared water or nuclease-free water. The washing of the precipitate with 75% ethanol was repeated once. After a 1 minute empty centrifuge, the remaining liquid in the centrifuge tube was aspirated with a 10 μL pipette tip, being careful not to aspirate the precipitate. The tube was then left to air dry. DEPC-prepared water was added to dissolve the RNA. After determining the RNA concentration using a Nano Drop assay, the RNA was stored at -80°C for subsequent experiments.

[0100] L, RNeasy Kits method for RNA extraction

[0101] Cell count less than 5×10 6 Add 350 μl of RLT buffer. The RLT buffer can be added to the cell pellet or directly to the cell culture dish, then transfer the liquid to a centrifuge tube. For starting materials containing RNases, β-mercaptoethanol or DTT can be added to the RLT buffer, and vortex to mix. Add an equal volume of 70% ethanol to the lysis buffer, and mix with the cell lysis buffer by pipetting. Transfer the liquid to an RNA column (maximum capacity 700 μL, can be added in fractions). Place the RNA column in a 2 mL collection tube, cap it, and centrifuge at a speed higher than 8000 g for 15 seconds. If DNA removal is required, this step is necessary. Add 700 μL of RW1 to the RNA column and centrifuge at a speed higher than 8000 g for 15 seconds. Add 500 μL of RPE buffer to the RNA column and centrifuge at a speed higher than 8000 g for 15 seconds. Add 500 μL of RPE buffer to the RNA column and centrifuge at a speed higher than 8000 g for 2 minutes. Transfer the RNA column to a new centrifuge tube and centrifuge at high speed for 1 minute. After air drying, add DEPC water to dissolve the RNA, centrifuge again, and the liquid in the centrifuge tube is the RNA.

[0102] M, Cellular Immunostained

[0103] Cells were cultured in 24-well plates for immunostaining. Cell crawling slides were pre-placed at the bottom of the 24-well plates, sterilized with 75% alcohol, and then placed into the cell culture plates. Cells were washed twice with PBS before use. After passage, cells were counted, and 2.5 × 10⁶ cells were added to each well. 4 3 × 10⁻⁶ renal tubular epithelial cells were induced. 4MEF cells were fixed after reaching an appropriate density. These cells were used for subsequent E-cadherin, ZO-1, AQP1, and ATP1A1 immunostaining. Epcam staining required a slightly higher cell density. The fixation methods for different proteins also varied. E-cadherin, ZO-1, AQP1, and ATP1A1 staining were performed using 4% PFA at room temperature for 15 min. Epcam staining was performed using pre-cooled methanol (-20℃) at room temperature for 15 min. PFA achieves fixation by cross-linking proteins, while methanol has strong dehydrating properties, fixing cells in a specific morphology and maintaining cell viability. Cells were washed with PBS before subsequent steps. Typically, cells were treated with 0.1% Triton X-100 at room temperature for 15 min. The permeabilization step differed depending on the fixation method; when using methanol fixation, permeabilization was generally not performed. The permeabilization method also varied depending on the localization of the stained proteins within the cells. For AQP1 staining, after cell fixation, cells were treated with 1% SDS at room temperature for 5 min before subsequent experiments. Cells were washed multiple times with PBS to prevent SDS from interfering with antibody binding to the target protein. The blocking solution is PBS containing 5% BSA and 5% goat serum, blocked at 37°C for 1 hour. The antibody is diluted in PBS containing 1% BSA and 5% goat serum, and 1% DMSO is added to the AQP1 primary antibody dilution solution. The primary antibody dilution is added according to the antibody instructions, and incubation is usually performed overnight at 4°C. Wash three times with PBS. The secondary antibody is diluted in PBS containing 1% BSA and 5% goat serum, usually at a 1:1000 ratio. Incubate at 37°C for 1 hour. After secondary antibody incubation, the staining can be preliminarily observed under a fluorescence microscope to determine subsequent steps. After washing the cells three times with PBST, mount the slides. If the mounting medium contains DAPI, DAPI staining is not required beforehand; if the mounting medium does not contain DAPI, DAPI staining should be performed before mounting. Prepare the slides, clean them with 75% alcohol, add an appropriate amount of anti-quenching agent, use forceps to transfer the cell smears to the slides, mount with nail polish, and observe the staining effect under a microscope and take photographs after the nail polish has solidified.

[0104] II. Experimental Results

[0105] 1. Preparation and culture of primary embryonic fibroblasts

[0106] To facilitate tracking the transdifferentiation of MEF into renal tubular epithelial cells, we used two transgenic mouse strains in our experiments: the mTmG reporter gene strain, which has loxP sites flanking TdTomato(mT) and expresses strong red fluorescence in all tissues and cell types. When crossed with mice expressing Cre recombinase, the offspring exhibit knockout of the mT cassette in Cre-expressing tissues, expressing downstream membrane-localized EGFP(mG). The other strain, the Ksp-Cre tool mouse (Cdh16-Cre), expresses Cre via the Cdh16 promoter. Cre is expressed in developing renal epithelial cells and renal tubular epithelial cells of adult mice. Figure 1 (A, B) Two-month-old Ksp-Cre mice were mated with mTmG mice. Two female mice and one male mouse were placed together in a cage in the evening. The mice were checked the next morning. Female mice without plugs were removed and placed together again in the evening. Mice with plugs were kept separately, clearly labeled with their strain, and the time of cage mating and plug appearance were recorded. Pregnant mice at 12.5 to 14 days of gestation were used to extract mouse embryonic fibroblasts. The pregnant mice to be tested were removed, euthanized by cervical dislocation, and immersed in 75% alcohol. Then, in a laminar flow hood, the skin of the pregnant mice was cut open with scissors and forceps. Another set of scissors and forceps was used to cut open the abdominal muscle layer to expose the uterus. Finally, a third set of scissors and forceps was used to carefully remove the uterus and place it in a petri dish containing PBS to rinse away blood. Carefully remove the outer cell membrane of the embryo using two curved forceps, remove the head and internal organs, and mince the tissue with scissors. Add 1 mL of 0.05% trypsin and transfer the tissue to a 15 mL centrifuge tube. Digest in a 37°C water bath, mixing every 5 minutes. After about 15 minutes of digestion, stop digestion by adding DMEM medium containing 10% FBS. Seed the completely digested primary embryonic fibroblasts into culture flasks for subsequent experiments. Figure 2 ).

[0107] 2. Construction of four-factor reverse transcription packaging plasmids

[0108] Primers were designed using a homologous recombination kit (Nanjing Novizan Biotechnology Co., Ltd.) according to the kit requirements. The primers contained approximately 20 bp homologous arms and a 20 bp target fragment sequence. The GC content of the homologous arms significantly affects the efficiency of homologous recombination; a GC content between 40% and 60% yields better recombination results. KOD Plus Neo and KOD FX were typically used for PCR amplification of the target fragment. When primers were long, the annealing temperature was usually set to 68 degrees Celsius. The target gene fragment containing Hnf1β, Hnf4α, Pax8, and Emx2 was amplified using a PCR instrument. cDNA was obtained by reverse transcription. The cDNA fragment carrying the murine Hnf1β, Hnf4α, Pax8, and Emx2 genes was constructed into a retroviral pMX vector to obtain a retroviral plasmid.

[0109] Amplification primers:

[0110] Hnf1β Forward (SEQ ID NO.1):

[0111] TAGTTAATTAAGGATCTACCGCCACCATGGTGTCCAAGCTCACG

[0112] Hnf1β Reverse (SEQ ID NO.2):

[0113] TGTGCTGGCGGCCGCTCGAGTCACCAGGCTTGCAGTGGACACTG

[0114] Emx2 Forward (SEQ ID NO.3):

[0115] TAGTTAATTAAGGATCTACCGCCACCATGTTTCAGCCGGCGCCCAAG

[0116] Emx2 Reverse (SEQ ID NO.4):

[0117] TGTGCTGGCGGCCGCTCGAGTTAATCGTCTGAGGTCAC

[0118] Hnf4α Forward (SEQ ID NO.5):

[0119] TAGTTAATTAAGGATCTACCGCCACCATGCGACTCTCTAAAACCCTTG

[0120] Hnf4α Reverse (SEQ ID NO.6):

[0121] TGTGCTGGCGGCCGCTCGAGTTAATCGTCTGAGCTAGATGGCTTCTTGCTTGGTG

[0122] Pax8 Forward (SEQ ID NO.7):

[0123] TAGTTAATTAAGGATCTACCGCCACCATGCCTCACAACTCGATCAG

[0124] Pax8 Reverse (SEQ ID NO.8):

[0125] TGTGCTGGCGGCCGCTCGAGCTACAGATGGTCAAAGGCTG

[0126] Hnf1β-P2A-Forward(SEQ ID NO.9):

[0127] CAGTGTCCCACTGCAAGCCTGGGCAACAAACTTCTCTCTGCTGAAACAAGCCGGAGATGTCGAAGAGAATCCTGGACCGGCGGCCGCCAGCACAGTGGT

[0128] Hnf1β-P2A-Reverse(SEQ ID NO.10):

[0129] ACCACTGTGCTGGCGGCCGCCGGTCCAGGATTCTCTTCGACATCTCCGGCTTGTTTCAGCAGAGAGAAGTTTGTTGCCCAGGCTTGCAGTGGACACTG

[0130] Hnf4α-P2A-Forward(SEQ ID NO.11):

[0131] CGATCACCAAGCAAGAAGCCATCGCAACAAACTTCTCTCTGCTGAAACAAGCCGGAGATGTCGAAGAGAATCCTGGACCGGCGGCCGCCAGCACAGTGGT

[0132] Hnf4α-P2A-Reverse(SEQ ID NO.12):

[0133] ACCACTGTGCTGCGGCCGCCGGTCCAGGATTCTCTTCGACATCTCCGGCTTGTTTCAGCAGAGAGAAGTTTGTTGCGATGGCTTCTTGCTTGGTGATCG

[0134] Emx2-P2A-Forward(SEQ ID NO.13):

[0135] TAGATGTGACCTCAGACGATGCAACAAACTTCTCTCTGCTGAAACAAGCCGGAGATGTCGAAGAGAATCCTGGACCGGCGGCCGCCAGCACAGTGGT

[0136] Emx2-P2A-Reverse(SEQ ID NO.14):

[0137] ACCACTGTGCTGGCGGCCGCCGGTCCAGGATTCTCTTCGACATCTCCGGCTTGTTTCAGCAGAGAGAAGTTTGTTGCATCGTCTGAGGTCACATCTA

[0138] P2A-Emx2-Forward(SEQ ID NO.15):

[0139] TGTGCTGGCGGCCGCTCGAGTTAATCGTCTGAGGTCAC

[0140] P2A-Emx2-Reverse(SEQ ID NO.4):

[0141] TGTGCTGGCGGCCGCTCGAGTTAATCGTCTGAGGTCAC

[0142] P2A-Pax8-Forward(SEQ ID NO.16):

[0143] GTCGAAGAGAATCCTGGACCGATGCCTCACAACTCGATCAG

[0144] P2A-Pax8-Reverse(SEQ ID NO.8):

[0145] TGTGCTGGCGGCCGCTCGAGCTACAGATGGTCAAAGGCTG

[0146] P2A-Hnf4α-Forward(SEQ ID NO.17):

[0147] GTCGAAGAGAATCCTGGACCGATGCGACTCTCTAAAACCCTTG

[0148] P2A-Hnf4α-Reverse(SEQ ID NO.6):

[0149] TGTGCTGGCGGCCGCTCGAGTTAATCGTCTGAGCTAGATGGCTTCTTGCTTGGTG

[0150] We use the Promega DNA Recovery Kit, which is suitable for both direct PCR product recovery and agarose gel extraction, offering high recovery efficiency. Generally, if the amplified PCR product is specific, it can be directly recovered. Then, steps such as recombination, transformation, plating, colony PCR identification, culture, plasmid extraction, plasmid sequencing, and plasmid expression detection are performed.

[0151] To improve reprogramming efficiency, we constructed three bicistronic retroviral vector prototypes isolated from the 2A polypeptide cleavage site (P2A) within the retroviral backbone plasmid pMXs. A dual antibiotic selection strategy using puromycin and plasticin was implemented in these prototypes. After obtaining cDNA fragments of four transcription factors via PCR, they were ligated into the bicistronic vector prototypes using homologous recombination. We obtained: Emx2-P2A-Pax8-Blasticin (EP-BSD), Hnf4α-P2A-Pax8-Blasticin (EP-BSD), and others. We selected three types of BSD bicistronic vectors: x8-Blasticin (H4P-BSD), Hnf4α-P2A-Emx2-Blasticin (H4E-BSD), and three types of BSD bicistronic vectors: Hnf1β-P2A-Emx2-Puromycin (H1E-Puro), Hnf1β-P2A-Hnf4α-Puromycin (H1H4-Puro), and Hnf1β-P2A-Pax8-Puromycin (H1P-Puro). We then combined these three previously successfully constructed bicistronic vectors to create three 4-factor reprogramming combinations: H1E-Puro+H4P-BSD (H1EH4P), H1H4-Puro+EP-BSD (H1H4EP), and H1E-Puro+H4E-BSD (H1PH4E). Figure 3 ).

[0152] 3. Retroviral packaging

[0153] We used early-generation PlateE cells to package retroviruses. PlateE cells were seeded in 10cm dishes and, after reaching a suitable cell density (50-60%), transfected using Lipofiter transfection reagent from Hanheng Biotechnology. The ratio of transfection reagent to plasmid was 1:2. The transfection reagent was mixed with Opti-MEM and incubated for 5 min. The plasmid was then mixed with Opti-MEM, and the transfection reagent and plasmid were combined, gently mixed, and incubated at room temperature for 20 min before being added to the cells. 6-8 h post-transfection, the culture medium was replaced with fresh medium containing 1% BSA and 1x HEPS. 10 ml of culture medium was added to a 10cm diameter culture dish. Cells were observed, and 48 h post-transfection, the supernatant was collected; virus particles were released into the supernatant. The supernatant was transferred to a 15ml centrifuge tube, centrifuged at 1000 rpm for 5 min at room temperature, and filtered using a 0.45μm filter. The filtrate was transferred to a new centrifuge tube, and 4x PEG8000 virus concentrate was added. After mixing, place in a 4°C refrigerator and let stand overnight. Take 200 μL of viral supernatant for titer determination. Centrifuge the virus using a horizontal rotor at 1500g for 30 min at 4°C, and discard the supernatant. Figure 2 ).

[0154] To investigate the process and mechanism of MEF transdifferentiation into renal tubular epithelial cells in vitro and to further improve the reprogramming efficiency of renal tubular epithelial cells, we first constructed expression plasmids for single transcription factors, namely Hnf1b, Emx2, Hnf4a, and Pax8, to establish a renal tubular epithelial cell reprogramming experimental system. To effectively overexpress reprogramming factors in MEF, we used viral infection for overexpression. We constructed the reprogramming factors into retroviral expression plasmids, packaged the virus, and then infected MEF. Western blot results showed that all four transcription factors were expressed normally. Figure 4 A).

[0155] Since viral titer and dosage have a significant impact on transdifferentiation experiments, we used GFP virus to observe its infection efficiency in MEF cells, serving as a reference for the transdifferentiation factor virus. After preparing the GFP virus, we infected MEF cells for 72 hours. First, we observed GFP expression in the cells under a fluorescence microscope. Then, we used flow cytometry to detect the percentage of GFP-positive cells in the MEF cells. The results showed that our prepared virus, at a dosage of 5 μL, achieved an infection efficiency of over 90% in MEF cells. Figure 4 B). Preliminary results confirm that the virus we prepared achieves high infection efficiency at low dosages and can be used for cell reprogramming experiments. We also found that co-transfection of MEF cells with expression plasmids of four single transcription factors induced GFP expression, but the fluorescence intensity and proportion were low. Figure 5 AC).

[0156] 4. Inducing MEF transdifferentiation into renal tubular epithelial cells

[0157] MEF cells from headless and limb-removed Ksp-Cre;mTmG fetal mice aged E12.5 to E14 days were prepared for experiments. Cells were digested with trypsin and counted, then seeded in 4 x 10⁶ cells / well plates in 12-well plates. 4 MEF cells were cultured. After cell adhesion, reprogramming factor virus was added. 4 μg / ml Polybrene was added to the culture medium to promote viral transport into the cells. For bicistronic transdifferentiation experiments, approximately 12 μL of transcription factor virus was used. After 48 hours of viral infection, the culture medium was replaced with fresh medium. After 60-72 hours of viral infection, selection was performed using Puromycin and Blastidin S. Figure 2 During the first three days of screening, Puromycin was used at a concentration of 2 μg / ml, and Blastidin S at a concentration of 20 μg / ml. Subsequently, the concentrations of Puromycin and Blastidin S were reduced by half to maintain the culture. GFP expression in MEF cells was continuously observed to track the transdifferentiation of MEF cells into renal tubular epithelial cells.

[0158] To facilitate the tracking of MEF transdifferentiation into renal tubular epithelial cells, we used two transgenic mouse strains in our experiments: the mTmG reporter gene strain, which has loxP sites flanking TdTomato(mT) and expresses strong red fluorescence in all tissues and cell types. When crossed with mice expressing Cre recombinase, the offspring exhibit knockout of the mT cassette in Cre-expressing tissues, expressing downstream membrane-localized EGFP(mG). The other strain, the Ksp-Cre tool mouse (Cdh16Cre), expresses Cre via the Cdh16 promoter. Cre is expressed in developing renal epithelial cells and renal tubular epithelial cells of adult mice. Ksp-Cre mice were mated with mTmG mice, and embryonic fibroblasts were isolated from individual mouse embryos at approximately 13.5 days. After genotyping, Ksp-Cre and mTmG mouse embryonic fibroblasts were used for renal tubular epithelial cell reprogramming experiments. Figure 1 MEF cells were infected with a virus containing reprogramming factors and cultured for 1-2 weeks. In Cdh16-activated cells, Cre expression was activated, and the cells switched from expressing TdTomato to expressing EGFP. On one hand, GFP expression was observed using fluorescence microscopy to track the transdifferentiation of MEF cells into renal tubular epithelial cells. On the other hand, the transdifferentiation efficiency of MEF cells into renal tubular epithelial cells was quantified by detecting the percentage of GFP-positive cells using flow cytometry.

[0159] 5. The combination of four factors can effectively improve the reprogramming efficiency of renal tubular epithelial cells.

[0160] The simultaneous transduction of four transcription factors into MEF cells is complex and challenging, contributing to the low efficiency of MEF transdifferentiation into renal tubular epithelial cells. Based on this and previous experimental results, and referencing research on iPS reprogramming, cardiomyocyte and neural cell reprogramming, to improve the efficiency of in vitro MEF transdifferentiation into renal tubular epithelial cells, we constructed two transcription factors into the same expression plasmid via P2A linkage. Using Puromycin and Blastidin S antibiotics, we screened MEF cells transduced with all four transcription factors, thereby improving the reprogramming efficiency of renal tubular epithelial cells. Furthermore, using antibiotic screening for in vitro reprogramming of renal tubular epithelial cells eliminates the need for repeated viral infections, improving the stability of the experimental system. Different combinations of the four transcription factors may lead to varying expression levels of these factors in MEF, further affecting the reprogramming efficiency of renal tubular epithelial cells. Based on this, we constructed Hnf1b with Emx2, Hnf4a, and Pax8 in the same expression plasmid, while constructing the other two transcription factors in a separate expression vector, ultimately obtaining three combinations, named H1EH4P, H1H4EP, and H1PH4E. The schematic diagrams of these three combinations are shown below. Figure 3 As shown. Infecting MEF cells with these three viral combinations differs from three consecutive infections with a single mixture of four transcription factors. After a single infection with the new four-factor viral combination, Puromycin and blasticidin S were added to the culture medium three days later for selection. Two weeks after culture, observation under a fluorescence microscope showed that all three combinations induced GFP expression in some MEF cells. The percentage of GFP-positive cells differed among the three combinations, with H1EH4P showing the highest induction efficiency. Figure 6 ).

[0161] We used Western blot to detect the expression of four transcription factors in three combinations. Due to the P2A polypeptide linking to the preceding protein during P2A cleavage, the protein strip shifted upwards. The results showed that the expression levels of the four transcription factors differed among the three combinations. Specifically, the expression levels of Hnf1b and Pax8 in the H1EH4P combination were significantly higher than those in the H1PH4E combination. Figure 7 A, B). The differences in the expression levels of these four transcription factors are partly due to the fact that the size of the plasmid in different combinations directly affects the viral titer, ultimately influencing the protein expression level. We simultaneously collected MEF samples induced for transdifferentiation at 10 and 15 days and detected the expression of the four transcription factors by qPCR. The results showed that the Hnf1b and Emx2 mRNA levels in the H1EH4P combination were significantly higher than in the other combinations, while the Hnf4a mRNA level was significantly lower than in the other two combinations. The Pax8 mRNA level did not differ significantly among the three combinations. Figure 7(C, D). Flow cytometry analysis showed that H1EH4P induced the highest transdifferentiation of MEF cells into renal tubular epithelial cells, consistent with observations under a fluorescence microscope. Furthermore, qPCR analysis revealed that Cdh16 mRNA expression was highest in the H1EH4P combination, consistent with its highest induction efficiency.

[0162] 6. The new four-factor combination can effectively improve the reprogramming efficiency of renal tubular epithelial cells.

[0163] Cultured cells were digested into a single-cell suspension. Cells cultured in well plates or culture dishes were first washed with PBS, then 0.05% trypsin was added and the plates were incubated for digestion. Induced renal tubular epithelial cells adhered more firmly than MEF cells, so digestion took approximately 3 minutes. To minimize cell loss during digestion, after 3 minutes of digestion, twice the volume of PBS was added, and the cells were gently detached from the bottom and transferred to 15 ml centrifuge tubes pre-filled with fresh culture medium. The tubes were centrifuged at 800 rpm for 3 minutes. After centrifugation, the supernatant was discarded, and the cells were resuspended in an appropriate volume of culture medium or FACS buffer (containing 5% PBS and 5 μm EDTA). The cells were then filtered through a 40 μm cell strainer. After staining with primary and secondary antibodies, the cells were ready for analysis. In our experiments, we used mice bred from Gt(ROSA)(ACTB-tdTomato,-EGFP)Luo / J(mTmG) transgenic mice and Cre strain mice (Ksp-Cre / +(B6.Cg-Tg(Cdh16-cre)91Igr / J) initiated by kidney epithelial cells. GFP-specifically labeled target cell populations were used for analysis; no staining was required before flow cytometry. Flow cytometry analysis was performed using the BD LSR Fortessa or FACSCanto II platform, and flow cytometry sorting was performed using FACSAria. We tracked the MEF transdifferentiation efficiency induced by the three combinations at weeks 2, 3, and 5. H1EH4P had an induction efficiency of 15.3% at week 2, 29.9% at week 3, and approximately 48% at week 5. H1H4EP had an induction efficiency of 10% at week 2, 16% at week 3, and approximately 31% at week 5. H1PH4E had an induction efficiency of 5% at week 2, 10% at week 3, and approximately 15% at week 5. Figure 8 These results indicate that the novel four-factor combination significantly improves the reprogramming efficiency of renal tubular epithelial cells (rhEH4P), with the H1EH4P combination showing the highest efficiency in promoting the transdifferentiation of MEF cells into rhEH4P cells. Furthermore, these results suggest that the novel four-factor combination synergistically promotes the reprogramming of rhEH4P cells.

[0164] 7. RNA-seq showed that the four factors can induce MEF to transdifferentiate into renal tubular epithelial cells.

[0165] To further confirm whether the exogenous expression of Hnf1b, Emx2, Hnf4a, and Pax8 in MEF cells in our experimental system leads to a change in MEF cell fate towards renal tubular epithelial cells, we infected MEF cells with H1EH4P and collected cell samples at induction days 0, 3, 9, and 13. The expression of kidney-related genes was detected by qPCR. Figure 9 (AC). With prolonged culture time, the expression levels of four transcription factors gradually increased. The expression of the epithelial cell marker gene E-cdherin was upregulated, while the expression of mesenchymal genes Snail1 and Snail2 was downregulated. This result indicates that overexpression of H1EH4P in MEF leads to decreased mesenchymal cell characteristics and upregulated epithelial cell characteristics. The expression of genes related to kidney development, such as Wnt4, Wnt9, Fgf8, Gdnf, Wt1, Ret, Tfcp2l1, and Lhx1, was upregulated. The expression of proteins related to kidney transport function, such as Slc23a, Slc6a1, Trpv4, Abcc2, and Lrp2, was also upregulated. Furthermore, qPCR detected an increase in Ppargc1a expression with prolonged culture time. Hnf1b and Hnf4a can directly regulate Ppargc1a. Additionally, there are existing reports on the involvement of Hnf1b, Hnf4a, and Pax8 in regulating cell metabolism. Kidney cells have a high metabolic rate, and metabolic changes may accompany renal tubular epithelial cell reprogramming.

[0166] We infected MEF cells with H1EH4P, H1H4EP, and H1PH4E. After culturing the cells for 12 days, we observed cells clearly expressing GFP under a fluorescence microscope. RNA was extracted and subjected to RNA-seq. Compared with MEF, the H1EH4P group showed upregulation of 2843 genes (2-fold or more) and downregulation of 1647 genes; the H1H4EP group showed upregulation of 2807 genes and downregulation of 1971 genes; and the H1PH4E group showed upregulation of 2150 genes and downregulation of 1661 genes. Figure 10 A). GO analysis was performed on the upregulated and downregulated genes of H1EH4P. The upregulated genes were enriched in pathways such as cell adhesion, ion transport, transmembrane transport, kidney development, cell junctions, fatty acid β-oxidation, and Notch signaling. Figure 10 B). Downregulated genes are enriched in those positively regulating cell migration, extracellular matrix composition, collagen fiber composition, positively regulating ERK1 and ERK2 pathways, and positively regulating the EMT pathway, etc. Figure 10C). Genes positively regulating the EMT pathway were downregulated in H1EH4P cells, including Pdpn, Loxl3, IL6, Snai1, Tgfb1i1, GLIPR-2, Mdk, and Bambi. Notch signaling pathway-related genes Dll1, Hes1, Hey1, Hey2, Jag1, Jag2, and Heyl were upregulated. The Notch signaling pathway plays a crucial role in kidney development. We used Western blot to detect ERK activation in cells. The results showed that at week 2, overexpression of renal tubular epithelial cell reprogramming factor 4 led to a relative decrease in ERK phosphorylation compared to MEF cells, with the decline weakening further by week 3. The ERK activation level initially decreased and then increased after inducing MEF transdifferentiation into renal tubular epithelial cells, suggesting that the ERK-related pathway is involved in renal tubular epithelial cell reprogramming. MEF cells, being interstitial cells, possess some cell migration ability; however, they lose their interstitial cell characteristics during the transformation into renal tubular epithelial cells. Compared to MEF, most genes were upregulated in H1EH4P, H1H4EP, and H1PH4E. These results indicate that exogenous expression of Hnf1b, Emx2, Hnf4a, and Pax8 in MEF can promote the transition of MEF cells to renal tubular epithelial cell fate.

[0167] 8. The efficiency of H1EP in inducing MEF transdifferentiation into renal tubular epithelial cells is similar to that of H1E and H4P.

[0168] To investigate whether removing one transcription factor could still transdifferentiate MEF cells into renal tubular epithelial cells, we conducted a study using three-factor combinations: Hnf1b combined with Emx2-P2A-Pax8 (H1EP), Hnf1b combined with Hnf4a-P2A-Pax8 (H1HP), Hnf4a combined with Emx2-P2A-Pax8 (H4EP), and Hnf1b combined with Hnf4a-P2A-Emx2 (H1H4E). Figure 11 A). Retroviruses were packaged and used to infect MEF cells. Transdifferentiation was observed using fluorescence microscopy, and transdifferentiation efficiency was quantified by flow cytometry. We found that MEF cells without Pax8 could not transdifferentiate into renal tubular epithelial cells. Removing Hnf1b resulted in a small number of MEF cells transdifferentiating into renal tubular epithelial cells. Removing Emx2, H1H4P induced significantly lower transdifferentiation efficiency of MEF cells into renal tubular epithelial cells compared to H1EH4P. Removing Hnf4a, H1EP did not decrease the transdifferentiation efficiency of MEF cells into renal tubular epithelial cells at week 2, with an induction efficiency of 27%, higher than the induction efficiency of H1EH4P at week 2. Figure 11B). The induction efficiency of H1EP was 28% in week 3 and approximately 36% in week 5. The induction efficiency of H1H4P was 10% in week 2, 12% in week 3, and approximately 20% in week 5. The induction efficiency of H4EP was 1% in week 2 and 2% in week 3. Figure 11 C). We detected the expression of four transcription factors using Western blot. In MEF, overexpression of H1EP resulted in the detection of endogenous HNF4a, which may explain why the transdifferentiation efficiency of H1EP did not decrease after the removal of exogenous Hnf4a. In the H4EP group, the removal of exogenous Hnf1b still resulted in the detection of a small amount of Hnf1b expression. Figure 11 (D, E). Simultaneously, qPCR detection showed that intracellular Hnf1b expression could still be detected at the transcriptional level even after the removal of exogenous Hnf1b. The regulated relationship between Hnf1b and Hnf4a has been reported in the literature, suggesting a possible mutual regulation between Hnf1b and Hnf4a during MEF transdifferentiation induction. These results indicate that exogenous Hnf4a is not essential for renal tubular epithelial cell reprogramming, and the efficiency of H1EP in inducing MEF transdifferentiation into renal tubular epithelial cells is similar to that of H1E and H4P. Furthermore, these results suggest that Hnf1b, Emx2, Hnf4a, and Pax8 play different roles in renal tubular epithelial cell reprogramming, with Pax8 and Hnf1b being particularly important.

[0169] 9. The induced renal tubular epithelial cells exhibit typical epithelial cell characteristics.

[0170] To further analyze whether the induced renal tubular epithelial cells possess renal tubular epithelial cell characteristics and gene expression, we sorted out renal tubular epithelial cells induced by H1EP, H1H4P, and H1EH4P, and analyzed them by morphological observation and transcriptome sequencing. Morphologically, the induced renal tubular epithelial cells exhibited a cobblestone morphology and possessed typical epithelial cell characteristics. Figure 12 A). Clonogenic assays showed that H1EP, H1H4P, and H1EH4P-induced renal tubular epithelial cells exhibited similar clonogenic capabilities, while MEF cells did not possess clonogenic capabilities. Figure 12 B, C).

[0171] We performed RNA-seq sequencing on renal tubular epithelial cells induced by H1EP, H1H4P, and H1EH4P, MEF cells, and primary renal tubular epithelial cells from 10-day-old mice. The sequencing results showed that, compared to MEF cells, the induced renal tubular epithelial cells were more similar to the primary renal tubular epithelial cells. Figure 13 A), in which epithelial cell marker genes, cell tight junction-related genes, and kidney-associated transporters are upregulated in induced renal tubular epithelial cells. Figure 13B). Compared with MEF cells, H1EP-induced renal tubular epithelial cells upregulated 2353 genes by 2-fold or more, and downregulated 1679 genes by 2-fold or more. Figure 13 C). For example Figure 13 As shown in the AC heatmap, compared with MEF, some genes upregulated in H1EP-induced renal tubular epithelial cells were also upregulated in H1H4P and H1EH4P-induced renal tubular epithelial cells. The horizontal axis represents renal tubular epithelial cells induced by different combinations, and the vertical axis represents gene names. The color intensity represents gene expression levels. Next, we reviewed the reported RNA-seq results of different segments of adult mouse kidney tissue. The genes upregulated in the induced renal tubular epithelial cells were expressed in all different segments of the mouse kidney. Figure 13 D shows the expression of marker genes from different segments of the renal tubule in H1EP-induced renal tubular epithelial cells. These results indicate that H1EP-induced renal tubular epithelial cells express renal tubular epithelial cell genes from different segments.

[0172] We detected significant increases in kidney development-related transcription factors such as Hnf1a, Pax2, Tfcp2l1, and kidney transport proteins Ggt1, Slc6a18, Slc17a1, Slc23a1, and Trpv4 in H1EP-induced renal tubular epithelial cells using qPCR. Figure 14 A), using primary renal tubular epithelial cells as a control, this result is consistent with RNA-seq results. We used Western blot and immunostaining to detect the expression of epithelial cell marker genes and kidney-related genes in induced renal tubular epithelial cells. Epithelial cell marker genes ZO-1, Epcam, E-cadherin, and the kidney gene Cdh16 were expressed and activated in induced renal tubular epithelial cells, while the interstitial cell marker gene Vimentin was not expressed in induced renal tubular epithelial cells. No epithelial cell marker genes were expressed in MEF (metastatic fibroblasts). Figure 14 (BF). The expression of epithelial cell marker genes and the kidney gene Cdh16 showed no significant differences in renal tubular epithelial cells induced by H1EP, H1H4P, and H1EH4P. These results indicate that renal tubular epithelial cells induced by H1EP, H1H4P, and H1EH4P possess typical epithelial cell characteristics and have similar gene expression profiles to primary renal tubular epithelial cells. Furthermore, differences still exist between renal tubular epithelial cells induced by H1EP, H1H4P, and H1EH4P.

[0173] 10. Hnf1b-induced expression of endogenous Hnf4a participates in H1EP-mediated renal tubular epithelial cell reprogramming.

[0174] H1EP was overexpressed in MEF, and endogenous Hnf4a expression was detected by both Western blot and qPCR. Figure 15 We hypothesized that overexpression of Hnf1b, Emx2, and Pax8 alone could regulate endogenous Hnf4a. In MEF cells, we overexpressed Hnf1b, Emx2, and Pax8, respectively. We then analyzed HNF4A expression using Western blot. Hnf1b induced an increase in HNF4A protein levels. Figure 16 A). To investigate whether Hnf1b regulates Hnf4a at the transcriptional level, we overexpressed Hnf1b in MEF. qPCR results showed that Hnf1b promoted the transcription of Hnf4a. Figure 16 B). Next, we added a flag tag to the N-terminus of Hnf1b and overexpressed H1EP in MEF cells. After culturing for 7 days, we collected the samples and performed ChIP experiments using the flag antibody. The ChIP-PCR results showed that Hnf1b could directly bind to the Hnf4a promoter region (B). Figure 16 (C, D) This is consistent with previous research reports. To further investigate whether Hnf1b functions as an Hnf4a transcriptional activator, we conducted a luciferase reporter gene experiment. The Hnf4a promoter containing the HNF1B binding site was cloned into a luciferase reporter gene plasmid and transfected into 293T cells. Compared with the empty vector plasmid, luciferase activity increased threefold; after the Hnf1b binding site was deleted, luciferase activity decreased by approximately 50%. Figure 16 These results indicate that Hnf1b can directly promote the transcription of Hnf4a. To further investigate whether Hnf1b-promoted activation of endogenous Hnf4a is involved in the H1EP-mediated MEF transdifferentiation process, we treated MEFs with an HNF4A inhibitor while simultaneously overexpressing H1EP. Transdifferentiation efficiency was assessed at 2 weeks. In the DMSO-treated group, the H1EP-induced transdifferentiation efficiency at week 2 was 26.4%, while under Hnf4a inhibitor treatment, the MEF transdifferentiation efficiency decreased to 15.6%. Figure 17 A). We detected the expression of four factors using Western blot. Compared with the control group, the HNF4a inhibitor significantly inhibited intracellular HNF4A expression, but had no significant effect on HNF1b, EMX2, and PAX8. Figure 17 B). These results indicate that Hnf1b activates endogenous Hnf4a in conjunction with H1EP to participate in the transdifferentiation of MEF into renal tubular epithelial cells.

[0175] 11. Induced renal tubular epithelial cells possess certain functions of renal tubular epithelial cells.

[0176] To further analyze whether the induced renal tubular epithelial cells possess similar cellular functions to in vivo renal tubular epithelial cells, we first treated the induced renal tubular epithelial cells with the nephrotoxic drug cisplatin. MEF cells showed a small amount of cell death after 18 hours of cisplatin treatment. However, H1EP and H1H4P-induced renal tubular epithelial cells showed a significantly increased number of cell deaths under cisplatin treatment. Figure 18 A). Furthermore, we tracked the effect of cisplatin treatment at different times on cell death. With prolonged culture time, the proportion of induced renal tubular epithelial cell death increased, and was significantly higher than in MEF cells (A). Figure 18 B). Cisplatin transport into cells is partially dependent on organic cation transporter 2 (OCT2). Cimetidine is a known inhibitor of OCT2. Under combined treatment with cimetidine and cisplatin, cisplatin-induced renal tubular epithelial cell death was significantly reduced. Figure 18 C). These results suggest that induced renal tubular epithelial cells can serve as a cell model for in vitro studies of nephrotoxic drugs. Adult wild-type mouse cadaver kidneys were washed 10 times with 10 U / mL heparinized PBS (Sangon Biotech), then digested in 1% SDS (Sangon Biotech) for three to five days until decellularization was observed, and cultured in 1% Triton X-100 for 24 hours. Subsequently, they were washed with penicillin / streptomycin and 100 μg / mL Primocin (Invivogen). Kidney samples were placed in centrifuge tubes and sent to an irradiation company for sterilization with a 3 kGry dose of Co60 irradiation. The kidneys were then injected with 10 kGry of PBS using a 25G needle. 6 iREC cells were implanted into an organ scaffold and subsequently cultured in DMEM medium for 14 days. To investigate whether induced renal tubular epithelial cells could autonomously form tubular structures under the provision of an extracellular scaffold, mouse kidneys were decellularized, retaining their extracellular matrix, and used as a kidney scaffold. Induced renal tubular epithelial cells were then injected into this scaffold. Figure 18 D), cultured for 2 weeks, and then subjected to immunostaining of sections. We used Epcam and GFP co-staining, and the results showed that H1EP, H1H4P, and H1EHP-induced renal tubular epithelial cells could form certain tubular structures and exhibited Epcam-positive cell characteristics. Figure 18 E). These results indicate that H1EP, H1H4P, and H1EHP-induced renal tubular epithelial cells possess certain renal tubular epithelial cell functions.

[0177] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited to the embodiments described. Those skilled in the art can make various equivalent modifications or substitutions without departing from the spirit of the present invention, and these equivalent modifications or substitutions are all included within the scope defined by the claims of this application.

Claims

1. A method for inducing fibroblasts to transdifferentiate into renal epithelial cells, characterized in that, Includes the following steps: S1. Construct reverse transcription packaging plasmids; The reverse transcription packaging plasmid carries three reprogramming factors, and the combination of these three reprogramming factors is as follows: Hnf1β-Puromycin + Emx2-P2A-Pax8-Blasticin, The method for constructing reverse transcription packaging plasmids includes the following steps: Bicistronic retroviral vector elements separated by the 2A polypeptide cleavage site P2A were constructed in the retroviral backbone plasmid pMXs. A dual antibiotic selection strategy of Puromycin and Blasticin was added to the elements. After obtaining the cDNA fragments of the transcription factors by PCR, they were ligated into the bicistronic vector elements by homologous recombination to obtain the Emx2-P2A-Pax8-Blasticin bicistronic vector element. The single-factor plasmid Hnf1β-Puromycin was constructed and combined with the Emx2-P2A-Pax8-Blasticin bicistronic vector element to establish a three-factor reprogramming combination, namely H1β-Puro+EP-BSD. S2, retroviral packaging; S3, after being packaged by retroviruses, infects fibroblasts and induces fibroblasts to transdifferentiate into renal epithelial cells.

2. The method for inducing fibroblast transdifferentiation into renal epithelial cells according to claim 1, characterized in that, The fibroblasts mentioned are mouse embryonic fibroblasts (MEFs) derived from 12.5 to 14-day-old embryos.

3. The method for inducing fibroblast transdifferentiation into renal epithelial cells according to claim 2, characterized in that, The method for preparing mouse embryonic fibroblasts is as follows: carefully remove the cell membrane outside the embryo, remove the head and internal organs, cut the tissue into small pieces with scissors, add 1 mL of 0.05% trypsin, transfer the tissue to a 15 mL centrifuge tube, digest in a 37°C water bath, mix every 5 min, and after digestion for 15 min, add DMEM medium containing 10% FBS to terminate digestion; then, seed the fully digested primary embryonic fibroblasts into a culture flask for culture.

4. The method for inducing fibroblasts to transdifferentiate into renal epithelial cells according to claim 1, characterized in that, Primers were designed using homologous recombination, and the primer sequences are shown in SEQ ID NO.1 to SEQ ID NO.

17. The target fragment was amplified by PCR using KOD Plus neo and KOD FX. A Promega DNA recovery kit was used. If the amplified PCR product was specific, it could be directly recovered. Then, the following steps were performed: recombination, transformation, plating, colony PCR identification, culture, plasmid extraction, plasmid sequencing, and plasmid expression detection.

5. The method for inducing fibroblast transdifferentiation into renal epithelial cells according to claim 1, characterized in that, The retroviral packaging method in step S2 includes the following steps: Plate PlateE cells were seeded into 10 cm dishes. After the cells reached a suitable density, they were transfected using the Lipofiter transfection reagent. The transfection reagent was mixed with Opti-MEM and allowed to stand for 5 min. The plasmid was mixed with Opti-MEM, and the transfection reagent and plasmid were then mixed gently and allowed to stand at room temperature for 20 min before being added to the cells. 6-8 h after transfection, the medium was replaced with fresh medium containing 1% BSA and 1×Hepes. The cells were observed. 48 h after transfection, the supernatant was collected, and the virus particles were released into the supernatant. The supernatant was transferred to a 15 mL centrifuge tube and centrifuged at 1000 rpm for 5 min at room temperature. The mixture was filtered using a 0.45 μm filter and transferred to a new centrifuge tube. 4×PEG8000 virus concentrate was added. The mixture was mixed and placed in a 4°C refrigerator overnight. 200 μL of the virus supernatant was used for titer determination. The virus was centrifuged horizontally at 1500g for 30 min at 4°C, and the supernatant was discarded.

6. The method for inducing fibroblast transdifferentiation into renal epithelial cells according to claim 1, characterized in that, The method for inducing fibroblast transdifferentiation into renal epithelial cells in step S3 includes the following steps: Embryonic fibroblasts from Ksp-Cre;mTmG mice aged E12.5 to E14 days were prepared for transdifferentiation experiments; cells were digested with trypsin and counted, and seeded in 12-well plates at 4 × 10⁶ cells / well. 4 Mouse embryonic fibroblasts were cultured; after cell adhesion, reprogramming factor virus was added; 4 μg / mL Polybrene was added to the culture medium to promote viral transport into the cells; when performing transdifferentiation experiments with bicistronic transcription factor virus, the amount of transcription factor virus was 12 μL; 48 h after viral infection of mouse embryonic fibroblasts, the culture medium was replaced with fresh medium; 60-72 h after viral infection, selection was performed using Puromycin and Blastidin S; during the first three days of selection, the concentration of Puromycin was 2 μg / ml and the concentration of Blastidin S was 20 μg / ml; subsequently, the concentrations of Puromycin and Blastidin S were reduced by half to maintain culture; the expression of GFP in mouse embryonic fibroblasts was continuously observed to track the transdifferentiation of mouse embryonic fibroblasts into renal tubular epithelial cells.

Citation Information

Patent Citations

  • CN105637092A

  • US20190071646A1