Application of HSP90 in regulating Seneca virus replication

Abstract

The present invention belongs to the field of molecular biology and veterinary medicine, and provides the use of HSP90 and its inhibitor in regulating the replication of Seneca virus. HSP90 inhibitor can be used to prepare a drug for inhibiting Seneca virus, and HSP90 and its encoding gene can be used to screen a drug for treating or preventing Seneca virus. HSP90 and its inhibitor provided by the present invention can regulate the replication process of Seneca virus, which is of great significance to the pathogenic mechanism and vaccine development of Seneca virus.

Description

Technical Field

[0001] The invention belongs to the fields of molecular biology and veterinary medicine, and specifically relates to the application of HSP90 in promoting the replication of Seneca virus. Background Art

[0002] Heat shock proteins (HSPs) were first discovered in the salivary glands of fruit flies and are widely present in cells. As intracellular chaperone molecules, they play a role in various biological activities such as protein folding, assembly, and proteasome degradation. According to their molecular weight and isoelectric point, they are divided into seven major families: HSP110, HSP90, HSP90, HSP60, HSP40, HSP27, and ubiquitin. HSPs are mainly composed of a highly conserved amino terminus (N-terminal region) and a variable carboxyl terminus (C-terminal region). The amino terminus is the binding site for ATP, and the carboxyl terminus can bind to unfolded polypeptides. When cells are exposed to pathogens, trauma or other stimuli, HSPs can maintain cell homeostasis, and at the same time play an important role in intracellular material transport, cell autophagy and apoptosis, and antigen presentation. HSPs are also important molecular chaperones that help protein folding and aggregation.

[0003] HSP90 is a dynamically changing homodimer with 5 different subtypes, of which HSP90α and β exist in the cytoplasm; and each monomer contains 3 highly conserved domains, namely the ATP binding domain; the middle domain, which contains the binding sites of substrate proteins and auxiliary molecular chaperones; and the dimerization domain, which has a conserved pentapeptide fragment. HSP90 is ATP-dependent and is mainly involved in regulating important physiological processes such as cell structural integrity, signal transduction, protein folding, mRNA stability, cell cycle progression, etc., to prevent irreversible polymerization and catalyze the refolding of its substrate in an ATP- and co-chaperone-dependent manner.

[0004] Senecavirus A (SVA), also known as Seneca Valley virus (SVV), can cause vesicular lesions on the muzzle, oral mucosa, and coracle of pigs, and its clinical symptoms are difficult to distinguish from those caused by other vesicular diseases. The virus belongs to the Picornaviridae family and the Senecavirus genus. SVA is currently the only member of the Senecavirus genus. The virus was first discovered as a contaminant of human embryonic retinal cells, and the first pigs infected with the virus were found in Canadian pig farms in 2007. The virus can cause vesicular lesions on the muzzle and coracle of pigs, and its clinical symptoms are difficult to distinguish from those caused by other vesicular diseases (such as foot-and-mouth disease and swine vesicular disease). In addition, SVA can cause temporary death of newborn piglets in epidemic conditions. At present, SVA infection has been reported in many countries around the world, such as the United States, Brazil, Thailand, etc. Seneca virus is a newly emerged virus that infects pigs and can cause death in piglets. The infection and replication of Seneca virus need to be regulated during basic virus research and vaccine development. However, there is currently no research on the relationship between SVA and host factors such as HSP90. Summary of the invention

[0005] In view of the lack of drugs for regulating Seneca virus replication, the present invention provides the use of HSP90 in promoting Seneca virus replication. HSP90 and HSP90 inhibitors can regulate the replication of Seneca virus in host cells and can be used in vaccine production.

[0006] To achieve the above purpose, the present invention adopts the following technical solution.

[0007] Application of HSP90 in enhancing Seneca virus replication in host cells.

[0008] The host cell is a hamster kidney cell BHK-21 cell.

[0009] Application of HSP90 inhibitor in the preparation of medicaments for inhibiting Seneca virus.

[0010] The HSP90 inhibitor is 17-AAG.

[0011] Application of HSP90 and its encoding gene in screening drugs for treating or preventing Seneca virus.

[0012] The application includes using HSP90 as a target to detect:

[0013] a) HSP90 protein activity, expression level, modification level or protein localization; or,

[0014] b) mRNA expression level, transcription or post-transcriptional modification level of HSP90 gene.

[0015] The present invention has the following advantages:

[0016] The HSP90 and the inhibitor thereof provided by the present invention can regulate the replication process of Seneca virus, and are of great significance to the pathogenic mechanism and vaccine development of Seneca virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Schematic diagram of the construction structure of the SVA subgenomic replicon rSVA-Rluc;

[0018] Figure 2 The expression of Rluc at different time points after rSVA-Rluc transfection into BHK-21 cells;

[0019] Figure 3 The effect of 17-AAG on the activity of BHK-21 cells;

[0020] Figure 4 The expression of Rluc after BHK-21 cells were pretreated with 17-AAG and transfected with rSVA-Rluc;

[0021] Figure 5 is the relative expression level of different SVA IRES domains after Hsp90 treatment;

[0022] Figure 6 is the expression level of Hsp90 after SVA infected BHK-21 cells;

[0023] Figure 7 The titers are those of SVA infected BHK-21 cells and BHK-21 cells overexpressing Hsp90;

[0024] Figure 8 is the expression level of viral capsid protein after SVA infected BHK-21 cells overexpressing Hsp90;

[0025] Figure 9 It is the Western blot of the Co-IP products of Hsp90 and each subunit of SVA protein;

[0026] Figure 10 Immunofluorescence images of Hsp90 and SVA protein subunits. DETAILED DESCRIPTION

[0027] The present invention is further described below in conjunction with embodiments and drawings, but the present invention is not limited by the following embodiments.

[0028] Example 1 Effect of Hsp90 on Seneca virus translation initiation activity

[0029] To explore the role of HSP90 in the translation of SVA virus proteins, the fusion PCR method was used to replace the coding gene of SVA structural protein P1 with the Rluc reporter gene, using the 2017 Shandong isolated strain SVA-CH-SDGT-2017 (Genbank No. MZ818785) as the backbone, retaining the SVA genome replication-related non-structural protein coding region as well as the 5′UTR and 3′UTR sequences, and constructing an SVA containing Rluc reporter gene ( Figure 1 ) subgenomic replicon rSVA-Rluc. After rSVA-Rluc was transfected into BHK-21 cells, the activity of Rluc was detected at different time points. The results are as follows Figure 2 As shown: The replicon RNA continuously expresses Rluc after transfection of BHK-21 cells, and the Rluc activity increases linearly 4-8h after transfection, reaches the highest point at 8h, and then slowly decreases. The results show that the constructed subgenomic replicon rSVA-Rluc can efficiently express Rluc, and the real-time detection of Rluc in the 4-8h period can reflect the dynamic changes of the replication and translation levels of the replicon.

[0030] In order to obtain evidence of whether Hsp90 affects the translation of viral proteins, the specific inhibitor of HSP90, 17-AAG, was selected to act on the constructed subgenomic replicon rSVA-Rluc, and the Rluc activity was detected to determine its effect on the activity of the internal ribosome entry site IRES of SVA. CCK-8 was used to detect the effect of the inhibitor 17-AAG on the activity of BHK-21 cells. Figure 3 It was shown that 10µM 17-AAG had no toxicity to BHK-21 cells.

[0031] BHK-21 cells were treated with 10µM as the highest concentration: BHK-21 cells were pretreated with 0µM, 0.5µM, 5µM, and 10µM 17-AAG 1 hour before transfection with the replicon; Rluc values ​​were detected 8 hours after transfection. Figure 4 As shown: 17-AAG can significantly inhibit the activity of SVA IRES, indicating that Hsp90 is involved in the translation process of SVA viral proteins.

[0032] The four domains (Domain I, II, III, and IV) of the internal ribosome entry site (IRES) of SVA were replaced to explore which domain of SVA IRES Hsp90 activity mainly affects the translation of viral proteins. The results showed that Hsp90 activity mainly affects the translation of viral proteins by interacting with Domain IV of SVA IRES ( Figure 5 a and 5b).

[0033] Example 2 Effect of Hsp90 on the replication of SVA in BHK-21 cells

[0034] Using actin protein as an internal reference, the expression of Hsp90 in BHK-21 cells was detected 0-24 hours after SVA infection. Figure 6 As shown in the figure, during the continuous viral infection, the expression of Hsp90 gradually increased, which indicates that Hsp90 is involved in the process of viral replication.

[0035] Subsequently, BHK-21 cells were pretreated with different concentrations of 17-AAG (0.5 μM, 10 μM), and then infected with SVA virus for 16 h, 20 h, and 24 h before the virus titer was detected. Figure 7 As shown in a: The virus titer decreased significantly. BHK-21 cells overexpressing Hsp90 were constructed, and the virus titer and viral capsid protein content of BHK-21 cells overexpressing Hsp90 were detected after SVA infection for 4-24 hours. The results are shown in Figure 7 b and Figure 8 As shown in the figure, after overexpression of Hsp90, the virus titer increased significantly and the expression of viral capsid protein also increased significantly. This indicates that after SVA enters the cell, its replication process requires the participation of Hsp90, and Hsp90 can promote the replication of SVA in the cell.

[0036] Example 3 Interaction between Hsp90 and Seneca virus protein

[0037] The RNA of SVA was extracted and reverse transcribed. The target gene was amplified with the primers in Table 1. The recombinant plasmids pEGFP-C1-Lpro, pEGFP-C1-VP1, pEGFP-C1-VP2, pEGFP-C1-VP3, pEGFP-C1-VP4, pEGFP-C1-2B, pEGFP-C1-2C, pEGFP-C1-3A, pEGFP-C1-3C, EGFP-C1-3D expressing each subunit of SVA protein were constructed with pEGFP-C1 as the backbone and co-transfected with Hsp90 plasmid into 293T cells, and the cells were collected after culturing for 48 h. Co-immunoprecipitation (Co-ip) detection was performed using anti-HA antibody, and the membrane was screened for co-immunoprecipitated proteins by immunoblot analysis.

[0038] Table 1 Primers for amplification of SVA protein subunits

[0039] Name Sequence 5'-3' VP1-U-GFP TCTCGAGCTCAAGCTTCGTCCACCGACAACGCCG VP1-L-GFP GCAGAATTCGAAGCTGTTATTGCATCAGCATCTTCTGC VP2-U-GFP TCTCGAGCTCAAGCTTCGGATCACAATACCGAAGAAATGG VP2-L-GFP GCAGAATTCGAAGCTGTTACTGTTCCTCGTCCGTCCC VP3-U-GFP TCTCGAGCTCAAGCTTCGGGGCCCATTCCCACAG VP3-L-GFP GCAGAATTCGAAGCTGTTAGTGGAACACGTAGGAAGG VP4-U-GFP TCTCGAGCTCAAGCTTCGGGTAATGTTCAGACAACC VP4-L-GFP GCAGAATTCGAAGCTGTTATTTGAGGTAGCCAAGAGGG Lpro-U-GFP TCTCGAGCTCAAGCTTCGATGCAGAACTCTCATTTTTCTT Lpro-L-GFP GCAGAATTCGAAGCTGTTACTGTAGTTCGTATACGATGTC 2B-U-GFP TCTCGAGCTCAAGCTTCGCCTGCTTCTGACAACC 2B-L-GFP GCAGAATTCGAAGCTGTTATTGCATCTTAAACAGCTTTCG 2C-U-GFP TCTCGAGCTCAAGCTTCGGGACCCATGGACACAG 2C-L-GFP GCAGAATTCGAAGCTGTTACTGTAGAACCAGAGTCTGC 3A-U-GFP TCTCGAGCTCAAGCTTCGAGCCCTAACGAGAACGACG 3A-L-GFP GCAGAATTCGAAGCTGTTACTCGCTCCTAGGCGC 3C-U-GFP TCTCGAGCTCAAGCTTCGCAGCCCAACGTGGACATGG 3C-L-GFP GCAGAATTCGAAGCTGTTATTGCATTGTAGCCAGAGG 3D-U-GFP TCTCGAGCTCAAGCTTCGGGACTGATGACTGAGC 3D-L-GFP GCAGAATTCGAAGCTGTCAGTCGAACGAGGCCC

[0040] The results are as follows Figure 9As shown, among the structural proteins: VP1-VP4 all interact with the heat shock protein Hsp90, and among the non-structural proteins 2B, 2C, and 3A interact with Hsp90.

[0041] Recombinant plasmids pEGFP-C1-Lpro, pEGFP-C1-VP1, pEGFP-C1-VP2, pEGFP-C1-VP3, pEGFP-C1-VP4, pEGFP-C1-2B, pEGFP-C1-2C, pEGFP-C1-3A, pEGFP-C1-3C, EGFP-C1-3D and Hsp90 were co-transfected into 293T cells, and then fluorescent antibody staining was used to observe protein colocalization.

[0042] The results are as follows Figure 10 As shown, Hsp90 is distributed in both the cytoplasm and the nucleus, and can overlap with the fluorescence images of each subunit protein of SVA, indicating that the two can be co-localized in the cytoplasm and the nucleus, confirming the interaction between SVA and Hsp90 proteins in mammalian cells.

Claims

1. Application of HSP90 in improving the replication of Seneca virus in host cells.

2. The use according to claim 1, characterized in that: The host cell is a hamster kidney cell BHK-21 cell.

3. The use of an HSP90 inhibitor in the preparation of a medicament for inhibiting Seneca virus, characterized in that: The HSP90 inhibitor is 17-AAG.

4. Use of HSP90 and its encoding gene in screening for drugs for treating or preventing Seneca virus, characterized in that: Using HSP90 and its encoding gene as targets, detection: a) HSP90 protein activity, expression level, modification level or protein localization; or, b) mRNA expression level, transcription or post-transcriptional modification level of HSP90 gene.

Images