A test strip for rapid detection of HPV antigen and antibody

Abstract

The present invention discloses a test strip for rapidly detecting HPV antigen and antibody. The test strip includes a sample pad, a colloidal gold labeling pad, a detection reaction area, and a water absorption pad arranged in sequence along the chromatography direction. The colloidal gold labeling pad contains an antibody-colloidal gold label against HPV L1 antigen. The detection reaction area is provided with a test line and a quality control line. The test line contains HPV L1 antigen, and the quality control line contains an antibody capable of binding to HPV antibody. The test strip of the present invention is convenient and fast to use, low in cost, suitable for home self-testing, rapid clinical diagnosis, and large-scale application at the scene of grass-roots epidemiological investigations.

Description

Technical Field

[0001] The present invention belongs to the field of immunoassay detection reagents, and relates to a test strip (card) that can be used for rapid detection of both HPV antigen and HPV antibody. Background Art

[0002] Cervical cancer is a common gynecological malignant tumor, ranking second in the incidence of female tumors. The number of new cases worldwide is approximately 470,000 per year, and it causes 300,000 deaths, making it an important cause of female death second only to breast cancer. The pathogenesis of cervical cancer is related to multiple factors, among which the infection of human papillomavirus (HPV) is the most important factor. It is reported that 99.8% of cervical cancers are associated with HPV infection, and almost no cervical cancers occur in HPV-negative individuals. Currently, there is no effective treatment for HPV infection. Preventing HPV infection and regularly detecting infected people are the main ways to reduce the incidence of cervical cancer.

[0003] HPV belongs to the Papillomaviridae family and is a double-stranded closed circular DNA virus that infects mucous membranes and skin. So far, more than 120 types of HPV have been reported, among which more than 40 are related to human genital tract infections. According to their carcinogenicity, they are divided into high-risk (carcinogenic) HPV, potentially carcinogenic, and low-risk HPV. Among high-risk HPV, HPV16, HPV18, HPV31, and HPV33 have the closest relationship with the occurrence of cervical cancer. The detection rate of HPV16 and HPV18 in cervical cancer is more than 70%. HPV16 is mostly found in cervical squamous cell carcinoma, while HPV18 is mostly found in cervical adenocarcinoma; low-risk HPV is mostly found in benign lesions such as condyloma acuminata.

[0004] The detection of HPV mostly focuses on histopathology or DNA detection of the HPV virus. These methods have limitations such as long time consumption, the need for professional technicians and equipment, complex operation procedures, high costs, and difficulty in promotion. It has been reported in the literature that monoclonal and polyclonal antibodies against the HPV16E6 protein are used to prepare colloidal gold diagnostic test strips (Hu Renjian. Development of an immunochromatographic test strip for high-risk human papillomavirus type 16. Chongqing University of Technology, 2009), that is, murine anti-HPV16E6 monoclonal antibody is used as the gold-labeled antibody and coated on the conjugate pad of the test strip, and rabbit anti-HPV16E6 polyclonal antibody is coated on the test line. However, both of these antibodies use HPV16E6 as the antigen, and the antigen-antibody binding site is the same antigenic determinant. Therefore, the binding ability of the sample HPV antigen combined with the gold-labeled antibody to the rabbit anti-HPV16E6 polyclonal antibody on the test line is limited, which limits the detection sensitivity of the test strip. The test strip (card) for rapid detection of HPV antibodies by the double antibody sandwich method in Chinese Patent CN108761091A uses the major capsid protein of HPV, that is, HPV L1 as the antigen, and also uses anti-human IgG antibody as the antigen, thus realizing the sensitive and accurate detection of HPV L1 IgG antibody in the sample. Although both HPV antigen and HPV antibody in blood or serum are markers for in vitro diagnosis of HPV virus infection, this test strip (card) cannot detect the HPV antigen in cervical cells. Therefore, there is an urgent need to propose a rapid detection test strip for high-risk HPV viruses with the advantages of convenience, low cost, simplicity, reliability, easy observation and differentiation, suitability for home self-examination, and easy promotion.

[0005] At present, there is no report on test strips for rapid detection of HPV virus (virus antigen and antibody) based on immunocompetition technology. Summary of the Invention

[0006] The purpose of the present invention is to provide a test strip for rapid detection of HPV antigen and antibody, which is convenient and fast to use, has accurate and reliable results, and has high detection efficiency for high-risk HPV viruses.

[0007] To achieve the above purpose, the present invention adopts the following technical solutions:

[0008] A test strip for detecting HPV antigen and HPV antibody, the test strip includes a sample pad, a colloidal gold labeling pad, a detection reaction area, and a water absorption pad arranged in sequence along the chromatographic direction, and the detection reaction area includes a test line and a quality control line; the colloidal gold labeling pad includes an antibody-colloidal gold label against HPV L1 antigen, the test line includes HPV L1 antigen, and the quality control line includes an antibody that can bind to HPV antibody (i.e., antibody against HPV L1 antigen).

[0009] Preferably, the detection reaction area further includes a nitrocellulose membrane, and the antibody that binds to HPV antibody and HPVL1 antigen are coated on the nitrocellulose membrane.

[0010] Preferably, the colloidal gold labeling pad further comprises a glass fiber membrane or a polyester membrane, and the antibody-colloidal gold label of the anti-HPV L1 antigen is dispersed and adsorbed on the glass fiber membrane or the polyester membrane.

[0011] Preferably, the HPV L1 antigen is derived from HPV16 or HPV18.

[0012] Preferably, the antibody against the HPV L1 antigen is one or more of polyclonal antibodies against the HPV L1 antigen from mouse, rabbit, sheep, horse, camel or guinea pig.

[0013] Preferably, the antibody that binds to the HPV antibody refers to an antibody that can form an immune complex by binding to the HPV antibody (i.e., the antibody against the HPV L1 antigen).

[0014] The preparation method of the test strip for detecting HPV antigen and HPV antibody includes the following steps:

[0015] Step 1: Preparation of the colloidal gold labeling pad

[0016] The antibody against the HPV L1 antigen is labeled with a colloidal gold solution to obtain a colloidal gold label (i.e., the antibody-colloidal gold label of the anti-HPV L1 antigen) solution; the colloidal gold label solution is coated on a glass fiber membrane or a polyester membrane and then dried for standby;

[0017] Step 2: Preparation of the detection reaction zone

[0018] The HPV L1 antigen solution and the solution of the antibody that can bind to the HPV antibody (i.e., the antibody against the HPV L1 antigen) are respectively coated on two different regions of a nitrocellulose membrane and then dried to obtain a test band and a quality control line for standby;

[0019] Step 3: Preparation of the sample pad

[0020] The glass fiber membrane or the polyester membrane is impregnated in a treatment solution containing a blocking agent and then dried for standby; or the glass fiber membrane or the polyester membrane is directly used without impregnation and drying; the sample pad obtained after being treated with the blocking agent can inhibit non-specific binding, thereby reducing the false positive rate of the test strip.

[0021] Step 4: The sample pad, the colloidal gold labeling pad, the detection reaction zone and the absorbent pad are sequentially installed on the bottom plate, and then cut according to the specifications of the test strip (such as a test strip or a test card).

[0022] Preferably, in the step 1, the preparation method of the colloidal gold marker solution specifically includes the following steps: adjusting the pH of 2-200 mL of colloidal gold solution (particle size 10-100 nm) to 5.5-7.0 with 0.03-0.3 M potassium carbonate solution, then mixing it with 50-100 μg of anti-HPV L1 antigen antibody, then reacting at 18-30 °C for 10-30 minutes, then adding BSA (bovine serum albumin) to the reaction system to a final concentration of 0.5%-1% (g / mL), then standing still for 5-10 minutes, then centrifuging at 2-25 °C and 1000-12000 rpm for 5-30 minutes and collecting the supernatant, centrifuging the supernatant at 2-25 °C and 5000-15000 rpm for 5-60 minutes and collecting the precipitate, and dissolving the precipitate in 0.5-5 mL of PBS (pH 6.0-7.5) containing 0.1%-10% (g / mL) BSA.

[0023] Preferably, in the step 1, the coating condition of the colloidal gold marker solution is: diluting the colloidal gold marker solution 1-2 times with PBS (pH 6.0-7.5) containing 0.1%-10% (g / mL) BSA and then spraying it at 40-80 μL / cm 2 on a glass fiber membrane or a polyester membrane; the drying condition is: at 35-40 °C for 18-24 hours.

[0024] Preferably, in the step 2, the concentrations of the HPV L1 antigen solution and the solution of the antibody that can bind to the HPV antibody are 0.5-4 mg / mL respectively, and the solvent is PBS (pH 6.0-7.5); the drying condition is: at 35-40 °C for 18-24 hours.

[0025] An HPV detection method, using the test strip prepared by the above steps to detect the sample to be tested, specifically includes the following steps:

[0026] Step 1 Sample treatment

[0027] Dilute the serum or plasma 1-100 times with a diluent (the diluent is water, 0.9% sodium chloride solution, phosphate buffer or borate buffer), and then take 50-150 μL and add it to the sample pad of the test strip (i.e., perform sample addition); or, take 2-200 μL of whole blood sample for sample addition and then immediately dilute it 1-100 times (i.e., add the required volume of sample addition buffer, such as phosphate buffer); or, place the sampled cervical epithelial swab in 0.5-2 mL of sample preservation solution (such as phosphate buffer) and mix well, and take 50-150 μL of the obtained cervical epithelial sample for sample addition;

[0028] The sampling condition of the serum is: take 1-5 mL of whole blood in a serum collection tube, stand still for 1-2 hours, centrifuge at 3000-5000 rpm for 10-30 minutes, and take the supernatant;

[0029] The sampling conditions for plasma are as follows: Take 1 - 5 mL of whole blood in a sodium citrate or sodium heparin anticoagulant tube, centrifuge at 1000 - 3000 rpm for 10 - 30 minutes, and take the supernatant;

[0030] In step 2, after adding the treated sample to the sample pad of the test strip, let the test strip stand for 5 - 20 minutes, and then observe the detection reaction area of the test strip;

[0031] Step 3 Result interpretation

[0032] Both the test band and the control line show color (the color of the test band is the same as or close to that of the control line, and both colors are relatively dark), and the result is negative (if it is a sample from blood source, it means negative for antibodies; if it is a sample from cervical epithelium source, it means negative for antigens); the test band does not show color or shows a lighter color (compared to the control line) while the control line shows color (relatively dark), and the result is positive (if it is a sample from blood source, it means positive for antibodies; if it is a sample from cervical epithelium source, it means positive for antigens); the control line does not show color, indicating that the test strip is invalid.

[0033] The beneficial effects of the present invention are as follows:

[0034] The present invention first applies a test strip based on the competitive method to the detection of HPV antibodies and HPV antigens in samples (samples from blood source and samples from cervical epithelium source). Moreover, this test strip is convenient, fast, and low - cost. By using only one test strip for detection, it can determine the situation of human infection with the corresponding HPV virus (virus antigen and antibody), providing a rapid auxiliary diagnosis for the screening and treatment of cervical cancer, and is suitable for home self - testing, rapid clinical diagnosis in hospitals and disease control departments, and large - scale application in epidemiological investigations at grass - roots health units.

[0035] Furthermore, the present invention uses the competitive method to detect the amount of gold - labeled antibody not bound by HPV antigen in the sample (cervical epithelial sample) through the interception (binding) of the test band, thereby reflecting the concentration of HPV antigen in the sample, avoiding the limitation of the detection sensitivity caused by the antigen - antibody binding reaction at the same binding site reported in the literature, and enabling the test strip to meet the requirements for the detection of HPV antigen and antibody in clinical diagnosis.

[0036] Furthermore, the HPV antigen used in the present invention is HPV L1 protein, which does not contain components for complete virus invasion and replication and is not pathogenic. Specific embodiments

[0037] The following further elaborates the present invention in conjunction with embodiments. The embodiments are only used to explain the present invention and do not limit the protection scope of the present invention.

[0038] (I) Preparation of HPV L1 antigen and antibody

[0039] 1.1 Preparation of HPV L1 antigen:

[0040] Using gene cloning technology, the full genes of HPV16 L1 and HPV18 L1 were respectively constructed into the pQE80L plasmid. The primers were as follows:

[0041] HPV16L1 forward primer - Sph1: CATGCATGCCAGGTGACTTTTATTTACATC

[0042] HPV16L1 reverse primer - Sac1: CGAGCTCCAGCTTACGTTTTTTGCGTTT

[0043] HPV18L1 forward primer - Sph1: CATGCATGCGCTTTGTGGCGGCCTAGT

[0044] HPV18L1 reverse primer - Sac1: CGAGCTCCTTTCTGGCACGTACACGC

[0045] Using the total DNA extracted from human cervical cancer cell lines (obtained from the China Center for Type Culture Collection) as a template, the target genes were amplified using the above primers. The constructed recombinant plasmids were respectively expressed in the prokaryotic expression system BL21 and purified by nickel column affinity chromatography to obtain HPV16 L1 protein and HPV18 L1 protein.

[0046] 1.2 Preparation of HPV L1 antibody:

[0047] Mix the HPV16 L1 protein or HPV18 L1 protein with a concentration of 0.5 - 2 mg / mL and Freund's adjuvant in a volume ratio of 1:1 and immunize BALB / c mice. The amount of HPV16 L1 protein or HPV18 L1 protein immunized per mouse is 100 μg. Strengthen the immunization twice at the same dose on the 14th and 28th days after the primary immunization. Collect the mouse serum on the 35th day after the primary immunization, and use rProteinG affinity purification to respectively prepare polyclonal antibodies against HPV16 L1 protein (i.e., antibodies against HPV16 L1 antigen) and polyclonal antibodies against HPV18 L1 protein (i.e., antibodies against HPV18 L1 antigen).

[0048] (2) Detection of HPV L1 antibody titer

[0049] (1) First, coat the ELISA 96 - well plate with 1 μg of HPV16 L1 protein and HPV18 L1 protein respectively, and incubate the coated plate overnight at 4°C.

[0050] (2) Wash each well 6 times with PBST washing buffer containing 0.05% Tween-20. Add 100 μL of blocking solution (PBST solution containing 5% skim milk powder) to each well and incubate for 2 hours.

[0051] (3) Add 100 μL of the corresponding HPV L1 antibody (antibody against HPV16 L1 antigen or antibody against HPV18 L1 antigen) sample diluted 200-fold with PBST solution to each well. React at 37 °C for 1 hour, then wash each well 4 times with PBST solution, 5 minutes each time.

[0052] (4) Add 100 μL of horseradish peroxidase-conjugated goat anti-mouse IgG antibody to each well. React at 37 °C for 1 hour, then wash each well 6 times with PBST solution to remove unbound enzyme-labeled antibody.

[0053] (5) Add 100 μL of TMB chromogenic solution to each well and perform the chromogenic reaction at room temperature for half an hour.

[0054] (6) Add 50 μL of reaction termination solution (2 M sulfuric acid solution) to each well to terminate the chromogenic reaction. Measure the absorbance at a wavelength of 450 nm with an enzyme-linked immunosorbent assay reader 5 minutes later and record the results.

[0055] The serum antibodies of 6 mice immunized according to the method described in (1) and one non-immunized negative control mouse were measured. Among them, the absorbances of the serum antibodies of 3 mice immunized with HPV16 L1 protein at a wavelength of 450 nm were 0.726, 1.258, and 0.915 respectively, and the absorbances of the serum antibodies of 3 mice immunized with HPV18 L1 protein at a wavelength of 450 nm were 0.612, 0.834, and 0.793 respectively, while the absorbance of the serum antibody of the negative control mouse was 0.049. It was thus judged that immunizing mice with HPV L1 protein could activate the immune system of the mice and produce specific antibodies against the corresponding HPV16 L1 protein and HPV18 L1 protein.

[0056] (III) Preparation of rapid test strip (card) for HPV antigen and antibody

[0057] (1) Preparation of colloidal gold: Prepare a 1% chloroauric acid (HAuCl4) solution. Take 1 mL of this chloroauric acid solution, add 99 mL of deionized water, mix well and heat to boiling. Immediately add 2 mL of 1% sodium citrate solution, stir rapidly and evenly, continue to heat for 10 minutes, cool to room temperature, and make up to 100 mL with deionized water to obtain a colloidal gold solution with an absorbance value greater than 0.7 (average particle size is 30 nm).

[0058] (2) Preparation of colloidal gold label: Take 10 mL of the prepared colloidal gold solution, adjust the pH value to 6.5 with 0.1 M potassium carbonate solution, add 50 μg of the antibody against HPV16 L1 antigen or the antibody against HPV18 L1 antigen, mix well, react at room temperature for 30 minutes, then add BSA to a final concentration of 0.5% (g / mL), mix well and let stand for 10 minutes, centrifuge at 2000 rpm for 20 minutes at 4°C, discard the precipitate, centrifuge the supernatant at 12000 rpm for 60 minutes at 4°C, discard the supernatant, and dissolve the precipitate in 1 mL of PBS (pH 6.5) solution (containing 0.2% BSA) to obtain the colloidal gold label solution.

[0059] (3) Preparation of gold conjugate pad: Dilute the colloidal gold label solution 1-fold with PBS (pH 6.5) solution (containing 0.2% BSA), and then spray (using a spraying instrument) the glass fiber membrane at a rate of 60 μL / cm 2 to make the colloidal gold label evenly spread on the glass fiber membrane, and then dry it at 37°C for 18 hours under a humidity of less than 30%. The dried gold conjugate pad is sealed with a foil bag (containing a desiccant) and stored at room temperature.

[0060] (4) Coating of test line and control line: Dilute the HPV L1 antigen (specifically HPV16 L1 protein or HPV18 L1 protein) with PBS (pH 6.5) solution to a concentration of 1 mg / mL, and draw a line (or spray it) on the NC membrane to immobilize the corresponding HPV L1 antigen (dry at 37°C for 18 hours) on the NC membrane as the test line T. At a distance of 6 mm from the test line T, draw another line (or spray it) with an antibody that can bind to the HPV antibody (goat anti-mouse antibody purchased from Hangzhou Xianzhi Biotechnology) diluted with 1 mg / mL (PBS solution at pH 6.5), and after immobilization (dry at 37°C for 18 hours), it serves as the control line C.

[0061] (5) Pretreatment of sample pad (blocking agent treatment)

[0062] Prepare another glass fiber membrane, impregnate it with a treatment solution containing 10% (v / v) rabbit serum (solvent is PBS at pH 6.5) at room temperature for 30 minutes, take it out and dry it at 37°C for 1 hour.

[0063] (6) Assembly of test strip (card)

[0064] The test strip consists of a sample pad, a gold conjugate pad, a nitrocellulose membrane (NC membrane), and a separately prepared absorbent pad (such as absorbent filter paper), which are connected in sequence. The upper section is the absorbent pad, the middle section is the detection reaction area on the nitrocellulose membrane (containing a test line T and a control line C), the gold conjugate pad adsorbed with colloidal gold markers is placed between the middle and lower sections; the lower section is the sample pad; the entire test strip is attached to the center of a PVC board and cut into a strip 4 mm wide to obtain the test strip, which is sealed and stored in a dry place for later use.

[0065] In addition, the test strip is placed into a housing composed of an upper plate and a lower plate. The sample pad part of the test strip faces the sample addition hole provided on the upper plate, and the detection reaction area part faces the detection window provided on the upper plate, thus obtaining the test card.

[0066] (IV) Sample processing, sample addition, and result interpretation procedures

[0067] Serum sample: Take 1 mL of whole blood in a serum collection tube, let it stand for 1 hour, centrifuge at 5000 rpm for 20 minutes, and take the supernatant. According to the detection accuracy of the test strip (card), dilute the serum sample 1 - 10 times with sample addition buffer (PBS solution with pH 6.5) or deionized water, then take 100 μL and drop it onto the sample pad part of the test strip (card), and observe the color development result of the detection reaction area part of the test strip (card) after standing for 10 minutes.

[0068] Plasma sample: Take 1 mL of whole blood in a sodium citrate or sodium heparin anticoagulant tube, centrifuge at 2000 rpm for 20 minutes, and take the supernatant. According to the detection accuracy of the test strip (card), dilute the plasma sample 1 - 10 times with sample addition buffer (PBS solution with pH 6.5) or deionized water, then take 100 μL and drop it onto the sample pad part of the test strip (card), and observe the color development result of the detection reaction area part of the test strip (card) after standing for 10 minutes.

[0069] Whole blood sample: Take about 50 μL of fresh blood from the fingertip or earlobe, drop it onto the sample pad part of the test strip (card), immediately add 50 μL of sample addition buffer (PBS buffer with pH 6.5) or deionized water to the sample pad for dilution, and observe the result after standing for 10 minutes.

[0070] Cervical epithelial sample: Hold a vaginal swab to collect cervical epithelial tissue, then put the vaginal swab into 1 mL of sample preservation solution (PBS solution with pH 6.5) or deionized water, mix well (1 - 2 minutes), drop 100 μL onto the sample pad part of the test strip (card), and observe the color development result of the detection reaction area part of the test strip (card) after standing for 10 minutes.

[0071] (V) Detection principle of the test strip (card)

[0072] 5.1 Principle of detecting HPV antigen

[0073] The sample to be detected (cervical epithelial sample) is loaded onto the sample pad. Subsequently, the HPV L1 antigen in the sample forms an immune complex with the colloidal gold label on the gold conjugate pad (the antibody against HPV16 L1 antigen or the antibody against HPV18 L1 antigen labeled with colloidal gold, simply referred to as the colloidal gold-labeled HPV L1 antibody). Due to capillary action, this immune complex continues to migrate towards the absorbent pad. Since the binding site of the colloidal gold-labeled HPV L1 antibody is occupied by the HPV L1 antigen in the sample, this immune complex cannot undergo an immune binding reaction with the corresponding HPV L1 antigen coated on the test line T, and the test line T does not show a purplish-red color or shows a lighter color. Due to capillary action, this immune complex continues to migrate forward and undergoes a specific immune reaction with the antibody that can bind to the HPV antibody coated on the control line C and is intercepted, gradually accumulating on the control line C to form a darker purplish-red band. The excess unbound substances continue to chromatograph onto the absorbent pad. Therefore, when a colored band appears only on the control line C, it is judged as a positive result for the HPV antigen in cervical cells; if the sample to be detected does not contain the HPV L1 antigen, the colloidal gold-labeled HPV L1 antibody undergoes an immune binding reaction with the HPV L1 antigen immobilized on the test line T, so a colored band appears on the test line T. The excess colloidal gold-labeled HPV L1 antibody on the gold conjugate pad continues to migrate forward and undergoes a specific immune reaction with the antibody that can bind to the HPV antibody coated on the control line C and is intercepted, gradually accumulating on the control line C to form a purplish-red band. Therefore, when colored bands appear on both the test line T and the control line C, it is judged as a negative result for the HPV antigen in cervical cells.

[0074] 5.2 Principle of detecting HPV antibody

[0075] The sample to be detected (serum, plasma or whole blood sample) is loaded onto the sample pad. Subsequently, the HPV L1 antibody in the sample forms a competitive relationship with the colloidal gold label on the gold conjugate pad (the antibody against HPV16 L1 antigen or the antibody against HPV18 L1 antigen labeled with colloidal gold, hereinafter referred to as the colloidal gold-labeled HPV L1 antibody). Due to capillary action, all the HPV L1 antibodies migrate towards the absorbent pad. The competing HPV L1 antibodies competitively bind to the corresponding HPV L1 antigen immobilized on the test line T. When the concentration of HPV L1 antibody in the sample is higher, its competitive advantage is more obvious. Then, the immunological reaction between the colloidal gold-labeled HPV L1 antibody on the gold conjugate pad and the corresponding HPV L1 antigen immobilized on the test line T is weaker, and the purple-red color development of the test line T is lighter. Due to capillary action, it continues to migrate forward. The colloidal gold-labeled HPV L1 antibody undergoes a specific immunological reaction with the antibody that can bind to the HPV L1 antibody coated on the control line C and is intercepted, gradually accumulating on the control line C to form a darker purple-red band. The excess unbound substances continue to chromatograph onto the absorbent pad. Therefore, when the test line T shows a light color or no color and a color band appears on the control line C, it is judged as a positive result for HPV antibody in the blood; if the sample to be tested does not contain HPV L1 antibody, the colloidal gold-labeled HPV L1 antibody on the gold conjugate pad undergoes a strong immunological reaction with the corresponding HPV L1 antigen immobilized on the test line T and is intercepted, and the purple-red color development of the test line T is obvious. Due to capillary action, it continues to migrate forward. The colloidal gold-labeled HPV L1 antibody undergoes a specific immunological reaction with the antibody that can bind to the HPV L1 antibody coated on the control line C and is intercepted, gradually accumulating on the control line C to form a darker purple-red band. Therefore, when color bands appear on both the test line T and the control line C, it is judged as a negative result for HPV antibody in the blood.

[0076] 5.3 Joint Interpretation of Antigen and Antibody

[0077] The test strip (card) of the present invention can detect both the HPV antigen in cervical cells and the HPV antibody in blood. That is, two important markers of human infection with the HPV virus can be detected on one test strip product, and the test results also have more detailed clinical guiding significance:

[0078] (1) For the same individual being tested, if both the HPV antigen in cervical cells and the HPV antibody in blood are positive, it indicates that the human body is infected with HPV and the body has produced corresponding antibodies;

[0079] (2) For the same individual being tested, if the HPV antigen in cervical cells is positive while the HPV antibody in blood is negative, it indicates that the human body is infected with HPV and the body has not yet produced corresponding antibodies;

[0080] (3) For the same individual being tested, if the HPV antigen in cervical cells is negative while the HPV antibody in the blood is positive, it indicates that the human body has been infected with HPV before, but the antibodies produced by the body have cleared the HPV.

[0081] (4) For the same individual being tested, if both the HPV antigen in cervical cells and the HPV antibody in the blood are negative, it indicates that the human body has not been infected with HPV either before or now, and the body does not have corresponding antibodies.

[0082] (6) False positive rate and false negative test experiments for HPV antibody detection

[0083] (1) Serum sample collection

[0084] Fifty healthy people under 15 years old and fifty people who have received the HPV vaccine; for each case, 1 mL of whole blood was taken into a serum collection tube, left to stand for 1 hour, centrifuged at 5000 g for 10 minutes, and the supernatant was taken to obtain the serum sample.

[0085] (2) False positive rate detection

[0086] Dilute 100 μL of the serum sample from healthy people under 15 years old with 100 μL of deionized water, take 100 μL and drop it on the sample pad part of the test strip (HPV16), leave it to stand for 10 minutes, and observe the test band T and the control line C; determine the situation of carrying the HPV antibody.

[0087] The determination rules are as follows:

[0088] Negative: If both the test band T and the control line C show purple-red bands, it is determined that the sample does not contain the HPV antibody;

[0089] Positive: If only the control line C shows a purple-red band (or the control line C shows a purple-red band while the test band T shows a lighter color), it is determined that the sample contains the HPV antibody;

[0090] Invalid: If the control line C does not show a purple-red band, then regardless of whether the test band T shows a purple-red band or not, the test strip is judged to be invalid;

[0091] The results show that 1 serum sample from healthy people under 15 years old is positive, 49 are negative, and all are valid. The results indicate that the false positive rate of the HPV antibody detection by the test strip is 2%.

[0092] (3) False negative rate detection

[0093] Dilute 100 μL of the serum sample from people who have received the HPV vaccine with 100 μL of deionized water, take 100 μL and drop it on the sample pad part of the test strip (HPV16), leave it to stand for 10 minutes, and observe the test band T and the control line C; determine the situation of carrying the HPV antibody.

[0094] The determination rules are as follows:

[0095] Negative: If both the test band T and the control line C show purplish red bands, it is determined that the sample does not contain HPV antibodies;

[0096] Positive: If only the control line C shows a purplish red band (or the control line C shows a purplish red band while the test band T shows a lighter color), it is determined that the sample contains HPV antibodies;

[0097] Invalid: If the control line C does not show a purplish red band, regardless of whether the test band T shows a purplish red band or not, the test strip is judged as invalid;

[0098] The results showed that 1 serum sample of those who had received the HPV vaccine was negative, 49 were positive, and all were valid. The results indicated that the false negative rate of the test strip for HPV antibody detection was 2%.

[0099] (7) False positive rate and false negative test experiments for HPV antigen detection

[0100] (1) Collection of cervical epithelial samples

[0101] For 50 healthy people under 15 years old and 50 patients with HPV type 16; for each case, hold a vaginal swab to collect cervical epithelial tissue (rotate 3 - 5 times) and then put it into 1 mL of sample preservation solution (PBS solution with pH 6.5), and mix well to obtain cervical epithelial samples.

[0102] (2) Detection of false positive rate

[0103] Drop 100 μL of cervical epithelial samples from healthy people under 15 years old onto the sample pad part of the test strip (HPV16), let it stand for 10 minutes, and observe the test band T and the control line C; determine the situation of carrying HPV antigen.

[0104] The judgment rules are as follows:

[0105] Negative: If both the test band T and the control line C show purplish red bands, it is determined that the sample does not contain HPV antigen;

[0106] Positive: If only the control line C shows a purplish red band (or the control line C shows a purplish red band while the test band T shows a lighter color), it is determined that the sample contains HPV antigen;

[0107] Invalid: If the control line C does not show a purplish red band, regardless of whether the test band T shows a purplish red band or not, the test strip is judged as invalid;

[0108] The results showed that 1 cervical epithelial sample from healthy people under 15 years old was positive, 49 were negative, and all were valid. The results indicated that the false positive rate of the test strip for HPV antigen detection was 2%.

[0109] (3) Detection of false negative rate

[0110] Drop 100 μL of the cervical epithelial sample from patients with HPV type 16 onto the sample pad part of the test strip (HPV16), let it stand for 10 minutes, and observe the test line T and the control line C; determine the situation of carrying the HPV antigen.

[0111] The determination rules are as follows:

[0112] Negative: If both the test line T and the control line C show purple-red bands, it is determined that the sample does not contain the HPV antigen;

[0113] Positive: If only the control line C shows a purple-red band (or the control line C shows a purple-red band while the test line T shows a lighter color), it is determined that the sample contains the HPV antigen;

[0114] Invalid: If the control line C does not show a purple-red band, regardless of whether the test line T shows a purple-red band or not, the test strip is judged to be invalid;

[0115] The results showed that 2 cervical epithelial samples from patients with HPV type 16 were negative and 48 were positive, and all were valid. The results indicated that the false negative rate of the HPV antigen detection by the test strip was 4%.

Claims

1. A test strip for detecting HPV antigen and HPV antibody, characterized in that: The test strip includes a sample pad, a colloidal gold labeled pad, a detection reaction area, and a water absorption pad that are sequentially arranged along the chromatography direction. The detection reaction area includes a test line and a quality control line. The colloidal gold labeled pad includes an antibody-colloidal gold label against the HPV L1 antigen. The test line includes the HPV L1 antigen, and the quality control line includes an antibody that binds to the HPV antibody. The colloidal gold labeling pad further includes a glass fiber membrane or a polyester membrane. The colloidal gold labeling solution obtained by labeling an antibody against HPV L1 antigen of 50-100 μg with colloidal gold solution is coated on the glass fiber membrane or the polyester membrane at 40-80 μL / cm 2 and dried, so that the antibody-colloidal gold label of the HPV L1 antigen is dispersed and adsorbed on the glass fiber membrane or the polyester membrane; The antibody against the HPV L1 antigen is one or more of polyclonal antibodies against the HPV L1 antigen from mouse, rabbit, sheep, horse, camel, or guinea pig sources.

2. The test strip for detecting HPV antigen and HPV antibody according to claim 1, wherein: The detection reaction area further includes a nitrocellulose membrane, and the antibody that binds to the HPV antibody and the HPV L1 antigen are respectively coated on the nitrocellulose membrane.

3. The test strip for detecting HPV antigen and HPV antibody according to claim 1, characterized in that: The HPV L1 antigen is derived from HPV16 or HPV18.

4. The test strip for detecting HPV antigen and HPV antibody according to claim 1, wherein: The antibody that binds to the HPV antibody refers to an antibody that can form an immune complex by binding to the HPV antibody.

5. A method for preparing a test strip for detecting HPV antigen and HPV antibody as described in claim 1, characterized in that: It includes the following steps: Step 1 Preparation of the colloidal gold labeled pad Use a colloidal gold solution to label the antibody against the HPV L1 antigen to obtain a colloidal gold labeled solution. Coat the colloidal gold labeled solution on a glass fiber membrane or a polyester membrane and then dry it. The coating conditions of the colloidal gold labeling solution are as follows: Dilute the colloidal gold labeling solution 1 to 2 times with PBS containing 0.1% to 10% BSA, and then spray it on the glass fiber membrane or polyester membrane at 40 to 80 μL / cm 2 ​ Step 2 Preparation of the detection reaction area Coat the HPV L1 antigen solution and the solution of the antibody that binds to the HPV antibody on two different areas of the nitrocellulose membrane respectively and then dry them to obtain a test line and a quality control line. Step 3 Preparation of the sample pad Immerse a glass fiber membrane or a polyester membrane in a treatment solution containing a blocking agent and then dry it; or directly use the glass fiber membrane or the polyester membrane without immersion and drying. Step 4 Install the sample pad, the colloidal gold labeled pad, the detection reaction area, and the water absorption pad on the bottom plate in sequence, and then cut according to the test strip specifications.

6. The preparation method according to claim 5, characterized in that: In the said Step 1, the preparation method of the colloidal gold labeled solution specifically includes the following steps: Adjust the pH of 2 - 200 mL of the colloidal gold solution to 5.5 - 7.0 with 0.03 - 0.3 M potassium carbonate solution, then mix it with 50 - 100 μg of the antibody against the HPV L1 antigen, then react at 18 - 30 °C for 10 - 30 minutes, then add BSA to the reaction system to a final concentration of 0.5% - 1%, then let it stand for 5 - 10 minutes, then centrifuge at 2 - 25 °C and 1000 - 12000 rpm for 5 - 30 minutes and collect the supernatant, centrifuge the supernatant at 2 - 25 °C and 5000 - 15000 rpm for 5 - 60 minutes and collect the precipitate, and dissolve the precipitate in 0.5 - 5 mL of PBS containing 0.1% - 10% BSA.

7. The preparation method according to claim 5, characterized in that: In the said Step 1, the drying conditions are: 18 - 24 hours at 35 - 40 °C.

8. The preparation method according to claim 5, characterized in that: In the said Step 2, the concentrations of the HPV L1 antigen solution and the solution of the antibody that binds to the HPV antibody are respectively 0.5 - 4 mg / mL, and the solvent is PBS; the drying conditions are: 18 - 24 hours at 35 - 40 °C.