Resistance of tomato plants to ToBRFV

Abstract

The present invention relates to a tomato plant comprising in its genome a QTL which confers improved resistance to the tomato brown wrinkle fruit virus relative to a corresponding plant lacking said QTL, wherein the QTL is introgressed from the berry tomato gene and is found on chromosome 9 within a chromosomal region defined by SNP TO-0201220 (SEQ ID NO.1) and a SNP with SEQ ID NO:101, or on chromosome 11 within a chromosomal region defined by markers with SEQ ID NOs:102 and 115. The QTL may be selected from those present in the genome of the plant of seed LVSTBRFVRES2NCIMB deposit number 43591. The QTL is preferably characterized by defined alleles of different SNPs on chromosome 9 or 11. The present invention also relates to parts and progeny of these plants having improved resistance, to use these plants to introgress improved resistance in another genetic background, and to different methods for obtaining tomato plants or seeds having enhanced foliage and / or fruit resistance to tomato brown wrinkle fruit virus.

Description

Technical Field

[0001] The present invention relates to resistance of tomato (Solanum lycopersicum) plants, also known as tomatoes (Lycopersicumesculentum), to tobacco mosaic virus Tomato brown wrinkled fruit virus (ToBRFV, formerly abbreviated TBRFV). More specifically, the present invention relates to tomato plants and fruits comprising genetic determinants that lead to resistance to Tomato brown wrinkled fruit virus. According to the present invention, resistance is provided by a DNA sequence or QTL, which is introgressed from the S. pimpinellifolium gene into the genome of the S. lycopersicum plant on chromosome 9 or 11. The introgressed QTL on chromosome 9 can be present in the genome of the tomato plant homozygously or heterozygously. The introgressed QTL on chromosome 11 is preferably present in the genome of the tomato plant homozygously. The present invention also relates to a marker associated with the DNA sequence, and the use of this marker to identify or select the DNA sequence or QTL, and to identify or select plants carrying such resistance. The invention also relates to the seeds and progeny of such plants and propagation materials for obtaining such plants, as well as different uses of these plants. Background Art

[0002] All cultivated and commercial forms of tomatoes belong to the species most commonly known as Lycopersicon esculentum Miller. The genus Lycopersicon is a relatively small genus in the extremely large and diverse Solanaceae family, which is thought to consist of about 90 genera, including peppers, tobacco, and eggplant. The genus Lycopersicon has been divided into two subgenera, the esculentum complex, which contains those species that can be easily hybridized with commercial tomatoes, and the peruvianum complex, which contains those species that are difficult to hybridize (Stevens, M. and Rick, CM 1986). Due to its value as a crop, L. esculentum has spread widely throughout the world. Even though the exact origin of the cultivated tomato is unclear, it seems to have come from the Americas, native to Ecuador, Peru, and the Galapagos Islands, and was first cultivated by the Aztecs and Incas in 700 AD. Mexico seems to have been the earliest place of domestication and source of introduction. It is assumed that the cherry tomato (L. esculentum var. cerasiforme) is the direct ancestor of the modern cultivated form.

[0003] Tomatoes are grown for their fruit and are widely used for fresh market or processed products. As a crop, tomatoes are grown commercially whenever environmental conditions allow for economically viable yields. Most fresh market tomatoes are hand-picked at the green ripe stage on the vine. Fresh market tomatoes are available year-round. Processing tomatoes are mostly mechanically harvested and used in a variety of forms such as canned tomatoes, tomato juice, tomato sauce, puree, tomato paste or even tomato sauce.

[0004] Tomatoes are generally a simple diploid species with twelve pairs of differentiated chromosomes. However, polyploid tomatoes are also part of this invention. Cultivated tomatoes are self-pollinating, almost completely self-pollinating. Tomato flowers are hermaphroditic. Commercial cultivars were originally open-pollinated. As heterosis has been identified in tomatoes, hybrids are replacing open-pollinated varieties due to their increasing popularity among farmers due to higher yields and more uniform plant characteristics. Due to their wide spread and high value, tomatoes have been intensively cultivated. This explains why there is such a wide range of tomato varieties today. Shapes range from small to large, and there are cherry, plum, pear, nubby, round and beefsteak types. Tomatoes can be grouped according to the time it takes for the plant to mature fruit for harvest, and generally speaking, cultivars are considered early, mid-ripening or late-ripening. Tomatoes can also be grouped according to the growth habit of the plant; grouped as determinate, semi-determinate or indeterminate. Determinate plants tend to produce foliage first, then flowers, which ripen into fruit if pollination is successful. All fruits tend to mature on the plant at about the same time. Indeterminate tomatoes start out with some foliage, then continue to produce foliage and flowers throughout the growing season. At any given time, these plants tend to have tomatoes at various stages of maturity. Semi-determinate tomatoes have a phenotype somewhere in between determinate and indeterminate, and they are typically determinate, except that they grow larger than determinate varieties. Recent developments in tomato breeding have resulted in a wider variety of fruit colors. In addition to the standard red ripening color, tomatoes can also be creamy white, lime green, pink, yellow, gold, orange, or purple.

[0005] Hybrid commercial tomato seeds can be produced by artificial pollination. Pollen from the male parent is harvested and applied manually to the stigma surface of the female inbred line. Flowers are covered before and after artificial pollination so that insects do not bring in foreign pollen and create a mixture or impurity. Flowers are marked to identify the pollinated fruit, from which seeds are harvested.

[0006] A variety of pathogens affect the productivity of tomato plants, including viruses, fungi, bacteria, nematodes and insects. Tomato is particularly susceptible to many viruses, so virus resistance is of great agricultural importance.

[0007] Tobacco mosaic virus is one of the most important plant viruses causing serious damage in agriculture, especially to vegetable and ornamental crops worldwide. Tobacco mosaic virus is easily spread mechanically, as well as via seeds. The general characteristics of tobacco mosaic virus are rod-shaped particles of about 300 nm encapsulating a single-stranded positive RNA genome encoding four proteins. In tomatoes, tobacco mosaic virus (TMV) and tomato mosaic virus (ToMV) are feared by growers worldwide, as they can severely damage crop production, for example through irregular ripening (yellow spots on the surface of the fruit and brown spots below the surface). However, plant breeders have identified multiple genes over the years, and resistant tomato varieties for TMV and / or ToMV now exist.

[0008] All modern indeterminate tomato varieties and many determinate tomato varieties developed over the past few decades do contain the Tm-2 gene or preferably a Tm-2 variant of the gene. 2 alleles, which made them immune to almost all tobacco mosaic virus species (ToMV and TMV) known to affect commercial tomatoes before 2014.

[0009] During 2014-2015, severe virus outbreaks affected tomato producing areas in the Middle East, such as Jordan and Israel. Most affected tomato varieties are considered to be resistant to TMV and / or ToMV, but are still severely affected and show typical TMV / ToMV-like symptoms: although the symptoms of branches and leaves are very similar to those of TMV / ToMV, the fruit symptoms are more frequent and severe than the common symptoms of such viruses with fruit lesions and deformations. The fruit quality is very poor and it is quite difficult to sell. Salem et al. (Arch. Virol. 161 (2), 503-506. 2015) extracted RNA from the fruits and leaves of symptomatic plants infected in Jordan and performed various tests, ultimately identifying a new species of tobacco mosaic virus, whose sequence corresponds to GenBank accession number KT383474 (SEQ ID NO: 112); Salem et al. proposed to name this Jordan virus: Tomato Brown Wrinkled Fruit Virus (formerly TBRFV, now ToBRFV). Comparison with other tobacco mosaic virus sequences showed that ToBRFV is indeed a tobacco mosaic virus, but not TMV or ToMV. Resistance to TMV and / or ToMV does not confer resistance to this new virus, ToBRFV.

[0010] Luria et al. (PLoS One. 2017; 12(1): e0170429) simultaneously isolated and sequenced the complete genome of the Israeli tobacco mosaic virus that infects tomatoes in Israel, corresponding to GenBank accession number KX619418 (SEQ ID NO: 113). As a result, they showed very high sequence identity (more than 99% sequence identity) between the Israeli virus and the Jordan virus and concluded that they were two different isolates of the tomato brown wrinkle fruit virus.

[0011] Recently, the virus has been detected in Europe, particularly in Sicily, Germany, the Netherlands and France, as well as in Mexico, so it is now considered a major global threat to tomato crops. The strains identified appear to be essentially Israeli strains, not Jordanian ones.

[0012] The identification of tomato plants showing resistance to Tomato Brown Ruffled Fruit Virus and the localization and identification of genetic determinants, hereinafter also referred to as QTLs (Quantitative Trait Loci) leading to resistance to Tomato Brown Ruffled Fruit Virus, was recently described in WO2018 / 219941, although tolerance is mentioned in this publication. Two QTLs, namely QTL1 and QTL2, were found on chromosomes 6 and 9, respectively, and when homozygous appeared in a tomato background, independently or in combination, conferred improved tolerance or resistance to the fruits of tomato plants infected or potentially infected with ToBRFV. A third QTL, QTL3, was found on chromosome 11 and, when homozygous appeared, it conferred improved tolerance or resistance to the leaves of tomato plants infected or potentially infected with ToBRFV.

[0013] Although these QTLs, alone or in combination, provide tolerance or resistance to ToBRFV, the inventors have now determined that in most cases they do not confer a high enough level of resistance on tomato plants such that a significant portion of the fruit is affected and cannot be marketed. Furthermore, these QTLs are described as conferring resistance when present in homozygous form. As long as QTL2 on chromosome 9 is present in the presence of a Tm-2 2 Genetically identical loci, in regions that are usually transmitted “en bloc” without recombination, therefore this QTL on chromosome 9 is not suitable for Tm-2 2 Gene binding.

[0014] WO2019 / 110130 and WO2019 / 110821 disclose the identification of 3 different QTLs on chromosomes 6, 11 and 12 that were introgressed from currant tomatoes and allegedly confer resistance or tolerance to ToBRFV. However, the QTL on chromosome 11 is described as being located between 2 markers that define a 55 Mb region corresponding to almost the entire sequence of chromosome 11. Without any more explicit description, this QTL on chromosome 11 cannot be used for genetic introgression.

[0015] WO2020 / 018783 discloses a genetic region on chromosome 11 of tomato, which contains a Stemphylium resistance allele from currant tomato and is also said to contain a related ToBRFV resistance allele. Since both alleles are associated with the same marker according to the disclosure of this document, it is not possible to introgress only ToBRFV resistance, especially in plants that are already resistant to Stemphylium but susceptible to ToBRFV.

[0016] Since tobacco mosaic virus is not easily controlled but rather genetically improved through identification and use in breeding of resistance genes, and since currently available resistance genes for control of TMV and / or ToMV are not useful against the new tomato brown wrinkled fruit virus damage, and the tolerance or resistance QTLs that have been identified are not always sufficiently effective, are not well characterized and cannot be used in conjunction with Tm-2 2 Combined, there is an urgent need to identify resistance to this new tobacco mosaic virus, as failure to do so will result in entire regions no longer being able to produce tomato crops. Summary of the invention

[0017] The inventors have identified resistance to ToBRFV in wild-type S. pimpinellifolium plants and have been able to introgress this resistance gene into S. lycopersicum plants, thereby obtaining tomato (S. lycopersicum) plants resistant to ToBRFV. The resistance of the present invention is conferred by a newly discovered sequence that is linked to an additive quantitative trait locus (QTL) and is transferable to different tomato genetic backgrounds.

[0018] The newly discovered QTLs confer resistance to Tomato Brown Rugose Fruit Virus (ToBRFV) essentially at the fruit level of virus-infected tomato plants, for the QTL on chromosome 9 at the leaf level of virus-infected tomato plants, and for the QTL on chromosome 11 essentially at the leaf level of infected plants.

[0019] Therefore, the present invention provides these introgressed sequences, also referred to herein as QTLs, which confer a ToBRFV resistance phenotype at the tomato leaf and / or fruit level in tomato plants infected with ToBRFV.

[0020] The present invention provides tomato plants showing resistance to ToBRFV, including commercial plants, strains and hybrids, and methods for producing or identifying tomato plants or populations (germplasm) showing resistance to ToBRFV. The present invention also discloses molecular genetic markers, especially single nucleotide polymorphisms (SNPs), which are linked to the QTLs responsible for ToBRFV resistance of the present invention. Plants obtained by methods and uses of these molecular markers are also provided.

[0021] Furthermore, the resistance can be easily transferred to different genetic backgrounds, ie into tomato varieties, and the invention also extends to different methods allowing the transfer or introgression of QTLs conferring a phenotype.

[0022] The present invention also provides various methods and uses of information associated with these SNPs associated with QTLs that confer ToBRFV resistance, in particular methods for identifying ToBRFV-resistant plants and methods for identifying further molecular markers associated with such resistance, as well as methods for improving tomato yield in an environment infected by ToBRFV and methods for protecting tomato fields from ToBRFV infection.

[0023] definition:

[0024] The term "resistance" is defined by the ISF (International Seed Federation) Vegetable and Ornamental Crops Section to describe plant responses to pests or pathogens, and abiotic stresses in the vegetable seed industry. Specifically, resistance refers to the ability of a plant variety to limit the growth and development of a specific pest or pathogen and / or the damage they cause, compared to susceptible plant varieties under similar environmental conditions and pest or pathogen pressure. Resistant varieties may show some disease symptoms or damage under severe pest or pathogen pressure. Two levels of resistance are defined:

[0025] Highly resistant (HR): Plants that highly restrict the growth and / or development of a specific pest and / or the damage it causes under normal pest pressure, compared to susceptible plants. However, these plants may show some symptoms or damage under severe pest pressure.

[0026] Intermediately Resistant (IR): Plants that highly restrict the growth and / or development of a specific pest and / or the damage it causes, but may show a wider range of symptoms or damage than highly resistant plants. When grown under similar environmental conditions and / or pest pressure, intermediately resistant plants will still show less severe symptoms or damage than susceptible plants.

[0027] The term tolerance is often used to describe the ability of plants to withstand abiotic stress without severe consequences for growth, appearance, and yield.

[0028] However, in the literature and patents, the term is also used to refer to the phenotype of a plant, in which at least some disease symptoms remain absent when the plant is exposed to an infectious dose of the virus, whereby systemic or local infection, viral propagation, and at least under certain culture conditions, at least the presence of viral genomic sequences in the plant cells and / or their genomic integration can be determined. Thus, tolerant plants are resistant to symptomatic manifestations but asymptomatic to virus carriers. Sometimes, viral sequences can be present or even propagated in plants without causing disease symptoms. It should be understood that tolerant plants, although infected by viruses, are generally able to at least moderately restrict the growth and development of the virus.

[0029] For this reason, tolerant plants according to this definition are best characterized as moderately resistant plants.

[0030] In the case of ToBRFV, leaf resistance or foliar resistance refers to a phenotype of a plant in which disease symptoms on leaves remain absent or less pronounced when the plant is exposed to an infectious dose of ToBRFV. However, disease symptoms on fruit may appear on infected plants.

[0031] In the case of ToBRFV, fruit resistance refers to the phenotype of a plant in which disease symptoms on the fruit remain absent or less pronounced when the plant is exposed to an infectious dose of ToBRFV. However, disease symptoms on the leaves may appear on infected plants.

[0032] Symptoms on leaves infected with ToBRFV usually include mosaic, deformed leaflets, and in many cases webbing. Symptoms on fruit infected with ToBRFV usually include the typical yellow lesions (discoloration) and deformed fruit. In many cases, there are also "chocolate spots" on the fruit.

[0033] Susceptibility: The inability of the plant to restrict the growth and development of a specific pest or pathogen; susceptible plants display deleterious symptoms associated with viral infection, i.e. foliage damage and fruit damage in the case of ToBRFV infection.

[0034] Tomato plants susceptible to TBRFV, such as the commercial variety Candela mentioned in the publication by Salem et al., 2015.

[0035] To date, i.e. prior to the present invention, all commercially available tomato varieties grown in ToBRFV-infected areas were susceptible to ToBRFV or did not have sufficient resistance for those plants carrying tolerance QTLs, such as the deposited seeds of HAZTBRFVRES1 mentioned in PCT application WO2018 / 219941.

[0036] Thus, the plants according to the invention have at least improved resistance or tolerance to ToBRFV relative to the variety Candela and more generally relative to any commercial tomato variety grown in ToBRFV-infected areas, including tolerant plants, and relative to HAZTBRFVRES1. The improved resistance relative to the plants corresponding to HAZTBRFVRES1 is demonstrated in Example 5 of the experimental part.

[0037] As used herein, the term "offspring" or "progeny" refers to any plant produced as progeny by asexual or sexual reproduction from one or more parent plants or their progeny. For example, progeny plants can be obtained by cloning or selfing of parent plants, or by crossing two parent plants, and include selfing and F1 or F2 or further generations. F1 is the first generation of offspring produced by parents, wherein at least one parent is the donor used as a trait for the first time, and the offspring of the second generation (F2) or subsequent generations (F3, F4, etc.) are samples produced from selfing, such as F1', F2', etc. Therefore, F1 can be (and usually is) a hybrid produced by crossing two true genetic parents (true genetics is homozygous for traits), and F2 can be (and usually is) an offspring produced by self-pollination of the F1 hybrid.

[0038] As used herein, the terms "hybridization," "hybridized," "cross-pollination," or "cross breeding" refer to the process of applying pollen from one flower on one plant (artificially or naturally) to the ovules (stigma) of a flower on another plant.

[0039] As used herein, the term "genetic determinant" and / or "QTL" refers to any DNA fragment associated with a biological function. Thus, QTL and / or genetic determinant include, but are not limited to, genes, coding sequences, and / or regulatory sequences required for their expression. QTL and / or genetic determinant may also include non-expressed DNA fragments, for example, recognition sequences that form other proteins.

[0040] As used herein, the term "genotype" refers to the genetic makeup of a single cell, cell culture, tissue, organism (eg, plant), or population of organisms.

[0041] As used herein, the term "grafting" is the operation of grafting a rootstock to a scion. The main motivation for grafting is to avoid damage caused by soil-borne pests and pathogens when genetic or chemical methods of disease management are not available. Grafting a susceptible scion onto a resistant rootstock can provide a resistant cultivar without breeding resistance into the cultivar. In addition, grafting can enhance tolerance to abiotic stresses, increase yields and lead to more efficient water and nutrient use.

[0042] As used herein, the term "heterozygous" refers to a diploid or polyploid individual cell or plant that has different alleles (forms of a given gene, genetic determinant, or sequence) present at least at one locus.

[0043] As used herein, the term "heterozygous" refers to the presence of different alleles (forms of a given gene, genetic determinant, or sequence) at a particular locus.

[0044] As used herein, "homologous chromosomes" or "homologs" (or homologs) refer to a set of one maternal chromosome and one paternal chromosome that pair with each other during meiosis. These copies have the same type of genes at the same locus and the same centromere position, but their sequences or alleles may be different.

[0045] As used herein, the term "homozygous" refers to an individual cell or plant that has the same alleles at one or more loci on all homologous chromosomes.

[0046] As used herein, the term "homozygous" refers to the presence of identical alleles at one or more loci in homologous chromosome segments.

[0047] As used herein, the term "hybrid" refers to any individual cell, tissue, or plant produced by a cross between parents that differ in one or more genes.

[0048] As used herein, the term "locus" (plural: "loci") refers to any genetically defined site, which can be a single position (nucleotide) or a chromosomal region. A locus can be a gene, a genetic determinant, a portion of a gene, or a DNA sequence, and can be occupied by different sequences. A site can also be defined by a SNP (single nucleotide polymorphism), multiple SNPs, or two flanking SNPs.

[0049] As used herein, the term "rhizome" is the lower part of the plant that is capable of receiving the scion in the grafting process.

[0050] As used herein, the term "scion" is the taller part of a plant that can be grafted onto a rhizome in a grafting process.

[0051] The present invention includes plants of different ploidy levels, primarily diploid plants, but also triploid plants, tetraploid plants, etc.

[0052] In the context of the present invention, DNA strands and alleles are designed as TOP according to the TOP / BOT designation method developed by Illumina:

[0053] (https: / / www.illumina.com / documents / products / technotes / technote_topbot.p df). DETAILED DESCRIPTION

[0054] The present inventors have identified QTLs which, when present alone or in combination in tomato plants, provide improved resistance in fruits and / or leaves of tomato plants infected or potentially infected with Tomato Brown Ruffle Fruit Virus (ToBRFV).

[0055] The inventors have identified a major QTL on chromosome 9, hereinafter referred to as QTL9, which, when present in a tomato background, confers resistance to ToBRFV infection, especially fruit resistance; and another additive QTL on chromosome 11, hereinafter referred to as QTL11, which also confers resistance to ToBRFV, especially leaf resistance, and can be combined with QTL9 defined above.

[0056] Seeds and plants according to the invention have been obtained from initial crosses between wild plants of S. cerevisiae (the introgression partner showing the desired phenotype but in another species) and tomato plants (the recurrent susceptible parent) in order to transfer the resistance into the tomato genetic background.

[0057] Seeds of resistant tomato plants derived from this initial cross homozygously contain QTL9 and QTL11 and are called LVSTBRFVRES2 and have been deposited by the inventors with NCIMB on April 1, 2020, with the deposit number NCIMB 43591. Plants grown from these deposited seeds are tomatoes (S. lycopersicum) that are resistant to ToBRFV, i.e., show at least improved fruit resistance to the virus relative to any known tomato plants, in particular any commercial tomato plants.

[0058] As shown in the examples, the phenotype of the plant according to the invention is best characterized as resistance to ToBRFV rather than tolerance, i.e. fruit resistance or foliage and fruit resistance, tolerance only being applicable to abiotic stress. Tolerance is also widely used to characterize resistance or moderate resistance, however, the plants of the invention may also be characterized as tolerant plants. In the following, reference is made to resistance to ToBRFV; however, this phenotype includes a tolerant phenotype, as defined in certain publications, as well as intermediate resistance.

[0059] In addition, as also demonstrated in the examples, in particular in Examples 4, 5 and 8, the ToBRFV resistance according to the present invention is different from the tolerance / resistance disclosed in the prior art. In fact, Example 5 demonstrates that the level of resistance according to the present invention is higher than the level of resistance described in WO2018 / 219941. In addition, Example 4 demonstrates that the sequences responsible for ToBRFV resistance according to the present invention and according to WO2018 / 219941 are different. Example 8 demonstrates that the ToBRFV resistance according to the present invention is not related to resistance to Stolonifera, contrary to the genetic determinants disclosed in WO2020 / 018783, and is therefore different from this resistance.

[0060] Therefore, according to a first aspect, the present invention relates to a tomato plant comprising in its genome a QTL on chromosome 9, hereinafter referred to as QTL9, and / or a QTL on chromosome 11, hereinafter referred to as QTL11, conferring improved resistance to ToBRFV in the event of infection, in particular at the fruit level for QTL9 and at the branch and leaf level for QTL11; as well as seeds and cells of such a tomato plant comprising QTL9 and / or QTL11 in their genome.

[0061] Said QTL conferring resistance was originally introgressed from wild currant tomato genes and is therefore hereinafter referred to as resistance QTL, or QTL9 or QTL11, or introgression sequences of the invention. The invention also relates to cells of such plants or seeds comprising these resistance conferring introgression sequences.

[0062] The tolerance / resistance phenotype can be tested and scored as described in the experimental part, in particular in Example 1, by natural infection or by artificial inoculation, either at the first leaf level or at the fruit level.

[0063] The QTL conferring improved resistance to ToBRFV is preferably located within the chromosomal interval or region defined by SNP TO-0201220 (SEQ ID NO. 1) and the SNP having SEQ ID NO. 101 on chromosome 9.

[0064] Indeed, the inventors have demonstrated in the Examples section that the introgressed sequence corresponding to QTL9 in this region is inherited along with the phenotype of interest.

[0065] According to the present invention and the QTL9 that confers improved resistance to ToBRFV is selected from the QTL9 present in the LVSTBRFVRES2 seed genome. Therefore, QTL9 is present in the genome of these deposited seeds. Samples of these tomato seeds have been deposited by HM.Clause SA (rue Louis Saillant, 26800 Portes-les-Valence, France), according to and meet the requirements of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for Patent Procedure ("Budapest Treaty"), and were deposited in the National Collection of Industrial, Food and Marine Microorganisms (NCIMB) (NCIMB, Ltd, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, UK) on April 1, 2020 with a deposit number of 43591. The deposit of this tomato seed is preserved by HM.Clause SA (rue Louis Saillant, 26800 Portes-les-Valence, France).

[0066] Other QTLs that confer improved resistance to ToBRFV according to the present invention are preferably located on chromosome 11, within the chromosomal interval or region defined by SNP TO-0201237 (SEQ ID NO: 102) and SL2.50ch11_9924232 (SEQ ID NO: 115), preferably within the chromosomal interval or region defined by SNP TO-0201237 (SEQ ID NO: 102) and SNP TO-0201241 (SEQ ID NO: 106). QTL11 according to the present invention and conferring improved resistance to ToBRFV, can be combined with QTL9, selected from those present in the genome of seeds of LVSTBRFVRES2, NCIMB 43591. QTL11 is indeed present in the genome of seeds of LVSTBRFVRES2 NCIMB, deposit number 43591.

[0067] The specific polymorphisms corresponding to the SNPs (single nucleotide polymorphisms) or markers mentioned in this specification, as well as the flanking sequences of these SNPs or markers in the tomato genome, are given in the experimental part (see in particular Tables G and H for QTL9, and Table K for QTL11) and in the accompanying sequence listing. Their positions relative to the tomato genome version 2.50 on chromosomes 9 and 11, as well as their flanking sequences are also indicated.

[0068] In this regard it is to be noted that, by definition, a SNP refers to a single nucleotide in the genome which varies depending on the allele present, whereas the flanking nucleotides are identical. In order to facilitate clear identification of the positions of the different SNPs, their positions are given in Tables G, H and K, identified by SEQ ID numbers by reference to the tomato genome sequence in version 2.50 thereof and by reference to their flanking sequences. In a sequence associated with a particular SNP in the present application, for example SEQ ID NO:1 for SNP TO-0201220, only one nucleotide in the sequence actually corresponds to the polymorphism, i.e. the 201st nucleotide of SEQ ID NO:1 corresponds to the polymorphic position of SNP TO-0201220, which may be either A or G as shown in Table G. The flanking sequences are used to locate the SNP in the genome, but are not part of the polymorphism itself. Therefore, detecting a SNP marker or an allele of that SNP refers to detecting the polymorphic nucleotide of that marker, and it is not necessary that all flanking sequences are identical.

[0069] Similarly, the other markers mentioned in the specification and Table K are not SNPs strictly speaking, but INDEL markers, which cause a single nucleotide insertion. For example, for the marker SL2.50ch11_9684449 (SEQ ID NO: 112) at position 9684449 of SL2.50 according to Table K, this means that position 9684449 is an allele, i.e., C or CT, corresponding to an insertion of T. The position of "C" in SL2.50 is the position 9684449 mentioned in Table K. As long as the allele only involves one position of these INDEL markers, for simplicity, they may also be referred to as SNP markers by language extension in the following.

[0070] The genomic or chromosomal region identified by the flanking sequence, such as a SNP or INDEL marker (hereinafter referred to as SNP) is thus clearly and unambiguously defined.

[0071] The genomic region defined by two SNPs X and Y refers to the portion of the genome, more specifically the portion of the chromosome, located between the positions of the two SNPs, preferably including the SNPs, so that the nucleotide sequence of this chromosomal region starts with the nucleotide corresponding to SNP X and ends with the nucleotide corresponding to SNP Y, i.e. according to the present invention, the SNPs are contained in the region defined by them.

[0072] By "introgression sequence from Solanum cerevisiae" in a given genomic region, it is understood that the genomic sequence found in this region has the same sequence as the corresponding genomic sequence found in the Solanum cerevisiae donor, i.e., in the introgression partner, is located at the same locus and has the same sequence as the corresponding genomic sequence found in LVSTBRFVRES2 (NCIMB 43591) at the same locus. By "having the same sequence", it is meant that the two sequences being compared are identical, except for potential point mutations that may have occurred during the transmission of the genomic region to the progeny, i.e., preferably at least 99% identical over a length of 1 kb.

[0073] It can be concluded that, in the sense of the present invention, a given genomic region has the same sequence as the corresponding genomic region found in a C. solanum donor of the same locus if said genomic region is also capable of conferring resistance to ToBRFV and originates from C. solanum.

[0074] For example, the presence of introgressed sequences in the genome of a tomato plant, seed or cell can be shown by GISH (Genetic In Situ Hybridization). GISH is indeed a powerful technique for detecting the introgression of chromatin material from one species or subspecies into another. The advantage of GISH is that the introgression process is visualized by means of a "genomic picture of introgression". Using this technique, it is also possible to determine whether a specific region of the genome is homozygous or heterozygous, thanks to the use of codominant molecular cytogenetic markers. With this technique, it is also possible to determine in which chromosome the introgressed gene of interest is present.

[0075] The present inventors have identified and located the QTLs that confer ToBRFV resistance of the present invention, mainly by identifying the presence of sequences representing QTLs of gene introgression at different loci along the above-mentioned chromosome 9 and 11 regions, i.e., 101 different loci defined by 101 SNPs of SEQ ID NO.1 to 101 with QTL9, and 14 different loci defined by 14 markers of SEQ ID NO: 102 to 115 with QTL11. These SNPs are hereinafter referred to as the SNPs of the present invention, or the 101 SNPs of the present invention for QTL9. Among them, the preferred SNPs are the 14 SNPs with SEQ ID NO: 1 to 14; in particular, the SNPs with SEQ ID NO: 1, 2, 10, 12 and 14.

[0076] Therefore, in the genome of the plant, seed or cell of the present invention, the presence of introgressed sequences or QTLs that confer a resistance phenotype can be identified based on these SNP markers.

[0077] Preferably, for QTL9, one of the 101 SNPs having SEQ ID NOs: 1-101 is used, and preferably one selected from the group consisting of SNPs TO-0201220 (SEQ ID NO: 1), TO-0201221 (SEQ ID NO: 2), TO-0201222 (SEQ ID NO: 3), TO-0201223 (SEQ ID NO: 4), TO-0201224 (SEQ ID NO: 5), TO-0201225 (SEQ ID NO: 6), TO-0201226 (SEQ ID NO: 7), TO-0201227 (SEQ ID NO: 8), TO-0201228 (SEQ ID NO: 9), TO-0201229 (SEQ ID NO: 10), TO-0201230 (SEQ ID NO: 11), TO-0201231 (SEQ ID NO: 12), TO-0201232 (SEQ ID NO: 13), The presence of the gene introgressed sequence or QTL in tomato plants is identified or characterized by a SNP from a list of 14 SNPs of TO-0201220, TO-0201221, TO-0201229, TO-0201231 and TO-0201233. The QTL9 of the present invention can be identified or characterized, for example, by SNP TO-0201220 or SNP TO-0201229.

[0078] Another suitable SNP is one having SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26; 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58 , 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 and 101.

[0079] According to a preferred embodiment, for QTL9, the presence of the introgressed sequence in the tomato plant, cell or seed of the present invention is identifiable by at least 2, preferably at least 3, or at least 5 of the 101 SNP markers, or the 14 SNP markers, preferably at least one of which is SNP TO-0201220 or SNP TO-0201229. For example, the presence of the introgressed sequence conferring resistance to ToBRFV is detected by the presence of a haploid consisting of at least 2 SNPs, for example one SNP is TO-0201229 and the other SNP is a different SNP selected from the SNPs having SEQ ID NO: 1-101 (excluding SEQ ID NO: 10).

[0080] For the 101 SNPs of the present invention, the alleles of these molecular markers representing the QTLs or gene introgression sequences conferring the resistance of the present invention are reported in the last column of Table H. For the above 14 SNP markers, the alleles representing the gene introgression QTL are SNPs allele G of TO-0201220, allele G of TO-0201221, allele A of TO-0201222, allele A of TO-0201223, allele A of TO-0201224, allele A of TO-0201225, allele A of TO-0201226, allele C of TO-0201227, allele C of TO-0201228, allele A of TO-0201229, allele C of TO-0201230, allele C of TO-0201231, allele G of TO-020132 and allele G of TO-020133.

[0081] Thus, the presence of a QTL in the genome of a tomato plant, cell or seed according to the invention can be detected or revealed by detecting a sequence representing the QTL at said locus, more preferably by detecting one or more resistance alleles of a SNP having SEQ ID NOs: 1-101, as reported in the last column of Table H, for example, by detecting allele G of SNP TO-0201220, allele G of TO-0201221, allele A of TO-0201222, allele A of TO-0201223, allele A of TO-0201224, allele A of TO-0201225. A, allele A of TO-0201226, allele C of TO-0201227, allele C of TO-0201228, allele A of TO-0201229, allele C of TO-0201230, allele C of TO-0201231, allele G of TO-0201232, and allele G of TO-0201233, more preferably by detecting SNP Allele G of TO-0201220, allele G of SEQ ID TO-0201221, allele A of TO-0201229, allele C of TO-0201231 or allele G of TO-0201233, and even more preferably detected or revealed by detecting SNP allele G of TO-0201220 and / or allele A of TO-0201229.

[0082] According to a preferred embodiment, the QTL on chromosome 9 of the present invention, i.e., QTL9, is detected in the genome of a tomato plant, cell or seed by detecting at least 2, preferably 3, and preferably at least 5 resistance alleles of SNPs with SEQ ID NOs: 1 to 101, preferably at least one detected resistance allele is allele G of SNP TO-0201220 and / or allele A of TO-0201229.

[0083] QTL9 is located on a chromosomal interval of chromosome 9 defined or flanked on one side by the flanking SNP TO-0201220 and on the other side by the flanking SNP marker having SEQ ID NO. 101. A more preferred chromosomal interval of chromosome 9 where QTL9 is found is the interval defined by TO-0201220 and TO-0201233. A more preferred interval is an interval defined by SNPs having SEQ ID NO: 20 and TO-0201233, or an interval between SNPs having SEQ ID NO: 22 and TO-0201233, or an interval between SNPs having SEQ ID NO: 26 and TO-0201233, or an interval between SNPs having SEQ ID NO: 30 and TO-0201233, or an interval between SNPs having SEQ ID NO: 34 and TO-0201233, or an interval between SNPs having SEQ ID NO: 38 and TO-0201233, or preferably an interval between SNPs TO-0201221 and TO-0201233.

[0084] QTL11 according to the present invention is preferably detected by one of the markers with SEQ ID NOs: 102 to 115, preferably by one of the SNP markers with SEQ ID NOs: 102 to 111, preferably by at least one of SNPs TO-0201237 (SEQ ID NO: 102), TO-0201238 (SEQ ID NO: 103), TO-0201239 (SEQ ID NO: 104), TO-0201240 (SEQ ID NO: 105) and TO-0201241 (SEQ ID NO: 106), and / or by markers SL2.50ch11_9684449 (SEQ ID NO: 112), SL2.50ch11_9779896 (SEQ ID NO: 113), SL2.50ch11_9823405 (SEQ ID NO: 114). Preferably, the presence of the QTL11 can be characterized by detecting one of the resistance alleles of the markers with SEQ ID NOs: 102 to 115, preferably by characterizing one of the resistance alleles of the SNPs with SEQ ID NOs: 102 to 111 and / or one of the markers with SEQ ID NOs: 112 to 115, as disclosed in the last column of Table K. According to a preferred embodiment, the presence of QTL11 is detected by detecting at least one of the alleles CT of SL2.50ch11_9684449, the allele AT of SL2.50ch11_9779896, the allele C of SL2.50ch11_9823405, the allele GT of SL2.50ch11_9924232, the allele G of TO-0201237, the allele A of TO-0201238, the allele A of TO-0201239, the allele A of TO-0201240 and the allele A of TO-0201241. Individual characterizations, preferably characterized by at least one of allele G of TO-0201237, allele A of TO-0201238, allele A of TO-0201239, allele A of TO-0201240 and allele A of TO-0201241, and / or at least one of allele CT of SL2.50ch11_9684449, allele AT of SL2.50ch11_9779896, allele C of SL2.50ch11_9823405 and allele GT of SL2.50ch11_9924232.Thus, preferred markers for QTLH are those with SEQ ID NOs: 102 to 115 (Table K), or those with SEQ ID NOs: 102-111, or the sequence of markers TO-0201237, TO-0201238, TO-0201239, TO-0201240, TO-0201241, SL2.50ch11_9684449, SL2.50ch11_9779896, SL2.50ch11_9823405 and SL2.50ch11_9924232. Table K, or a list of markers TO-0201237, TO-0201238, TO-0201239, TO-0201240 and TO-0201241, or a list of markers SL2.50ch11_9684449, SL2.50ch11_9779896, SL2.50ch11_9823405 and SL2.50ch11_9924232. Preferred resistance alleles are those corresponding to these different lists and given in Table K. These lists of markers and / or resistance alleles are applicable to all different aspects of the invention.

[0085] The tomato plants, cells or seeds of the present invention may be homozygous for QTL9, QTL11 or the introgression sequence of the present invention that confers ToBRFV resistance. However, the present invention is not limited to such homozygous plants, cells or seeds. In fact, the inventors have also demonstrated that the resistance conferred by such QTL9 is additive, and that such plants heterozygous for the QTL9 of the present invention are also resistant to ToBRFV (see the experimental section), with a resistance level lower than that of plants homozygous for the QTL, but higher than that of susceptible plants. Therefore, the present invention also includes tomato (S. lycopersicum) plants, cells or seeds of the present invention that heterozygously possess QTL9 or a gene introgression sequence in their genome on chromosome 9 as defined above.

[0086] QTL11 may also be present homozygously or heterozygously in a tomato plant, cell or seed of the invention, but only confers ToBRFV resistance at the homozygous stage, since the resistance allele is recessive (see Example 9 in this regard). The heterozygous or homozygous presence of QTL9 and QTL11 can be defined independently.

[0087] According to a preferred embodiment, the plant, seed or cell of the invention comprises QTL9 heterozygously or homozygously, and QTL11 homozygously or heterozygously as defined above. Preferred combinations are the presence of both QTL9 and QTL11 homozygously, QTL9 heterozygously with QTL11 homozygously, and the presence of both QTLs heterozygously.

[0088] Preferably, the tomato plant according to the invention is a commercial plant or line. Such commercial plants or lines preferably also show resistance to ToMV (Tomato Mosaic Virus), for example due to the presence of the Tm-2 gene (allele Tm-2 or Tm-2 2 (also known as Tm-2a)), which also confers resistance to TMV (Tobacco Mosaic Virus). Plants according to this aspect of the invention preferably also have the following additional characteristics: nematode resistance traits (Mi-1 or Mi-j), and resistance to Fusarium and Verticillium, and TYLCV resistance.

[0089] Other resistances or tolerances are also contemplated according to the present invention.

[0090] According to a preferred embodiment, the plant of the present invention has no resistance to Pepino Mosaic Virus (PepMV). According to another embodiment, the tomato plant of the present invention also has resistance to PepMV.

[0091] Furthermore, the commercial plants of the invention bear fruit under suitable conditions of at least 10 g, preferably 25 g when fully mature, preferably at least 100 g when fully mature, and / or even more preferably at least 150 g or at least 200 g when fully mature. Furthermore, the number of fruits per plant is not substantially affected by the presence of the QTL9 of the invention, i.e. the productivity of the plants according to the invention is not inferior by more than 20% to plants having the same genotype but lacking said QTL9. Thus, the plants of the invention, e.g. plants grown from deposited seeds, generally bear at least 3 tomatoes per cluster, preferably about 4, and these fruits have a weight of preferably 150 to 180 g.

[0092] According to still another embodiment, the plant of the present invention is a determinate, indeterminate or semi-indeterminate plant or a seed or a cell thereof, ie corresponds to a determinate, indeterminate or semi-indeterminate growth habit.

[0093] By determinate, it refers to tomato plants that tend to produce foliage first, then flowers, which ripen into fruit if pollination is successful. All the fruit tend to ripen on the plant at about the same time. Indeterminate tomatoes start out by producing some foliage, then continue to produce foliage and flowers throughout the growing season. At any given time, these plants tend to have tomato fruit at various stages of ripeness. Semi-determinate tomatoes have a phenotype somewhere in between determinate and indeterminate, they are typically determinate except that they grow larger than determinate varieties.

[0094] The present invention also relates to a hybrid plant of tomatoes, which can be obtained by crossing a plant homozygous for the QTL9 of the present invention with another tomato. Since the QTL9 of the present invention is additive, the hybrid plant of tomatoes produced by the above hybridization will have resistance to ToBRFV. Preferably, the hybrid partner of the other tomato is free of the QTL9 described in the present invention, but may contain one of the QTLs described in WO2018 / 219941, preferably QTL2 on chromosome 9 or QTL3 on chromosome 11. Alternatively, the hybrid partner of the other tomato may contain the QTL on chromosome 11 that confers ToBRFV resistance described in WO2020 / 018783, WO2019 / 110130 and WO2019 / 110821.

[0095] The present invention therefore also relates to a tomato plant, seed or cell comprising homozygous or heterozygous the disclosed QTL9, and:

[0096] - QTL2 on chromosome 9 as disclosed in WO2018 / 219941; heterozygous;

[0097] - QTL3 on chromosome 11, as disclosed in WO2018 / 219941, preferably homozygously;

[0098] -One or more QTLs on chromosome 11, as disclosed in WO2020 / 018783, WO2019 / 110130 and WO2019 / 110821, homozygously or heterozygously.

[0099] In addition, with respect to the QTL on chromosome 11 that the inventors of the present invention have identified, hereinafter referred to as QTL11, which confers resistance to ToBRFV, this QTL11 can be present in combination with the QTL9 of the present invention. This QTL on chromosome 11 also corresponds to the sequence introgressed from the introgression partner of the currant tomato that provides QTL9. The sequence of the introgression corresponding to QTL11 was found in the region defined by SNP TO-0201237 (SEQ ID NO: 102) and SNP TO-0201241 (SEQ ID NO: 106) on chromosome 11. As demonstrated in the experimental part of the present application, this QTL11, when present in the genome of a tomato plant, in particular when present in combination with QTL9 in the genome of a tomato plant; provides increased resistance to ToBRFV relative to the same plant lacking said QTL11. Thus, each QTL independently confers resistance to ToBRFV, but the combination of QTLs provides increased resistance relative to the resistance provided by only one QTL, i.e. at least cumulative, in particular because the resistance of QTL11 is essentially at the leaf level and the resistance of QTL9 is at the fruit level. The present invention therefore also relates to tomato plants, cells and seeds comprising this QTL11 in their genome homozygously or heterozygously, but preferably homozygously so as to confer resistance to ToBRFV, preferably resistance to the leaves. Preferably, this QTL11 is found in combination with the QTL9 of the present invention.

[0100] Therefore, the present invention also relates to a tomato plant comprising QTL9 and QTL11, thereby increasing the plant's resistance level to ToBRFV relative to the corresponding plant lacking said QTL11; the present invention also includes cells and seeds thereof.

[0101] Furthermore, as disclosed above, the presence of resistance genes that provide resistance to ToMV and TMV is advantageous, especially for indeterminate commercial varieties. According to some preferred embodiments of the present invention, the Tm-2 that confers resistance to ToMV and TMV 2 The gene (also referred to as Tm-22 or Tm-2(2)) is thus combined with QTL9 of the present invention, with QTL11 of the present invention, or with QTL9 and QTL11. However, the inventors indicate that Tm-2 2 The gene and QTL9 are located on the same arm of chromosome 9, in the transmitted “en bloc” region, which is not prone to recombination events. 2 The combination of genes and QTL9 on the same chromosome 9 is difficult to obtain routinely. However, due to the Tm-2 2 The gene and QTL9 are dominant or at least cumulative, Tm-2 2The gene and QTL9 are advantageously found on two different homologues of chromosome 9, i.e. they are both present heterozygously. 2 The gene is preferably present heterozygously.

[0102] According to an embodiment, the present invention thus relates to a plant, cell or seed, which heterozygously comprises a QTL9 according to the present invention and a Tm-2 that provides resistance to ToMV and TMV. 2 gene or its analogue. 2 The gene is well known to those skilled in the art; suitable sequences of the gene are referred to as Solyc09g018220 or GeneBank AF536201, and the protein sequence is AAQ10736. Variants and analogs are well known in the art. According to a preferred embodiment, the Tm-2 2 The gene is a gene encoding a protein having the 861 amino acid sequence reported in AAQ10736 (SEQ ID NO: 114), or a gene having at least 75%, preferably at least 80% sequence identity with the sequence and exhibiting Tm-2 2 activity, i.e., the ability of a gene to inhibit viral RNA replication of a ToMV strain.

[0103] According to a preferred embodiment, the tomato plant, cell or seed of the present invention thus heterozygously comprises QTL9 and Tm-2 2 The gene or its variant, and homozygously or heterozygously comprising the QTL11 of the present invention, this combination provides resistance to ToBRFV, ToMV and TMV. If appropriate, further resistances may also be added.

[0104] As disclosed in application PCT / IB2019 / 00674 under the name of the same applicant, the presence of the Tm-1 gene can also improve resistance to ToBRFV. Therefore, the plant, cell or seed of the present invention also advantageously comprises the Tm-1 gene. The Tm-1 gene is defined in particular in Ishibashi et al., a publication in 2007 (An inhibitor of viral RNA replication is encoded by a plant resistance gene). PNAS August 21, 2007 104 (34) 13833-13838); the preferred 'Tm-1 gene' reported in the literature refers to a gene sequence encoding a protein with Tm-1 activity, i.e., the ability to inhibit viral replication of wild-type ToMV strains susceptible to Tm-1, such as the ToMV-L strain disclosed in the document. According to a preferred embodiment, the Tm-1 gene according to the present invention is a gene encoding a protein having a 754 amino acid sequence reported in Ishibashi et al., corresponding to SEQ ID No: 115 (NCBI BAF75724) or a gene encoding a protein having at least 75%, preferably at least 80% sequence identity with the sequence and exhibiting Tm-1 activity (reported in Ishibashi et al., 2007), i.e., the ability of wild-type Tm-1 susceptible ToMV strains to inhibit viral RNA replication.

[0105] Therefore, in addition to the QTL9 of the present invention, the present invention also includes tomato plants, cells or seeds homozygously or heterozygously comprising the Tm-1 gene, and potentially Tm-2 2 Gene and QTL11, or QTL3 on chromosome 11 as defined in WO2018 / 219941. Therefore, in addition to the QTL11 of the present invention, the present invention also includes a tomato plant, cell or seed that homozygously or heterozygously, preferably homozygously comprises the Tm-1 gene.

[0106] Still according to another embodiment, the plant of the present invention is used as a scion or rhizome in a grafting process. Grafting is a process that has been used for many years in crops such as Cucurbitaceae, but has only recently been used in tomatoes. Grafting can be used to provide a certain level of resistance to telluric pathogens on the ground, such as Phytophthora or certain nematodes. Therefore, grafting tends to prevent the plant or variety to be cultivated from contacting infected soil. The variety that is interested in being used as a graft or scion can be selected as an F1 hybrid, grafted on a resistant plant used as a rhizome. The resistant rhizome remains healthy and provides a normal supply from the soil for the graft separated from the disease.

[0107] As described above, the present invention relates to tomato plants showing improved ToBRFV resistance, as well as seeds producing these plants, and cells of these plants or seeds, or other plant parts, comprising resistance QTL9 and / or QTL11 in their genome introgressed from the tomato gene, and to the progeny of the plants of the present invention comprising said QTL.

[0108] Progeny include the first, second and all further offspring of a cross with a plant according to the invention, wherein the cross includes a cross with itself or a cross with another plant. The plant or seed according to the invention may be a progeny or descendant of a plant grown from the deposited seed LVSTBRFVRES2, deposited in NCIMB, deposit number NCIMB 43591. Plants grown from the deposited seeds are indeed homozygous for the QTL9 and QTL11 of the invention that confer an improved phenotype; therefore, they carry the QTL of interest on each homolog of chromosomes 9 and 11 in their genomes. They can be used to transfer these sequences to another background by crossing and selfing and / or backcrossing.

[0109] The present invention also relates to deposited seeds of LVSTBRFVRES2 (NCIMB 43591) and plants grown from one of these seeds, homozygously containing QTL9 conferring the desired phenotype, and QTL11. It is noteworthy that these seeds do not correspond to plant varieties, and they are not homozygous for most genes except the QTL of the present invention; therefore, their phenotypes are not fixed during breeding, except for the ToBRFV resistance / tolerance of the present invention; most of their phenotypic traits are separated during breeding, except for the ToBRFV resistance of the present invention.

[0110] The invention also relates to a plant or seed as defined above, i.e. containing the QTL9 and / or QTL11 of interest in a homozygous or heterozygous state, said sequences conferring an improved phenotype, possibly in combination, which plant or seed is obtainable by transferring the QTL from a tomato plant, representative seeds of which are deposited under NCIMB accession number NCIMB-43591, into another tomato genetic background, for example by crossing said plant with a second tomato plant parent and selecting plants with the QTL9 and / or QTL11 controlling the phenotype of interest. In such a cross, QTL9 and, if applicable, QTL11 can be transferred.

[0111] It should be noted that the seeds or plants of the present invention may be obtained by different treatments and are not exclusively obtained by essentially biological treatments.

[0112] According to this aspect, the present invention relates to a tomato plant or seed, preferably a non-naturally occurring tomato plant or seed, which may contain one or more mutations in its genome, which provide the plant with fruit and / or foliage resistance to Tomato Brown Crinkle Fruit Virus, the mutation being present, for example, in the genome of the plant, a representative sample of which is deposited at NCIMB under the deposit number NCIMB 43591.

[0113] In another embodiment, the present invention relates to a method for obtaining a tomato plant or seed carrying one or more mutations in its genome, which provides the plant with fruit and / or foliage resistance to Tomato Brown Crinkle Fruit Virus. This method is shown in Example 7 and may include:

[0114] a) treating M0 seeds of the tomato plant to be modified with a mutagen to obtain M1 seeds;

[0115] b) growing plants from the M1 seeds thus obtained to obtain M1 plants;

[0116] c) producing M2 seeds by self-pollination of M1 plants; and

[0117] d) Optionally repeat steps b) and c) n times to obtain M1+n seeds.

[0118] M1+n seeds are grown into plants and infected with ToBRFV. Surviving plants, or those with milder symptoms of ToBRFV infection, are propagated for one or more generations while continuing to select for fruit and / or foliage resistance to ToBRFV.

[0119] In this method, the M1 seeds of step a) can be obtained by chemical mutagenesis (e.g., EMS mutagenesis). Other chemical mutagens include, but are not limited to, diethyl sulfate (des), ethyleneimine (ei), propane sultone, N-methyl-N-nitrosocarbamate (mnu), N-nitroso-N-methylurea (NMU), N-ethyl-N-nitrosourea (enu), and sodium azide.

[0120] Alternatively, mutations are induced by radiation, for example selected from X-rays, fast neutrons, ultraviolet radiation.

[0121] In another embodiment of the present invention, the mutation is induced by genetic engineering. Such mutations also include the integration of sequences that confer resistance to ToBRFV fruit and / or foliage, and the replacement of resident sequences with alternative sequences that confer resistance or tolerance to ToBRFV fruit and / or foliage. Preferably, the mutation is the integration of QTL9 and / or QTL11 as described above to replace the homologous sequences of tomato plants. More preferably, the mutation is the replacement of sequences or fragments thereof contained in SNP TO-0201220 (SEQ ID NO: 1) and SNP TO-0201233 (SEQ ID NO: 14) on chromosome 9 of the tomato genome with homologous sequences present on chromosome 9 in the plant genome, and a representative sample of the plant is deposited in NCIMB under the accession number NCIMB43591, wherein the sequence or fragment thereof confers resistance to ToBRFV. According to another embodiment, the mutation is to replace the sequence or fragment thereof contained in SNP TO-0201237 (SEQ ID NO: 102) and SL2.50ch11_9924232 (SEQ ID NO: 115) on chromosome 11 of the tomato genome (for example, the sequence contained in SNP TO-0201237 and SNP TO-0201241) with a homologous sequence on chromosome 11 present in the plant genome, wherein a representative sample is deposited in NCIMB with the deposit number NCIMB43591, wherein the sequence or fragment thereof confers resistance to ToBRFV when present homozygously.

[0122] Genetic engineering techniques that can be used include the use of all the so-called New Breeding Techniques, which are various new technologies developed and / or used to create new characteristics in plants through genetic variation, with the aim of targeted mutagenesis, targeted introduction of new genes or gene silencing (RdDM). Examples of such New Breeding Techniques are the promotion of targeted sequence changes by using the following techniques: Zinc Finger Nuclease (ZFN) technology (ZFN-1, ZFN-2 and ZFN-3, see U.S. Pat. No. 9,145,565), Oligonucleotide Directed Mutagenesis (ODM), Cisgenesis and Intragenesis, Grafting (in GM rhizomes), Reverse breeding, Agrobacterium infiltration (Agro-infiltration "strictly", Agrobacterium inoculation, floral dip), Transcription Activator-Like Effector Nucleases (TALENs, see U.S. Pat. No. 9,145,565). Nos. 8,586,363 and 9,181,535), CRISPR / Cas systems (see U.S. Pat. Nos. 8,697,359; 8,771,945; 8,795,965; 8,865,406; 8,871,445; 8,889,356; 8,895,308; 8,906,616; 8,932,814; 8,945,839; 8,993,233; and 8,999,641), engineered meganucleases, re-engineered homing endonucleases, DNA-guided genome editing (Gao et al., Nature Biotechnology (2016)), and synthetic genomics. A major part of targeted genome editing, another name for new breeding techniques, is the application of inducing DNA double-strand breaks (DSBs) at selected locations in the genome where the modification is desired. Such applications can be used to generate mutations (e.g., targeted mutations or precise natural gene editing) as well as precise insertion of genes (e.g., homologous genes, within endogenous genes, or heterologous genes). Applications that result in mutations are generally identified as site-directed nuclease (SDN) technologies, such as SDN1, SDN2, and SDN3. For SDN1, the result is a targeted, non-specific gene deletion mutation: the location of the DNA DSB is precisely selected, but the DNA repair of the host cell is random and results in small nucleotide deletions, additions, or substitutions. For SDN2, SDN is used to generate targeted DSBs and a DNA repair template (a short DNA sequence identical to the target DSB DNA sequence, except for one or a few nucleotide changes) is used to repair the DSB: this results in targeted and predetermined point mutations in the desired target gene. For SDN3, SDN is used with a DNA repair template containing a new DNA sequence (e.g., a gene). The result of this technology is the integration of this DNA sequence into the plant genome.The most likely application for the use of SDN3 is the insertion of cisgenic, intragenic or transgenic expression cassettes at selected genomic locations. A full description of each technique can be found in the 2011 report by the European Commission's Joint Research Centre (JRC) Institute for Foresight Technologies titled "New Plant Breeding Technologies - Current State of the Art and Prospects for Commercial Development".

[0123] According to the present invention, resistance or intermediate resistance to ToBRFV corresponds to a significant reduction in non-marketable fruits of the resistant plants of the present invention; in particular, the resistant plants disclosed herein produce tomatoes such that at least 70% of the fruits are marketable when ripe, i.e., without discolored spots, without browning calyx, without undersize and rough surface, without brown necrotic spots. Preferably, even in the case of double infection, at least 80% of the fruits are still marketable when ripe, preferably at least 90% of the fruits are still marketable when ripe.

[0124] As defined above, the plant of the present invention is characterized in that on chromosome 9, an introgression sequence is present in the chromosomal region defined by SNP TO-0201220 and the SNP with SEQ ID NO: 101, and / or on chromosome 11, an introgression sequence is present in the chromosomal region defined by SNP TO-0201237 and SL2.50ch11_9924232, preferably by SNP TO-0201237 and SNP TO-0201241. However, introgression sequences from currant tomato may be found outside these borders or flanking sequences. Similarly, introgression sequences may be found within the above-mentioned regions, but the entire region is not necessarily composed of introgression sequences. In view of the markers of QTL9 identified and used by the inventors, it is preferred that the introgression sequence conferring ToBRFV resistance is found in the genome of the plant, seed or cell of the present invention at the following locus: comprising the SEQ ID NO mentioned in Table H. At least one or more of the 101 loci of the 101 SNPs of NO:1-101, more preferably at least one of the following 14 loci on chromosome 9: a locus comprising TO-0201220, a locus comprising TO-0201221, a locus comprising TO-0201222, a locus comprising TO-0201223, a locus comprising TO-0201224, a locus comprising TO-0201225, a locus comprising TO-0201226, a locus comprising TO-0201227, a locus comprising TO-0201228, a locus comprising TO-0201229, a locus comprising TO-0201230, a locus comprising TO-0201231, a locus comprising TO-0201232 and a locus comprising TO-0201233.

[0125] The so-called "locus containing a SNP marker" refers to the sequence surrounding the SNP polymorphism, preferably a sequence extending from about 2 megabases upstream of the SNP to about 2 megabases downstream of the SNP, preferably 1 megabase upstream and downstream of the SNP, and preferably even 0.5 megabases.

[0126] The introgression sequences for these loci are the sequences found at the corresponding loci in the seed LVSTBRFVRES2 corresponding to NICMB43591.

[0127] For QTL11, it is preferred that the introgression sequences that confer ToBRFV resistance when present homozygously are found in the genome of the plant, seed or cell of the present invention at the following loci, which are at least one or more of the 14 loci comprising the 14 markers with SEQ ID NOs: 102-115 mentioned in Table K. The introgression sequences of these loci are also the sequences found at the corresponding loci in LVSTBRFVRES2 of the seed corresponding to NICMB43591.

[0128] The present invention also relates in another aspect to any plant that may be obtained from the seeds or plants of the present invention as described above, as well as plant parts of such plants, and most preferably explants, scions, cuttings, seeds, fruits, roots, rhizomes, pollen, ovules, embryos, protoplasts, leaves, anthers, stems, petioles, cotyledons, flowers, root tips, hypocotyls and any other plant parts, wherein the plants, explants, scions, cuttings, seeds, fruits, roots, rhizomes, pollen, ovules, embryos, protoplasts, leaves, anthers, stems, petioles, cotyledons, flowers, root tips, hypocotyls and / or plant parts are obtainable from the seeds or plants according to the first aspect of the present invention, i.e. carry the target QTL9 and / or QTL11 homozygously or heterozygously in their genome. These plant parts, in particular explants, scions, cuttings, seeds, fruits, roots, rhizomes, pollen, ovules, embryos, protoplasts, leaves, anthers, stems, petioles, cotyledons, flowers, root tips or hypocotyls, comprise in their genome QTL9 and / or QTL11 conferring the desired phenotype, i.e. resistance to ToBRFV, in particular fruit resistance to QTL9 and foliage resistance to QTL11. According to a preferred embodiment, the present invention relates to a seed as described above that develops into a plant according to the first aspect of the present invention, thereby being resistant to ToBRFV infection due to the presence of resistance QTL9 or QTL11 or gene introgression sequences, as defined above.

[0129] The QTL9 and QTL11 referred to in this aspect of the invention are those defined above in the context of the plants of the invention.

[0130] The plant part may advantageously comprise QTL11 as defined above in addition to or instead of QTL9.

[0131] The different features of the QTLs defined in relation to the first aspect of the invention apply mutatis mutandis to this aspect of the invention. Thus, QTL9 is preferably selected from those present in the genome of the plant corresponding to deposit material LVSTBRFVRES2 (NCIMB deposit number 43591). Its advantageous feature is that: at least one resistance allele of the SNP in Table H is present; preferably, allele G of SNP TO-0201220, allele G of TO-0201221, allele A of TO-0201222, allele A of TO-0201223, allele A of TO-0201224, allele A of TO-0201225, allele A of TO-0201226, allele C of TO-0201227, allele C of TO-0201228, allele A of TO-0201229, allele C of TO-0201230, allele C of TO-0201231, allele G of TO-0201232 and / or allele G of TO-020133 are present, and more preferably, SNP Allele G of TO-0201220, allele G of SEQ ID TO-0201221, allele A of TO-0201229, allele C of TO-0201231 or allele G of TO-0201233, and even more preferably allele G of SNP TO-0201220 and / or allele A of TO-0201229 are present.

[0132] QTL11 is preferably selected from those present in the plant genome corresponding to the deposit material LVSTBRFVRES2 (NCIMB deposit number 43591). Its advantageous characteristics are: the presence of at least one resistance allele of the marker in Table K; preferably the presence of allele G of TO-0201237, allele A of TO-0201238, allele A of TO-0201239, allele A of TO-0201240, allele A of TO-0201241, allele CT of SL2.50ch11_9684449, allele CT of SL2.50ch11_977 allele AT of 9896, allele C of SL2.50ch11_9823405 and allele GT of SL2.50ch11_9924232; for example, there is at least one of allele G of TO-0201237, allele A of TO-0201238, allele A of TO-0201239, allele A of TO-0201240 and allele A of TO-0201241.

[0133] The present invention also relates to cells of a tomato plant, such that these cells comprise in their genome a QTL9 or QTL11 of the present invention, independently conferring a desired phenotype to the tomato plant, as well as potential QTL9 and QTL11. QTL9 and QTL11 are the ones already defined within the framework of the present invention, characterized by: the same features and preferred embodiments already disclosed for plants and seeds according to the preceding aspects of the present invention. The presence of such a QTL, i.e. QTL9 or QTL11, can be revealed by the above disclosed techniques and is well known to a person skilled in the art. Among other things, it can be determined whether the QTL is homozygously or heterozygously present in the genome of this cell of the present invention. The advantageous feature of QTL9 is the presence of at least one resistance allele of the SNPs in Table H; preferably the presence of allele G of SNP TO-0201220, allele G of TO-0201221, allele A of TO-0201222, allele A of TO-0201223, allele A of TO-0201224, allele A of TO-0201225, allele A of TO-0201226, allele C of TO-0201227, allele C of TO-0201228, allele A of TO-0201229, allele C of TO-0201230, allele C of TO-0201231, allele G of TO-0201232 and / or allele G of TO-020133, and more preferably the presence of SNP Allele G of TO-0201220, allele G of SEQ ID TO-0201221, allele A of TO-0201229, allele C of TO-0201231 or allele G of TO-0201233, even more preferably allele G of SNP TO-0201220 and / or allele A of TO-0201229 are present. Advantageous characteristics of QTL11 are the presence of at least one resistance allele of a marker of Table K, preferably allele G of TO-0201237, allele A of TO-0201238, allele A of TO-0201239, allele A of TO-0201240, allele A of TO-0201241, allele C of SL2.50ch11_9684449, allele A of SL2.50ch11_9684449. allele AT of 779896, allele C of SL2.50ch11_9823405 and allele GT of SL2.50ch11_9924232; for example, there is at least one of allele G of TO-0201237, allele A of TO-0201238, allele A of TO-0201239, allele A of TO-0201240 and allele A of TO-0201241.

[0134] The cell according to the invention may be any type of tomato cell carrying the QTL9 and / or QTL11 of interest, in particular an isolated cell and / or a cell capable of regenerating a whole tomato plant.

[0135] The present invention also relates to a tissue culture of non-regenerable or regenerable cells of the plant defined above according to the present invention; preferably, the regenerable cells are derived from the embryo, protoplast, meristem cell, callus, pollen, leaf, anther, stem, petiole, root, root tip, fruit, seed, flower, cotyledon and / or hypocotyl of the present invention, and the cells contain in their genome QTL9 and / or QTL11 independently conferring an improved phenotype, i.e., QTL9's fruit resistance to ToBRFV and QTL11's branch and leaf resistance to ToBRFV.

[0136] Preferably, the cell comprises QTL9 homozygously or heterozygously and also comprises QTL11 as defined in the context of the present invention.

[0137] The cell advantageously also comprises any additional resistance or tolerance genes as disclosed in the context of the first aspect of the invention, which also apply here.

[0138] The tissue culture is preferably capable of regenerating plants having the physiological and morphological characteristics of the aforementioned tomato plants, as well as regenerating plants having substantially the same genotype as the aforementioned tomato plants. The present invention also provides tomato plants regenerated from the tissue culture of the present invention.

[0139] The present invention also provides a plant as defined above or a protoplast from a tissue culture as defined above, said protoplast comprising QTL9 and / or QTL11 conferring the improved phenotype of the present invention.

[0140] The present invention also relates to tissues of the plants of the present invention; the tissues may be undifferentiated tissues or differentiated tissues. Such tissues contain one or more cells containing the QTL of the present invention.

[0141] The invention also relates to propagation material capable of producing resistant tomato plants according to the invention, comprising the introgression sequence or QTL as defined above.

[0142] According to another aspect, the present invention also relates to a tomato plant according to the present invention, preferably homozygously comprising the QTL9 according to the present invention, for use as a breeding partner in a breeding scheme for obtaining a plant having an improved phenotype according to the present invention. In fact, such a breeding partner homozygously comprises in its genome the QTL9 conferring the target phenotype. By crossing this plant with a tomato plant, in particular a line, the QTL9 according to the present invention conferring the desired phenotype can therefore be transferred to the offspring. Therefore, the plant according to the present invention can be used as a breeding partner for introgressing the QTL9 gene conferring the desired phenotype into a tomato plant or germplasm, i.e. ToBRFV resistance. Although plants or seeds heterozygously carrying the target QTL9 can also be used as breeding partners as described above, the separation of the phenotype may make the breeding program more complicated.

[0143] The improved phenotype of the present invention is resistance to ToBRFV, particularly fruit resistance or foliage resistance, or fruit and foliage resistance.

[0144] The breeding partner may further comprise QTL11 as defined in the present invention, preferably homozygously comprise QTL11 as defined in the present invention.

[0145] The introgressed QTL9 will be advantageously introduced into varieties containing other desired genetic traits, such as disease resistance, early fruit maturity, drought tolerance, fruit shape, etc. Preferably, the introgressed QTL9 will be advantageously introduced into varieties containing Tm-2 2 Gene in plants or varieties.

[0146] According to another embodiment, the present invention also relates to the same use of a tomato plant according to the present invention, but homozygously comprising the QTL11 according to the present invention as breeding partner.

[0147] The invention also relates to the same uses as plants or seeds deposited at NCIMB under the deposit number NCIMB 43591 containing homozygously QTL9 and / or QTL11, and plants derived therefrom. Said plants are also suitable as introgression partners for breeding programmes aiming at conferring a desired phenotype to tomato plants or germplasm.

[0148] In such a breeding program, selection of progeny displaying a desired phenotype or carrying a QTL9 linked to a desired phenotype can advantageously be based on the alleles of the SNP markers, particularly based on the alleles of the SNP markers of the invention having SEQ ID NOs: 1-101.

[0149] For QTL9, preferably, the progeny of the plant are selected in the presence of SNPs G allele of TO-0201220, G allele of TO-0201221, A allele of TO-0201222, A allele of TO-0201223, A allele of TO-0201224, A allele of TO-0201225, A allele of TO-0201226, C allele of TO-0201227, C allele of TO-0201228, A allele of TO-0201229, C allele of TO-0201230, C allele of TO-0201231, G allele of TO-0201232 and / or G allele of TO-020133, more preferably in the presence of SNPs The progeny of the plant are selected in the presence of allele G of TO-0201220, allele G of SEQ ID TO-0201221, allele A of TO-0201229, allele C of TO-0201231 or allele G of TO-0201233, and even more preferably in the presence of allele G of SNP TO-0201220 and / or allele A of TO-0201229.

[0150] Alternatively, selection may be made based on the presence of any one resistance allele of the 101 SNPs of the present invention, or a combination of these alleles, that are associated with an improved phenotype.

[0151] This selection will be based on the presence of the target allele in the sample of genetic material of the plant to be selected. The presence of this or these alleles indeed confirms the presence of the QTL9 of the present invention or the gene introgression sequence at the locus defined by the SNP. However, after a point mutation or recombination event, it is conceivable that at least one or two of these alleles are lost, and the remaining chromosome fragment carrying the target QTL9 still confers the target phenotype.

[0152] Selection of progeny carrying QTL11 can advantageously be performed based on the alleles of markers having SEQ ID NOs: 102-115, preferably based on the alleles of SNP markers having SEQ ID NOs: 102-111, preferably based on allele G of TO-0201237, allele A of TO-0201238, allele A of TO-0201239, allele A of TO-0201240, allele A of TO-0201241, allele CT of SL2.50ch11_9684449, allele A of SL2.50ch11_9779896, allele B of SL2.50ch11_9779897, allele C of SL2.50ch11_9779898 The presence of gene AT, allele C of SL2.50ch11_9823405 and allele GT of SL2.50ch11_9924232; for example, by the presence of at least one of allele G of TO-0201237, allele A of TO-0201238, allele A of TO-0201239, allele A of TO-0201240 and allele A of TO-0201241.

[0153] Therefore, plants according to the invention or plants grown from seeds deposited under accession number NCIMB 43591 are particularly valuable in marker-assisted selection for obtaining commercial tomato lines and varieties having the improved phenotype of the invention.

[0154] The invention also relates to the use of said plants in procedures aimed at identifying, sequencing and / or cloning gene sequences conferring a desired phenotype.

[0155] Any of the specific embodiments described for the previous aspects of the invention also apply to this aspect of the invention, particularly with respect to the characteristics of QTL9 and QTL11 that confer the phenotype of interest.

[0156] According to yet another aspect, the present invention also relates to a method or process for the production or breeding of tomato plants, particularly commercial plants and inbred lines, having a desired phenotype. The present invention indeed also relates to the transfer of the QTL or gene introgression sequence of the present invention conferring ToBRFV resistance to other tomato plants, particularly other tomato varieties, or other species or inbred lines, and can be used to produce new types and varieties of tomatoes.

[0157] In this regard, the present invention also includes a method for breeding a tomato plant having resistance to ToBRFV, comprising the steps of crossing a plant grown from the deposited seed LVSTBRFVRES2 NCIMB 43591 carrying the QTL9 of the present invention conferring resistance to ToBRFV or its progeny with an initial tomato plant preferably lacking said QTL. The QTL is as defined above, i.e., introgressed from the tomato gene of currant, preferably present in the genome of the seed of LVSTBRFVRES2, NCIMB deposit number 43591. The QTL can be identified by at least one resistance allele of a SNP marker having SEQ ID NO: 1-101.

[0158] The present invention also relates to a method for conferring ToBRFV resistance to a tomato plant, comprising genetically modifying the plant to introduce the QTL9 resistance of the present invention. The QTL9 is as defined above and is preferably present in the genome of seeds of LVSTBRFVRES2, NCIMB deposit number 43591. The genetic modification can be performed by any method or means well known to those skilled in the art.

[0159] The present invention also relates to the same method for breeding tomato plants with ToBRFV resistance associated with QTL11 but not QTL9 and conferring tomato plants ToBRFV resistance associated with QTL11 but not QTL9. In this case, the QTL can be identified by at least one resistance allele of a marker having SEQ ID NOs: 102-115.

[0160] Therefore, the present invention relates to a breeding method for tomato plants with ToBRFV resistance, comprising the following steps: crossing a plant grown from the deposited seed NCIMB 43591 or its progeny carrying QTL9 on chromosome 9, which is introgressed from the currant tomato gene and confers ToBRFV resistance, with an initial tomato plant lacking the QTL9, wherein the QTL9 on chromosome 9 is present in the genome of the plant seed LVSTBRFVRES2, NCIMB deposit number 43591, and can be identified by allele G of SNPTO-0201220, allele G of SEQ ID TO-0201221, allele A of TO-0201229, allele C of TO-0201231 or allele G of TO-0201233.

[0161] The present invention also relates to a method for breeding tomato plants resistant to ToBRFV, comprising the steps of: breeding seeds from the deposited NCIMB Plants grown from 43591 or its progeny are crossed with an initial tomato plant lacking the QTL11, wherein the QTL11 on chromosome 11 is present in the genome of plant seeds LVSTBRFVRES2, NCIMB deposit number 43591, and can be identified by allele G of TO-0201237, allele A of TO-0201238, allele A of TO-0201239, allele A of TO-0201240, allele A of TO-020124, allele CT of SL2.50ch11_9684449, allele AT of SL2.50ch11_9779896, allele C of SL2.50ch11_9823405 or allele GT of SL2.50ch11_9924232.

[0162] In particular, the present invention also relates to a method or process for producing plants resistant to ToBRFV, comprising the following steps:

[0163] a) crossing a plant grown from the deposited seed NCIMB 43591 or a progeny thereof comprising QTL9 conferring ToBRFV resistance, with a starting tomato plant preferably lacking said QTL,

[0164] b) selecting a plant comprising the QTL9 of the present invention among the progeny thus obtained;

[0165] c) Optionally, the plants obtained in step b) are self-pollinated one or more times, and the plants thus obtained that are resistant to ToBRFV, whether fruit resistance, foliage resistance or both, are selected in the progeny.

[0166] Optionally, the method or process may include the following steps instead of step a):

[0167] a1) crossing a plant grown from the deposited seed (NCIMB 43591) or a progeny thereof corresponding to the deposited seed comprising QTL9 conferring ToBRFV resistance, and an initial tomato plant preferably lacking said QTL,

[0168] a2) Increase F1 hybrids by selfing to create F2 populations.

[0169] In the above methods or processes, preferably SNP markers are used in step b) and / or c) for selecting plants carrying a sequence conferring the desired resistance phenotype.

[0170] The SNP marker is preferably one or more of the 101 SNP markers of the present invention having SEQ ID NOs: 1 to 101, including all combinations thereof mentioned elsewhere in this application, and preferably has SNPs having SEQ ID NOs: 1-14.

[0171] By selecting plants based on the alleles of one or more SNPs, it can be understood that when the allele of the SNP is an allele of the LVSTBRFVRES2 parent corresponding to the SNP but not the allele of the initial tomato plant, the plant is selected as having ToBRFV resistance relative to the initial plant, whether it is fruit tolerance / resistance, foliage tolerance / resistance or both. For example, when allele G of SNP TO-0201220, allele G of TO-0201221, allele A of TO-0201222, allele A of TO-0201223, allele A of TO-0201224, allele A of TO-0201225, allele A of TO-0201226, allele C of TO-0201227, allele C of TO-0201228, allele A of TO-0201229, allele C of TO-0201230, allele C of TO-0201231, allele G of TO-0201232 and / or allele G of TO-020133 are detected, more preferably, when allele G of SNP TO-0201220, SEQ ID NO: 1, allele C of SNP TO-0201231, allele C of SNP TO-0201232 and / or allele G of SNP TO-0201233 are detected. When allele G of TO-0201221, allele A of TO-0201229, allele C of TO-0201231, allele G of TO-0201232 or allele G of TO-0201233, and even more preferably when allele G of SNP TO-0201220 and / or allele A of TO-0201229 are detected, plants having the improved phenotype of the present invention can be selected.

[0172] Preferably, the tomato plant of step a) is an elite line for obtaining plants with commercially desirable traits or desirable horticultural traits. Advantageously, due to the Tm-2 2 When the gene is present homozygously or heterozygously, the plant is resistant to TMV.

[0173] The method or process as defined above may advantageously comprise a backcrossing step, preferably after step c), to obtain plants having all the characteristic features of a tomato plant. Thus, the method or process for producing a plant having these characteristics may also comprise the following additional steps:

[0174] d) backcrossing the resistant plants selected in step b) or c) with tomato plants;

[0175] e) selecting plants carrying the QTL9 or introgression sequence of the present invention.

[0176] The plant used in step a), i.e. the plant corresponding to the deposited seeds, may be a plant grown from the deposited seeds; it may also be any plant carrying QTL9 or gene introgression sequences, conferring a phenotype, preferably homozygously carrying these sequences according to the first aspect of the invention.

[0177] Preferably such a plant further comprises the defined QTL11, preferably comprises the defined QTL11 homozygously.

[0178] In step e), the SNP marker can be used to select plants that are resistant to ToBRFV relative to the initial plant. The SNP marker is a marker of the present invention, as described in the previous sections. According to a preferred embodiment, the method or process of the present invention is carried out so that, for at least one selection step, i.e. b), c) and / or e), the selection is based on the detection of at least one resistance allele of a SNP having SEQ ID NO: 1-101. Preferred alleles and combinations have been disclosed and are suitable for this embodiment of the present invention.

[0179] It should be noted that when selecting plants with an improved phenotype and homozygously carrying the QTL conferring this phenotype, the selection is based on one or more SNPs of the present invention, in the presence of the allele representing the QTL, i.e. the allele LVSTBRFVRES2 parent, in combination with the absence of the allele representing the relapse-susceptible tomato parent.

[0180] Selection can also be based on any other markers that are related to the introgressed sequences and represent the presence of these introgressed sequences by contrast to the resident sequences of the susceptible parent. Methods for defining surrogate markers are also within the scope of the invention and are disclosed in another section.

[0181] The plants selected in step e) are preferably commercial plants, in particular plants having a fruit weight of at least 10 g but preferably 25 g, at least 100 g, at least 150 g or at least 200 g when fully mature under normal culture conditions.

[0182] Preferably, steps d) and e) are repeated at least twice, preferably three times, not necessarily with the same tomato plants. The tomato plants are preferably breeding lines.

[0183] In the selection step of each of the processes disclosed above, one may additionally select for resistance to a nematode trait or resistance to ToMV.

[0184] The selfing and backcrossing steps may be performed in any order and may be inserted, for example, backcrossing may be performed before and after one or more selfings, and selfing may be performed before and after one or more backcrossings.

[0185] Progeny with the desired improved phenotype can also be selected based on comparison of ToBRFV resistance from tomato parents, in particular by the scheme disclosed in the Examples; the resistance / tolerance tested can be fruit resistance / tolerance or foliage resistance / tolerance, or both.

[0186] The method for allele detection may be based on any technique that allows distinguishing between two different alleles of a SNP on a specific chromosome.

[0187] The present invention also relates to the same method, wherein in step a), plants grown from deposited seeds NCIMB 43591 or progeny thereof containing QTL11 conferring ToBRFV resistance are used. All detection / selection steps are then performed for QTL11, in particular markers with SEQ ID NOs: 102-115, more preferably based on allele G of TO-0201237, allele A of TO-0201238, allele A of TO-0201239, allele A of TO-0201240, allele A of TO-0201241, allele CT of SL2.50ch11_9684449, allele AT of SL2.50ch11_9779896. , allele C of SL2.50ch11_9823405 and / or allele GT of SL2.50ch11_9924232; for example, by the presence of at least one of allele G of TO-0201237, allele A of TO-0201238, allele A of TO-0201239, allele A of TO-0201240, and allele A of TO-0201241. Alternative preferred lists of markers and resistance alleles have been disclosed above.

[0188] Therefore, the present invention also relates to a method for conferring resistance to ToBRFV in tomato plants, comprising the following steps:

[0189] a) crossing plants grown from deposited seed NCIMB 43591 or its progeny, carrying QTL9 on chromosome 9 and / or QTL11 on chromosome 11 introgressed from tomato and independently conferring ToBRFV resistance in NCIMB 43591, with an initial tomato plant preferably lacking said QTL;

[0190] b) selecting plants carrying QTL9 and / or QTL11 among the progeny thus obtained;

[0191] c) Optionally, the plants obtained in step b) are self-pollinated one or more times and the plants thus obtained that are resistant to ToBRFV are selected among the progeny.

[0192] According to another embodiment, the present invention relates to a method for conferring resistance to ToBRFV in a tomato plant, comprising the following steps:

[0193] a1) crossing plants grown from the deposited seed NCIMB 43591 or its progeny carrying QTL9 on chromosome 9 and / or QTL11 on chromosome 11 introgressed from the tomato gene of C. cerana and independently conferring ToBRFV resistance in NCIMB 43591 with an initial tomato plant preferably lacking said QTL, thereby producing an F1 population,

[0194] a2) F1 hybrids are self-pollinated to produce F2 populations,

[0195] b) selecting the progeny individuals thus obtained that are resistant to ToBRFV.

[0196] The SNP markers are advantageously used in steps b) and / or c) to select plants carrying QTL9 and / or QTL11 that independently confer ToBRFV resistance.

[0197] The present invention also relates to a method for obtaining a commercial tomato plant or its inbred parental line, which commercial tomato plant or its inbred parental line has a desired improved phenotype corresponding to fruit and / or foliage tolerance and / or resistance to Tomato Brown Crinkle Fruit Virus relative to the original commercial tomato plant, the method comprising the following steps:

[0198] a) backcrossing plants obtained by germinating the deposited seed LVSTBRFVRES2 NCIMB deposit number 43591 or its progeny with commercial tomato plants, wherein the progeny of the deposited seed LVSTBRFVRES2 NCIMB deposit number 43591 carries QTL9 that confers ToBRFV resistance,

[0199] b) selecting plants carrying the QTL9 of the present invention.

[0200] Preferably, the screening is performed based on one or more of the 101 SNPs of the present invention, as described in detail in other methods of the present invention.

[0201] Alternatively, the progeny of step a) is a progeny carrying QTL11, and the selection of step b) is based on QTL11, preferably based on one or more of the 14 markers of the invention having SEQ ID NOs: 102-115, as detailed in other methods of the invention.

[0202] In all methods and processes according to the invention, the starting tomato plants are determinate, indeterminate or semi-determinate.

[0203] As already disclosed, the tomato plants according to the invention are preferably also resistant to Tomato mosaic virus, nematodes, TYLCV and Fusarium and Verticillium. In order to obtain such plants in the process and method of the invention, the tomato parents used in the breeding scheme preferably carry sequences that confer resistance to Tomato mosaic virus, nematodes, TYLCV and Fusarium and Verticillium; and a selection step is performed to select plants having these resistance sequences, as well as QTLs that confer the improved phenotype of the invention.

[0204] The invention also relates to tomato plants and seeds obtained or obtainable by any of the methods and processes disclosed above. Such plants are indeed tomato plants with an improved phenotype according to the first aspect of the invention. Such tomato seeds are preferably coated or pelleted with active species such as phytonutrients, enhancing microorganisms or products for disinfecting the environment of the seeds and plants, either alone or in combination. These species and chemicals can be products that promote plant growth, such as hormones, or increase their resistance to environmental stress, such as defense stimulants, or stabilize the pH value of the substrate and its surroundings, or other nutrients.

[0205] They can also be products for preventing agents that are not conducive to the growth of seedlings, including viruses and pathogenic microorganisms herein, such as fungicides, bactericides, nematicides (hematicidal), insecticides or herbicides products that act by contact, ingestion or gas diffusion; for example, it is any suitable essential oil, such as thyme extract. All these products strengthen the resistance response of plants, and / or disinfect or regulate the environment of the plants. They can also be living biological materials, such as non-pathogenic microorganisms, such as at least one fungus or bacteria or virus, with a culture medium that ensures its viability if necessary; and such microorganisms, such as pseudomonas, bacillus, trichoderma, clonostachys, fusarium, rhizoctonia and other types stimulate the growth of plants, or protect them from pathogens.

[0206] In all of the foregoing methods and processes, identification of plants carrying a QTL or introgression sequence responsible for ToBRFV resistance can be accomplished by detecting at least one allele of a SNP associated with the resistance QTL9, which can be combined with the absence of other allelic forms of the SNP of the present invention to confirm the homozygous state of the QTL if desired. Thus, identification of plants homozygous for the QTL or introgression sequence of the present invention will be based on identification of a resistance allele of at least one SNP having SEQ ID NO: 1-101 for QTL9, as well as the absence of a susceptible allele of said SNP. For example, identification of plants homozygously carrying the QTL9 of the present invention will be based on the identification of SNPs allele G of TO-0201220, allele G of TO-0201221, allele A of TO-0201222, allele A of TO-0201223, allele A of TO-0201224, allele A of TO-0201225, allele A of TO-0201226, allele C of TO-0201227, allele C of TO-0201228, allele A of TO-0201229, allele C of TO-0201230, allele C of TO-0201231, allele G of TO-0201232 and / or allele G of TO-020133, and the absence of the corresponding susceptible alleles, i.e., SNPs. Allele A of TO-0201220, allele A of TO-0201221, allele G of TO-0201222, allele G of TO-0201223, allele C of TO-0201224, allele G of TO-0201225, allele G of TO-0201226, allele A of TO-0201227, allele G of TO-0201228, allele G of TO-0201229, allele A of TO-0201230, allele A of TO-0201231, allele A of TO-0201232 and / or allele A of TO-0201233.

[0207] Similarly, identification of plants homozygous for the QTL or introgression sequence of the present invention will be based on identification of the resistance allele for at least one marker having SEQ ID NOs: 102-115 for QTL11, and the absence of the susceptible allele for said SNP. For example, identification of plants homozygous for the QTL11 of the present invention will be based on allele G of TO-0201237, allele A of TO-0201238, allele A of TO-0201239, allele A of TO-0201240, allele A of TO-0201241, allele CT of SL2.50ch11_9684449, allele AT of SL2.50ch11_9779896, allele C of SL2.50ch11_9823405, and / or allele C of SL2.50ch11_9924232. Identification of allele GT and the corresponding loss of susceptible alleles, i.e., allele A of TO-0201237, allele T of TO-0201238, allele C of TO-0201239, allele C of TO-0201240, allele C of TO-0201241, allele C of SL2.50ch11_9684449, allele A of SL2.50ch11_9779896, allele T of SL2.50ch11_9823405, and allele G of SL2.50ch11_9924232.

[0208] The present invention also relates to the use of the information provided herein by the inventors, namely the presence of QTL9 and QTL11 present in the deposited seeds LVSTBRFVRES2 and conferring an improved phenotype to tomato plants, and the disclosure of molecular markers associated with these QTLs or gene introgression sequences. This knowledge can be used, among other things, to precisely locate QTLs, define their sequences, identify tomato plants containing QTLs conferring improved phenotypes and to identify further or alternative markers associated with these QTLs. Such further markers are characterized by their location, i.e. close to the 101 markers disclosed herein, and are preferably derived from the 14 SNPs with SEQ ID NOs: 1-14 for QTL9, and by their association with the ToBRFV resistance disclosed by the present invention. For QTL11, suitable markers are those with SEQ ID NOs: 102 to 115.

[0209] In this regard, the present invention also relates to a method for identifying, detecting and / or selecting tomato plants having a QTL9 of the present invention, such as the QTL9 found in the seed genome of LVSTBRFVRES2 (NCIMB deposit number 43591), which confers improved resistance to ToBRFV relative to corresponding plants lacking said sequence, the method comprising detecting at least one resistance allele of the SNP markers () of Table H, in particular SNP The present invention is one of allele G of TO-0201220, allele G of TO-0201221, allele A of TO-0201222, allele A of TO-0201223, allele A of TO-0201224, allele A of TO-0201225, allele A of TO-0201226, allele C of TO-0201227, allele C of TO-0201228, allele A of TO-0201229, allele C of TO-0201230, allele C of TO-0201231, allele G of TO-0201232 and allele G of TO-020133, and more preferably allele G of SNP TO-0201220, SEQ ID NO: 1 One of allele G of TO-0201221, allele A of TO-0201229, allele C of TO-0201231 and allele G of TO-0201233, for example one of allele G of SNP TO-0201220 and allele A of TO-0201229 in a sample of genetic material of a plant to be identified and / or selected. Preferably, at least 2 or 3 or 5 of the resistance alleles of the SNPs of SEQ ID NOs: 1-101 are detected.

[0210] The present invention also relates to a method for detecting or selecting a tomato plant having a QTL9 conferring resistance to ToBRFV and having at least one resistance allele of a SNP having SEQ ID NO: 1-101, in particular those having SEQ ID NO: 1-14, wherein the detection or selection is carried out under conditions of ToBRFV infection, comprising inoculation of the plant to be tested with ToBRFV, artificial infection or natural infection. The presence of the desired phenotype is information on the presence of the QTL9 of the present invention or a gene introgression sequence, in particular in a breeding scheme comprising parents carrying the QTL9 of the present invention.

[0211] The present invention also relates to a method for identifying, detecting and / or selecting tomato plants having a QTL11 of the present invention, identical to the method found in the genome of the seed LVSTBRFVRES2, said QTL conferring improved resistance to ToBRFV relative to a corresponding plant lacking said sequence, the method comprising detecting in a sample of the genetic material of the plant to be identified and / or screened at least one resistance allele of a marker of Table K, in particular alleles G, TO-0201237, TO- allele A of TO-0201238, allele A of TO-0201239, allele A of TO-0201240, allele A of TO-0201241, allele CT of SL2.50ch11_9684449, allele AT of SL2.50ch11_9779896, allele C of SL2.50ch11_9823405 and one of the alleles GT of SL2.50ch11_9924232. Preferably, at least 2 or 3 or 5 of the resistance alleles of the SNPs having SEQ ID NOs: 102-115, or 2, 3 or 4 of the 9 markers TO-0201237 to TO-0201241 and SL2.50ch11_9684449, SL2.50ch11_9779896, SL2.50ch11_9823405 and SL2.50ch11_9924232 are detected. According to another embodiment, at least 1, 2 or 3 of the resistance alleles of the markers SL2.50ch11_9684449, SL2.50ch11_9779896, SL2.50ch11_9823405 and SL2.50ch11_9924232 are detected. Alternative preferred lists of markers and resistance alleles have been disclosed above. Detection or selection can be performed under conditions of ToBRFV infection. The presence of the desired phenotype is information for the presence of a homozygous QTL11 or introgression sequence of the invention.

[0212] The present invention also relates to a method for detecting and / or selecting tomato plants, in particular commercial tomato plants, which have the QTL of the present invention, the method comprising detecting at least one of the above-mentioned resistance alleles in a sample of the genetic material of the plant to be selected, namely

[0213] -For the QTL on chromosome 9, allele G of SNP TO-0201220, allele G of TO-0201221, allele A of TO-0201222, allele A of TO-0201223, allele A of TO-0201224, allele A of TO-0201225, allele A of TO-0201226, allele C of TO-0201227, allele C of TO-0201228, allele A of TO-0201229, allele C of TO-0201230, allele C of TO-0201231, allele G of TO-0201232 and allele G of TO-0201233 are detected, preferably allele G of SNP TO-0201220, SEQ ID NO: at least one of allele G of TO-0201221, allele A of TO-0201229, allele C of TO-0201231, allele G of TO-0201232, or allele G of TO-0201233, or

[0214] -For the QTL on chromosome 11, allele G of TO-0201237, allele A of TO-0201238, allele A of TO-0201239, allele A of TO-0201240, allele A of TO-0201241, allele CT of SL2.50ch11_9684449, allele CT of SL2.50ch11_9779896, etc. were detected. Allele AT of SL2.50ch11_9823405, allele C of SL2.50ch11_9924232, and at least one of allele G of TO-0201237, allele A of TO-0201238, allele A of TO-0201239, allele A of TO-0201240, or allele A of TO-0201241.

[0215] Alternative preferred lists of resistance alleles have been disclosed above.

[0216] The method is particularly suitable for breeding programs having LVSTBRFVRES2 (NCIMB deposit number 43591) as the original parent or its progeny comprising the QTL of the present invention that confers ToBRFV resistance.

[0217] The present invention also relates to a method for detecting and / or selecting a tomato plant having a QTL9 and / or QTL11 of the present invention that confers resistance to ToBRFV, the method being based on the detection of any molecular marker that reveals the presence of said QTL. In fact, now that QTL9 and QTL11 of the present invention have been identified by the inventors, the identification and subsequent use of molecular markers, in addition to the 101 SNPs (SEQ ID NOs: 1 to 101) or 14 markers (SEQ ID NOs: 102 to 115) of the present invention, can be easily implemented by a person skilled in the art. QTL9 may be characterized by the presence of at least one of the 101 SNPs of the present invention, but it may also be identified by using different, alternative markers; the same applies to QTL11. Therefore, the present invention also includes methods and uses of any such molecular markers for identifying a QTL of the present invention in the tomato genome, wherein the QTL confers resistance to ToBRFV relative to a corresponding plant lacking the QTL, the QTL being characterized by the presence of at least one resistance allele having a SNP of SEQ ID NOs: 1 to 101, preferably 1 to 14.

[0218] Also included are methods and uses for identifying any such alternative molecular markers for the QTL9 of the present invention in the tomato genome, wherein the QTL confers resistance to ToBRFV, wherein the QTL is characterized by the presence of at least one resistance allele having a SNP of SEQ ID NO: 1 to 101, preferably SNP The present invention is one of allele G of TO-0201220, allele G of TO-0201221, allele A of TO-0201222, allele A of TO-0201223, allele A of TO-0201224, allele A of TO-0201225, allele A of TO-0201226, allele C of TO-0201227, allele C of TO-0201228, allele A of TO-0201229, allele C of TO-0201230, allele C of TO-0201231, allele G of TO-0201232 and allele G of TO-020133, and more preferably allele G of SNP TO-0201220, SEQ ID NO: 1 One of allele G of SNP TO-0201221, allele A of SNP TO-0201229, allele C of SNP TO-0201231 and allele G of SNP TO-0201233, and even more preferably one of allele G of SNP TO-0201220 and allele A of SNP TO-0201229.

[0219] Also included are methods and uses for identifying any such alternative molecular markers for the QTL11 of the present invention in the tomato genome, wherein the QTL confers resistance to ToBRFV when homozygously present, wherein the QTL is characterized by the presence of at least one resistance allele having a marker of SEQ ID NOs: 102 to 115, preferably at least one resistance allele having a SNP of SEQ ID NOs: 102 to 111, more preferably allele G of TO-0201237, allele A of TO-0201238, allele A of TO-0201239, allele A of TO-0201240, allele A of TO-0201241, allele CT of SL2.50ch11_9684449, allele CT of SL2.50ch11_977449. One of alleles AT of 9896, allele C of SL2.50ch11_9823405 and allele GT of SL2.50ch11_9924232; for example, allele G of TO-0201237, allele A of TO-0201238, allele A of TO-0201239, allele A of TO-0201240 and allele A of TO-0201241. The preferred list of alternative resistance alleles has been disclosed above.

[0220] The present invention also relates to a method for detecting and / or selecting a tomato plant having a resistance QTL conferring ToBRFV resistance as defined above, the method comprising:

[0221] a) determining the presence of at least one genetic marker in tomato plants which is genetically associated or related to QTL9 or QTL11 which is involved in resistance to ToBRFV, in particular which confers said resistance in tomato plants,

[0222] b) selecting plants comprising the genetic marker and the relevant or associated QTL9 or QTL11 involved in ToBRFV resistance,

[0223] Wherein, for QTL9, the QTL and genetic markers are found in the genomic region defined by TO-0201220 and the SNP with SEQ ID NO: 101, preferably in the region defined by TO-0201220 and TO-0201233 in the tomato genome, and for QTL11, in the genomic region defined by markers with SEQ ID NOs: 102 and 115, preferably in the region defined by markers with SEQ ID NOs: 102 and 111.

[0224] By association or genetic association, more specifically genetic linkage, it is understood that a polymorphism of a genetic marker (e.g. a specific allele of a SNP marker) and a phenotype of interest occur simultaneously, i.e. are co-inherited, more frequently than expected by chance, i.e. there is a non-random association between the allele and the gene sequence responsible for the phenotype, due to their genomic proximity.

[0225] The genetic marker is one of the 101 markers disclosed above for QTL9 or a surrogate marker and is preferably inherited with the phenotype of interest in more than 90% of meioses, preferably more than 95%, 96%, 98% or 99% of meioses. The same applies to QTL11.

[0226] Definitions and preferred features of the QTL or introgression sequences of the invention are as defined elsewhere in this specification.QTLs conferring ToBRFV resistance are advantageous as found in the genome of the seed LVSTBRFVRES2.

[0227] Therefore, the present invention relates to the use of one or more molecular or genetic markers for fine mapping or identifying QTLs in the tomato genome that confer resistance to ToBRFV of the present invention, wherein the one or more markers are located in one of the following chromosomal regions:

[0228] - in the chromosomal region defined by SNP TO-0201220 (SEQ ID NO: 1) and the SNP with SEQ ID NO: 101 on chromosome 9,

[0229] - Less than 2 megabase units from the locus of one of the 101 SNP markers of the present invention, preferably less than 2 megabase units from the locus of one of the SNPs having SEQ ID NOs: 1 to 14, even more preferably less than 2 megabase units from the locus of one of TO-0201220, TO-0201221, TO-0201229, TO-0201231 or TO-0201233.

[0230] According to a preferred embodiment, as disclosed above, the one or more markers are in the chromosomal region defined by TO-0201210 and the SNP having SEQ ID NO: 101, or by TO-0201210 and TO-0201233, or by TO-0201221 and TO-0201233.

[0231] Furthermore, the one or more molecular or genetic markers are preferably associated with at least one of the following resistance alleles of the SNPs with QEDID NOs: 1 to 101, with a p-value of 0.05 or less, such as with SNP Allele G of TO-0201220, allele G of TO-0201221, allele A of TO-0201222, allele A of TO-0201223, allele A of TO-0201224, allele A of TO-0201225, allele A of TO-0201226, allele C of TO-0201227, allele C of TO-0201228, allele A of TO-0201229, allele C of TO-0201230, allele C of TO-0201231, allele G of TO-0201232 and / or allele G of TO-020133 are related.

[0232] The molecular or genetic marker is preferably a SNP marker. More preferably, it is located less than 1 megabase, preferably less than 0.5 megabase from the locus of at least one of the 101 SNPs of the present invention.

[0233] The p-value is preferably less than 0.01.

[0234] Furthermore, the present invention relates to the use of at least one of the 101 SNP markers of the present invention, associated with a QTL on chromosome 9 conferring ToBRFV resistance, for identifying one or more alternative molecules or genetic markers associated with said QTL, wherein said one or more alternative molecules or genetic markers are:

[0235] - in the chromosomal region defined by SNP TO-0201220 (SEQ ID NO: 1) and the SNP with SEQ ID NO: 101 on chromosome 9,

[0236] - Less than 2 megabase units from the locus of one of the 101 SNP markers of the present invention, preferably less than 2 megabase units from the locus of one of the SNPs having SEQ ID NOs: 1 to 14, even more preferably less than 2 megabase units from the locus of one of TO-0201220, TO-0201221, TO-0201229, TO-0201231 or TO-0201233.

[0237] According to a preferred embodiment, the surrogate marker is in the above-mentioned preferred chromosomal region.Genetic association or linkage can advantageously be detected by following the surrogate marker and the presence of the QTL in progeny produced by plants comprising the QTL of interest.

[0238] The surrogate molecular marker is preferably associated with the QTL with a p-value of 0.05 or less, preferably less than 0.01. The QTL is preferably found in the genome of deposited seed NCIMB 43591.

[0239] The molecular or genetic marker and the resistance phenotype are co-inherited in preferably greater than 90% of the meioses, preferably greater than 95% of the meioses.

[0240] The molecules or genetic markers according to this aspect of the invention are preferably SNPs. They are more preferably less than 1 megabase, preferably less than 0.5 megabase, from the locus of at least one of the 101 SNPs of the invention.

[0241] The present invention also relates to the same method and use, wherein the marker is located:

[0242] - in the chromosomal region defined by the marker with SEQ ID NO: 102 and the marker with SEQ ID NO: 115 on chromosome 11,

[0243] - Less than 2 megabase units from the locus of one of the 14 markers in Table K, preferably less than 2 megabase units from the locus of one of TO-0201237, TO-0201238, TO-0201239, TO-0201240, TO-0201241, SL2.50ch11_9684449, SL2.50ch11_9779896, SL2.50ch11_9823405 or SL2.50ch11_9924232.

[0244] Similarly, the present invention also includes a method for identifying a molecular or genetic marker associated with a QTL that confers resistance to ToBRFV in a tomato plant, as described in the present application, comprising the following steps:

[0245] - Identify a molecule or genetic marker in the genomic interval defined by TO-0201220 and TO-0201233 or at a locus less than 2 megabase units, preferably less than 0.5 megabase units from one of the 101 SNPs of the present invention; and

[0246] - Determining whether the allele or state of the molecule or genetic marker is associated or correlated with the ToBRFV resistance phenotype in a segregating population of plants emitted that show ToBRFV resistance, for example in a segregating population of plants emitted that correspond to the deposited seeds.

[0247] According to yet another aspect, the present invention also relates to a method for genotyping plants, preferably tomato plants or tomato germplasm, for the presence of at least one genetic marker associated with resistance or tolerance to ToBRFV infection, wherein the method comprises determining or detecting in the genome of the tested plant a nucleic acid comprising at least one of the 101 markers of the present invention or comprising at least one of the alternative molecular markers disclosed above. Preferably, the method comprises the step of identifying in the plant sample to be tested a specific sequence associated with ToBRFV resistance in a nucleic acid comprising at least one resistance allele of the SNP of the present invention.

[0248] According to a most preferred embodiment of the method, the method comprises detecting the presence of a nucleic acid comprising allele G of SNP TO-0201220 or allele A of SNP TO-0201229 in the tested plant.

[0249] The present invention also relates to the same method related to QTL11 and to the chromosomal region defined by a marker with SEQ ID NO: 102 and a marker with SEQ ID NO: 115 on chromosome 11. The relevant markers or SNPs of this region have been disclosed in the present invention, as well as preferred lists.

[0250] In view of the ability of the resistant plants of the present invention to limit the damage caused by ToBRFV infection, they are advantageously grown in environments infected or likely to be infected or infested by ToBRFV; under these conditions, the resistant or tolerant plants of the present invention produce more marketable tomatoes than susceptible plants. Therefore, the present invention also relates to a method for improving the yield of tomato plants in an environment infected by ToBRFV, comprising growing a tomato plant whose genome comprises QTL9 on chromosome 9 and / or QTL11 on chromosome 11, as defined according to the preceding aspects of the present invention, and conferring resistance to ToBRFV to the plant.

[0251] Preferably, the method comprises a first step of selecting or screening a tomato plant comprising said QTL or introgression sequence of interest. The method may also be defined as a method for increasing productivity of a tomato field, tunnel or greenhouse, or as a method for reducing the intensity or number of chemical or fungicide applications in tomato production.

[0252] The present invention also relates to a method for reducing tomato production losses under conditions of ToBRFV infection or infection, comprising growing a tomato plant as defined above.

[0253] These methods are particularly valuable for populations of tomato plants in the field, tunnel, or greenhouse.

[0254] Alternatively, the method for improving yield or reducing tomato production losses may include: a first step, namely identifying a tomato plant that is resistant / tolerant to ToBRFV and contains in its genome the QTL9 and / or QTL11 of the present invention that confers ToBRFV resistance to the plant; and then growing the resistant plant in an environment infected or likely to be infected by the virus. According to a preferred embodiment, the plant to be identified in the first step contains allele A of TO-0201229, or at least one resistance allele of a SNP having SEQ ID NOs: 1 to 101.

[0255] The resistant plants of the present invention are also able to limit the growth of ToBRFV, thereby limiting the infection of other plants and the spread of the virus. Therefore, the present invention also relates to a method for protecting a field, a tunnel or a greenhouse or any other type of plantation from infection with ToBRFV, or at least limiting the level of infection of the field, tunnel or greenhouse with ToBRFV, or limiting the spread of ToBRFV in a field, tunnel or greenhouse, in particular in a tomato field. This method preferably includes the step of growing a resistant or tolerant plant of the present invention, i.e. a plant comprising in its genome QTL9 on chromosome 9 that confers ToBRFV resistance to the plant. The plant of the present invention to be used preferably comprises allele A of TO-0201229, or at least one resistance allele of a SNP having SEQ ID NO: 1 to 101. According to another embodiment, the plant to be used comprises at least one resistance allele of a marker having SEQ ID NO: 102 to 115.

[0256] The invention also relates to the use of ToBRFV-resistant plants for controlling ToBRFV infection or infestation in fields, tunnels or greenhouses or other plantations; such plants are plants of the invention, comprising in their genome QTL9 and / or QTL11, or sequences of gene introgression from tomato on chromosomes 9 or 11 as defined above. This use or method is also a method for disinfecting a field, tunnel or greenhouse by reducing the virus population.

[0257] All preferred characteristics of the QTL are as defined in conjunction with the other aspects of the invention, i.e., preferably present in seeds of LVSTBRFVRES2 (NCIMB deposit number 43591), and identifiable by SNP markers having SEQ ID NOs: 1 to 101 for QTL9; preferably identifiable by SNP markers having SEQ ID NOs: 1 to 14, preferably identifiable by SNP markers having SEQ ID NOs: 1 to 14. Allele G of TO-0201220, allele G of TO-0201221, allele A of TO-0201222, allele A of TO-0201223, allele A of TO-0201224, allele A of TO-0201225, allele A of TO-0201226, allele C of TO-0201227, allele C of TO-0201228, allele A of TO-0201229, allele C of TO-0201230, allele C of TO-0201231, allele G of TO-0202132, and / or allele G of TO-020133 can be identified by a sequence having SEQ ID NO: 1 for QTL11. It is identified by using markers NO:102 to 115, preferably allele G of TO-0201237, allele A of TO-0201238, allele A of TO-0201239, allele A of TO-0201240, allele A of TO-0201241, allele CT of SL2.50ch11_9684449, allele AT of SL2.50ch11_9779896, allele C of SL2.50ch11_9823405 and / or allele GT of SL2.50ch11_9924232 of QTL11.

[0258] In a further aspect, the present invention also relates to a method for producing tomatoes, comprising:

[0259] a) growing a tomato plant of the invention comprising QTL9 and / or QTL11 as defined above;

[0260] b) allowing the plant to bear fruit; and

[0261] c) harvesting the fruits of the plant, preferably when ripe and / or before ripening.

[0262] All preferred embodiments concerning QTL9 and QTL11 have been disclosed in the context of the previous aspects of the invention.The method may advantageously comprise the further step of processing said tomatoes into a processed tomato food. Sequence Listing <110> VILMORIN & CIE <120> Resistance of tomato plants to ToBRFV <130> B14263WO CS <150> PCT / IB2020 / 000546 <151> 2020-06-05 <160> 115 <170> PatentIn version 3.3 <210> 1 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; G = resistant allele <400> 1 gttgggaggc agaagggtat aagattggac actgaaattt ttgctactta ccgtaagctc 60 atcaacatcg actgttagaa acatcagaga aagatatttc tcagacagct cacagtagaa 120 tggagagatc attctacatg gaccacacca tgaagcactg aaatttgcaa taacctgcca 180 aaatttcact tgcgtaagaa rggtccaaaa tgccaaagcc agcaaaaatg taaaatttta 240 agcaagcaaa aggcgaggga tccatatggg gaaactgctg caccattctg ctattatcct 300 tctcttcgca tgtgtgcaaa gcattagagt taaagtgcct tgagtattgt tttttaacgt 360 cttttgaatt ttagtgcagc tgggctagag gattaagtta c 401 <210> 2 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; G = resistant allele <400> 2 tactgtacca atattcagtg caaggtatag gtgtccattc atgagggctg tcacccatga 60 acaccgaaaa tgctgctcac agtacttgct gagagcttca gacgaaccat ccatttgcag 120 ataatatcca gtgctcaaga taggggtgtt tgttggagcc ggtgaatttt ttccagaaga 180 gagtatatgtttgggatcac rgtctgtgac aatgacctcg ggatgtccat gtagcctaat 240 aatttcagaa gcaaatgaag aagccatagt ttgagctgtg aaggtagaag aaaaggcaat 300 gattgattgc ccatatttga gttaccagtc aaccaacgtc aagattgtta ccttcccttc 360 gaccccaaaa ggcaagtaat gcattggtac ctccttaaac a 401 <210> 3 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 3 tactatcgaa gggtaaaaat aaaaaacaag ttgttcaaat atccattaga atgaagaaaa 60 gaaaagcaag ttaggggctc ttggaccggg tggtatcaat gtctaagcaa tggttctcca 120 gaggcgtcac accattccaa gccttattca gcatggagaa aaatccctga aatctaatgg 180 ctcaagtcta gaaatagcct rgtcgataga cacacaagta aaaattacct ttaccgtctt 240 ctacatcatt agcattaggc gttctctgac cactcccttc ctcttctcct tttgcaaatg 300 acgacagaac atctcgactt cgagggaagt tttgggtggg attggagtaa aatcgtgtat 360 tcactcccca tactcagcct ccaagtccta tttaacctgt g 401 <210> 4 <211> 401 <212> DNA <213> Solanum lycopersicum <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 4 aagtaggaat acggtccatg gtctgtgttc atggattgag acataactta cccaatcact 60 taaatgaaca acagatgacc agcgcggagc attgttcaat ctattgtccg tatgtttgat 120 cataactgag gttagcagtt agttacggga aatttacgga ttggatcaac ttaaaattgt 180 cataaatttt agcacaaaat raattaggtt ctccataacc catgatatga tagataattt 240 aatattctct ccatatccac tgagtttgct aaaatttgac ctccgagtga aaagttatgc 300 ctattttagt gaaggcctat tgagtagacc ctaacgacag accgtctatt gaacaacggc 360 ccatcagtcc aggtcgtcga tttccgcgac aacaattagc t 401 <210> 5 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> C = Susceptible allele; A = Resistant allele <400> 5 aacaacccaa tattcttagg aaatgatcct taaaatggtg catcttgctt agacaaccaa 60 tgtaagggct acttgactag agagagaagt ctctgggatg attgaagcta ccacaacatt 120 tggtttagct cccctccatg tgtctattga tgatttgacc gctagggtca caacttgtga 180 gagcaagaaa ggggagaaat mtgaggcttt gtcttttaaa gacaaggtag caaagcagaa 240 gaaggacata gactatccaa agtctactga cttcacttca ttactagagg ctgctaatga 300 tttagaaaca attgatactt tagagattac ttcgcctacc accagagagg tacataggga 360 ggatgctaga attgatgtat tagatgctga aactgatgag g 401 <210> 6 <211> 401 <212> DNA <213> Solanum lycopersicum (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 6 cattgcgaaa ttgcatttgt tctcttaatc aaagtcttgt aactttgggt gatttagtgt 60 gttctcggtg aaccgatcgg caactcaccg actacacatt tatgtcgccg acttgatttt 120 tccccctccc ctccgggcta gtatacttga actgtaggcg aattggggag ccactcggca 180 gttcaccaat tggttttggc rattaccagg atcttctttt tctccacttg ttcagctcgt 240 ttttctccct tttttctaga agtgtcctgc cttgcttatt aactcatata ccttaaaatt 300 aatgctttaa caatagtttg tagaataaaa taggcattta aggacactca aactaccaaa 360 aaatatccct aaatgagtaa aatctttgac tcattattta t 401 <210> 7 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 7 gtaatagggt cataaaatac ttggtgtgaa tttaccaaac accctaagca ttggcagaaa 60 acatatagtg tttgaacccc tcaaagacga gacctaacaa atagaccatc tgcgcatcaa 120 cggaccgttt gtggggtctc gtgggttgac acttagcttt acatggagcc tgactaacaa 180 accttgaaga tccaacagat rgagcaagaa gacaggccat cggttcaacc attggctgtc 240 gttgcctttg ttggtgaaca cctcaaggaa atttttaacc aagatttggg ctctttctct 300 agggcccctt gtgggtcaaa ggtggggtcg tactaaacaa ttaaattcct taactatgta 360 atataggttt aggaatatct catgcaggtt ccaataaaaa a 401 <210> 8 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; C = resistant allele <400> 8 tgaaatgttt aaggtttaga ttggttggtt cgctcacata ggagggtaag tgtgggtgcc 60 agccccagcc cggttttggg tcgtgacaat tggacttcca tctgtggtga ttttaataca 120 ccgatatggg tttttcccat gctattatct tcactttagt ttcatgagtg caagcatccc 180 ctagttgaaa gagacctttc macattgaag gccatttgat ttaaggaaat gttacagcca 240 acattctgta tgtatccata ataataacat attttactct actcatgtcg gatgctcttc 300 cttaatatat gcttgcgcac ctattctttc acaagatcca acatattatg acatgtctgg 360 cttataagag tagtttgtgt gccccatttt ggtgttttgt t 401 <210> 9 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; C = resistant allele <400> 9 gacttgactc ttaactttta gtcaattgaa ttatggattc aaagttaatt atctcatgtt 60 tatggatgat tttaagattt ttgagtgtac cttaaagtgt gggaataaac tagaaaacat 120 aggtatgttg ctagggtact agtacgaaat gaagtgggaa aagattgatg aattggtaac 180 cctggcgcat taagaggtgc sggccgcaag tgggtaacat cagatactag tgtagggttt 240 tttggctggt atggagcccc agattccaaa cttcagcgcc cctaatgagg cgctttggct 300 ggaacagcgc cttagtccct tgcccagttg aattccaact tttcttgctc atttttcaac 360 tctaaacccc taatttcaac ttgattcttt acccaaacac a 401 <210> 10 <211> 401 <212> DNA <213> Solanum lycopersicum <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 10 tatgagagag aattttttaa accatctaat ccatgaaaag gcttcacaga cattagatca 60 gtacaaggac cgtcaatggg gttcgtcaac ctaaaactac agacagtgtg atatttttat 120 ttttttccat tgttagctcg tcatcctaaa agtgttttga gtgtgccgtt aagatatatt 180 ggtactaaaa atttctccgc rggtactatg tctcccaaga ggcaagtggt ttatacaaaa 240 aggggcaaat tcaagttagt tggcccttct tcttggttaa ttgatgaaga cctagactag 300 aagagggacc cagcctacat tccttcggac ataaaaacac caccaacaaa accctaaact 360 actaagagca ccattctaat gaggaccgca cactgttcgg c 401 <210> 11 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; C = resistant allele <400> 11 gaactatcta acttctttca tcctcctttt atgcgataga gttcatcttt ataaaagttt 60 ctttctaact cgtgcttgca cgtatctttt agatcatgcc tccatgaaga tttgtctgag 120 ctagtcgttc taggagcaac gttaaggatc aagaggtgcc caatgcacta gaagtgcgac 180 cctaaggaga ggtcacttct mggatcggat aatgagacag attgcgacca acaaagctat 240 gaaataaaga aagaattgac aggagctagt tgatacttct agcattcgtg agtacttaag 300 gatgaatttt tcaagcttca ataattcaag tgtgactgag gatccagaat attttataaa 360 atagttgtag aaagtgattg aggtcatgcg tgttgcttat g 401 <210> 12 <211> 401 <212> DNA <213> Solanum lycopersicum (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = Susceptible allele; C = Resistant allele <400> 12 aaaatttaac catcaaatct tcattaaaca tagacgtatg ggatctaatt cacctttgag 60 acctctttcc tcaaaggttt tcttcaaagt attttcaaaa gttgagtttt cttgtaggtg 120 cattcatccg aatttggacc tcccacagtg gttcaaagtt caaaaatttg atgtcattgg 180 aggaataggg aaccccttag mgcatctaag gtcctattgt tacaaactaa tgggagttag 240 gagtgataaa gctatattga tgcaactttt tggcagaaga ttgagcggag aagctttgga 300 actgtttaaa tctcacgaga ccagacaatg agattgctgg aatgcctcgg ctaatgaatt 360 cattgagcga gttgcttaca acgtagagat cgtccctgac t 401 <210> 13 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; G = resistant allele <400> 13 agttagtgag ttctatagtc tttggcaaga gttttggagt ataatatgat ggtaaaagct 60 tgtaaaaatg gtttccgtac ttacaatagg agtttaaggg gtccgggtac gactccccaa 120 ataccaccaa ggggtccttg aggaggaccc taacactgac caaagagatt tcaaaacaac 180 ttggttgatg gttgcaattc rtgaccagta ggttggtcta caccccgtaa gtcaagtcat 240 gcaccactcc tacaaagctg atcctcgggt gcaaaccaca aaggtggttg acgtacagta 300 acttctccta cagtccgtag gtggaggggt gtaggtgttt ccagttttaa gtaatttatt 360 ttagttaggt gtttggtaat cgattagtta tacaattacg g 401 <210> 14 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; G = resistant allele <400> 14 cattaagaga ctaaggtcgt ggggtaacaa tccatggacc aggaccacga cctgtgacct 60 ggcctaagat ccgtggatct ggcagtgggt cgacccttag aggattttct ggaccttttt 120 gggaagggtt gtaggttgaa atccacggac caccacttac agtctgtgcg tcaccctagt 180 ggtaactatg gattgcacat rtagcttctg gaattaacat gcaacttttg gatgttggtt 240 ggtcttttta ggataaaagg tgttacatta tctccccctt ggaaataatc ttcctcgagt 300 gaagactaaa ctagctgaat atgaaggaaa agagcttcca accctaccac taattactag 360 aaactgattt ctgactgaaa taagttccaa ggacatgcaa a 401 <210> 15 <211> 401 <212> DNA <213> Solanum lycopersicum <220> <221> Polymorphism <222> (201)..(201) <223> C = susceptible allele; A = resistant allele <400> 15 gaactatgag cttctgtcaa catctaattt gtcaactcat cagcatttaa aacacataat 60 tgactttgat atcgaggaca ccatctcccc attgtgcaaa agcctcaatg aaattttcag 120 atgttgactt ctataagtca actcatacca gatcaagatc ttgcttaccc ttcacatctg 180 atacaaaaga tgattccaaa maattttgaa cctctacaca accttcatta gaatatacca 240 tctaaacatc caatctggaa aatctatgaa aatcatgaac agaatctttc ttatcatcct 300 caacaggaga tacactacct aactataacc gactaagaac atttgtaacc aaatttatat 360 ttttaggatg atatagggaa ctttatgtcat aatccttcta c 401 <210> 16 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 16 gtcattatta taattagaat caataggaag tgataaaaca cttcagaaag acttaaacgg 60 acagaatagc gaaaagctgg taaaaatgat gatttgggtg catcttgggc gcaccccacc 120 agctccgaat tgattagggc tcaaaaatag cgcactgcta gcatgctact ctagtctgcg 180 tggcgctatt tgggactgtc rtgccatcct ttacttggga aaagattggc aaacttttga 240 tctcattttt taagttttaa atcgattaat ttcgattact tttctaaaat tcactttaat 300 gtaagatatc caaagcatat acacaaaatc taactcaaat aactcaagga aacaacactt 360 taatatataa aaaaaactct ttaatctcaa cctaactcaa g 401 <210> 17 <211> 401 <212> DNA <213> Solanum lycopersicum (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 17 ttagctagtg gatccaccta aaagatgaaa tatataggtt taccttagga aaataggaca 60 tatgtttttg tgtgggacat gacaccagat tctatacatc tcacattatt tatgtcggtt 120 aaggctaatt ccctacatga caagatcatg aacataaact atatttatga cttctcaagg 180 ggttctactt agtgtgagta rgggtatgag acttcactcc tgtattccac gagtagcttt 240 gaaaaggttt tatagtgtgg ttttcttaat ctatgaatat atatgaattt atgtatgtac 300 aatatggatt attgctataa gtggatttcg ttgttacaag ttgattaaca tatatgtttc 360 attgtttatg gatgaggtca aggtatgtta tgtatgatta g 401 <210> 18 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; G = resistant allele <400> 18 gcagcatgtc tcattaggtc tatctctcag ttagtagcta gccttttaaa ataatacttc 60 aacctagaca gacaaactag ccaataatat ttatttatgt tagaaacaac caacaaactc 120 actatttttt taatttataa ttcttgaaaa ttaccttctt gtcgatttct ttatccaaaa 180 gaagaagaaa gaaaaaataa ratagtctca ttgtcactta cactcacatc attagtggaa 240 tatcttttgc ataaaaacca caaacacata taaagggtga ttccaattaa acttccctat 300 aattgacaat tacctattcg ttaacagaat ctagagatat tatgacaatg atattacaca 360 tacatacact gaatattaaa agtctatatg attaacagaa a 401 <210> 19 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> C = susceptible allele; A = resistant allele <400> 19 tcatgaggct tctctcgggt agcggcataa ggaaatcata cagagggtgt agtatcatca 60 ttgtgactgg ccattttgag agagattaca aaaaataagg taagttagga tagtatagac 120 acgataggga tgcctagacg gaaagagaat ttttttggga aaattaagcc aatctactga 180 cctaagtcat cttgatgtag mggcaatcat cccgctacaa cgggatgatg caggccacta 240 caacgacctt aatctaggac gaacttcaaa cgcaaagagg gcgtattttt gtcccaaaat 300 ctgagtttta tcagtttttt agcatatcaa agtctataaa ctatcctaga acaagaacta 360 actaacatgt caaccaaata actcctaaat tgtgtctaaa t 401 <210> 20 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 20 ttgattacta acaacaagtg acttgattaa taagacaaca attgtttcat gatagaagat 60 tgaatcacta gtgaagtctt ctcgaagtat aacttcaatt tttaagaact ccagttatga 120 acttcatgat aattctgagt tcaagattcc tcatcatctt ttgtcttggg ggcaacattt 180 aaatcaaact tcagatgctc raccaaaata gattttgtgt ttcttttttt actttctcca 240 tccttaactt caatgtcaac ttattctcct tcatatgctt gtcttgaggt aattctgagc 300 aaaggtgcag aatctcatgc attagcactc tctttttttt tttccgttac atgtttgcaa 360 ttctttatag agatcttcca atgcctcaaa attatttgat t 401 <210> twenty one <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; C = resistant allele <400> twenty one gttttcttat tgtctattcc aatacattac ttctaacttt tctatttcca gatgaagata 60 cattcatatt aaagagattt caccatctca caaagagcta gcctagatgt aaaatgttaa 120 tgcactaatc ttatcgaaga tgaaaacata aatggaaatt aatgaatgta tgagcgtttt 180 ctttgattta tcacttttcc matattcact agttattaga aagttcaact aaatttatca 240 atttaggcaa tataaggcct cattaaagtc tgaggatgaa aaaagctgac ttaataacat 300 aagaaatcca taatctttca tttttaatct aaaacctcat atcgatggat aattgattac 360 taacaacaag tgacttgatt aataagacaa caattgtttc a 401 <210> 22 <211> 401 <212> DNA <213> Solanum lycopersicum (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 22 taaagtaaag ttaggcggca gaagataaca catggaaggg acaaggtctt tatctgaagg 60 ataagtaagt gactaggaga ctttaattga tgcgaaaaaa ctcaaatatg ccatcgaaat 120 tttagaaaag acttatttat atcatcttct agatatttgg ttaatttatg tcattgttgt 180 taaagaaaag acgcattcac rttttactcc aattttacaa aaccattttc tacacctcaa 240 ataaggtttg acgcttttca attggagttt ttggatcata tgcacacttt ttgcttcttt 300 ttctttaaga acaacaagaa cacatgaaga acataaacaa ctcccaaaat tttcaacatc 360 ttcaactctt cacgaaatca tctcaatttt cggctacatc a 401 <210> twenty three <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> T = susceptible allele; A = resistant allele <400> twenty three acatttgata aatgcaacat aaaaaataaa ttcaatccat tcacagaacc aacacataca 60 aagcaatcaa acttttatca gatgtgatat tcgatccaat caaaagataa cccatatcga 120 tgtggtattc gagataatcg atatgtatat caagggtggt atccgagcct atgaaaagat 180 atcatgtatc aattgtggta wttagaccaa ttgaatatac cacatcacac aatcagaatc 240 ataataaata caatcacatt tgtataaaca agtcaattgg aaaagtttat cgcatgagat 300 tgacgacaaa tatcatttca atttcatcca ttttctagtc cctaaccaca tattgtacaa 360 gtctactagc aaaataatta acttgaacat attacacaat g 401 <210> twenty four <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; G = resistant allele <400> twenty four tatacatgag aaaattgttc gagaagggtc gtcgaggtag gtgatggttg aattattttt 60 cattgtgtaa tatgttcaag ttaattattt tgctagtaga cttgtacaat atgtggttag 120 ggactagaaa atggatgaaa ttgaaatgat atttgtcgtc aatctcatgc gataaacttt 180 tccaattgac ttgtttatac raatgtgatt gtatttatta tgattctgat tgtgtgatgt 240 ggtatattca attggtctaa ataccacaat tgatacatga tatcttttca taggctcgga 300 taccaccctt gatatacata tcgattatct cgaataccac atcgatatgg gttatctttt 360 gattggatcg aatatcacat ctgataaaag tttgattgct t 401 <210> 25 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 25 atagagcctt aattttggtc atgccatctg tggatagtgg aactgcacat tttgaaggct 60 agagttaaga ttcaccgcaa tagtagaact tgttttagat gatgagttac atttacacca 120 tcatatgcac ttactagtag tagatctaac cgggggattc acaaatccca tgatgattgg 180 tttcagagac taacgaggta ragtgatgtg atgaataact aacctttgag ttttgattgg 240 ttaaaattag tgtatacttg agtgattcca taattatgcc atctcctaaa aacaacaaga 300 aggtacgcat taaaactatt ttagcattcg aggtcaagaa tcaaagatct cactttgatt 360 ataaatagaa ttaaagatct cgccttcact gtagcttgaa t 401 <210> 26 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 26 ttggtgagtc tattctagct gagattgtat cgtgattgta ccatttccgt caatcacaaa 60 agaaccatgg atgacttagt tgagttagat ataattttga attcattcta ggtatgaatg 120 gtttcattct tgttatgact caatcgattg aagaactcga gttgtgaagt tcaaaatccc 180 taatgagaca cttattgagt rgagaagtag ttttgtagtg cctaagggtc attttttttt 240 gtatcttaag gcgataaagt tagtttctaa gggttgttcc tatcactttg ttagagttaa 300 cgactctagt gttgagatgc ctcttattca acaagtcgca gttgtgagtg aagtttccag 360 atgatcttcc cgaagtccct catatgagaa atagacctcg a 401 <210> 27 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = Susceptible allele; G = Resistant allele <400> 27 ctttaaatat gtttttcgaa ctaaaaaagg ataagaaata ctccaactag cacaggtatt 60 ttgtacagaa aataaagaag agccaagtaa ctttttttaa aaaaaatcca aaagaaactc 120 tcatgtttga gcaacatcta atacttctag gacaacaaca aaaaatgctt aaaagatggt 180 aataacacta tgaatcatca rattaaacta attgcatggt aacataatga acagaacacg 240 tatacaccta aagacatgga tcatatgctt ggactaacga gaatacaata aaataaaata 300 aaacacattg tgtagtgaat ggggataatc ttaaataaag aaccaacaga ttgattaatt 360 ttgaggttct gcctcatact cttgttgctt gaatattggc a 401 <210> 28 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> C = susceptible allele; A = resistant allele <400> 28 tttgtaaacg aggatatgtt ttcaacaata ttaacaagat caaatcacat tatatttact 60 ctcaatacct aacattgatg actacaagac ttatctcaa agattcactc cttactatca 120 ccattatact taaggttcag ggtattaaaa tcacaatttt cattagtaga tgattctagg 180 cataattcgc catagaggtt maatttcaat tttactattc atgatccata ttatgcacta 240 aaatctagtt caattcattt ctatatgttc ctaatcttga aaattatgaa agttgatatc 300 aaatttagaa gatcaccctt gaatcctcaa ttttacctct catggcataa acccaattaa 360 tatcaattct atcaactaga ctagggttaa tcatgaaaat c 401 <210> 29 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 29 ttaattctgc actagttttc acgtctttatg taatgaatga tagcgaaaag gctagtacaa 60 gaccttcgaa aggttaatta cacaattgtt ccgatccaag ggtgccttat tctacggtgt 120 actacgggtc atgaaaaatt ttacccatag agtccattca gaacttgatt tctaagcttg 180 cgaatttccc caaaaattag rgttcaatct aagtcaaaat ttctctttca agacctttct 240 aatatttaat ttatcaataa ttatgattga attgttgatt aaatattgat ttatgaatcc 300 ccatatttct aaattgtgaa tttatgattt gggttgatcg aacataccaa aatgtgaagt 360 tattatgtct atattgattg agttattaac taatgatatt a 401 <210> 30 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> C = susceptible allele; G = resistant allele <400> 30 cgaggagttc ttggagatga gaagttatga ataaatgaat gttatacgca aaagcctaca 60 atttgggcat tttcaaactc tacaccacga tctgattact agcaattttg cagtttagct 120 tcaactgaat cccttttgta aaagtcatca atactctact tgtttaatct tttcttcata 180 aggacatatt tcaggtgaat stagagaaat cgtcgacaat cacgaagatg tatcttttcc 240 cacttctgct ttaaattctc atttgtccgc aaatatccat gtggagaagc tctaatggat 300 tgattgcggt gacacctttc tttgacctga aagatgatct tctttgattc cttcttacgc 360 aagcctcaca aattttattt tctagagaac atttttattc c 401 <210> 31 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> C = susceptible allele; A = resistant allele <400> 31 ttaccattgc atgtactata atccatggat ttttggtgat acgtcaatcc aacttgtttt 60 ttgacgaata tttttatggg aattggttag gaccttatta attacgtgat tggtaagtag 120 gggcaaacaa acacttttta aagttcgaaa tagccccaat gtggaagtga ccgaaattac 180 tattttacgc ctgttatagt mcatgaattt ttggtgatat attaatccgt cttgtttttg 240 gtcgaaattt ttatggacgt ccgttaaaaa cttattaatg gcatgaattg gtcaaaaggg 300 acaaagtaac aaatgcattt tcaagttcaa aatagtccaa tgcagtaaga gcatccccaa 360 gagtttgttc tactaactaa aaaacatgtt gaggattcaa a 401 <210> 32 <211> 401 <212> DNA <213> Solanum lycopersicum <220> <221> Polymorphism <222> (201)..(201) <223> G = Susceptible allele; C = Resistant allele <400> 32 atgcacaaac aaatttggat tatttatgcc acctactaga aatatttcac tgacttaaag 60 acttgatcct acaataatgt gagcatatat ttcttgagtg acatccaaaa taggcaataa 120 tgcttgtaga tatttcattg ctagttgtct tctttctgct gtttgattgc atcaacagaa 180 ccattactga aacggctgtt scttcttttg tttctatgtc gatattggga ccataacttt 240 gctacactct gaatgaaatc aacttgtata cttctatcat aaacttgagt attatccatt 300 ttaaaatatg cttttgcgca ggactctttg tcctctaact cgatgaaagc ataacagtgt 360 ctatccccag tttcgtgatc tttgataatt ttagcaaata t 401 <210> 33 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; G = resistant allele <400> 33 tcgtaccatt ttttgtctta aggcttgtaa gatgatctct aaagagtgtt catatcatat 60 tgtcagagtc aaatatttag actctgaaac tcctcccatg gagttagtct ccatagtgag 120 gaaatttcct aaggtctttc ctaatgatat tcccataact cctctcgaat gagaaattga 180 ttttgtatcg cattgctacc rgacacaaat cccatttcaa ttcctccttg tcggatggat 240 ctggccgaat taaaagattt gaagcttaaa ctcaagaatt tactaaagaa aggattcatt 300 aaaccttgca tttccccatg gggtgctctg tttctaattg ggaagaaaaa ggatggatct 360 cttaggatgt gtattgacta ccagcaactc aataaagtga c 401 <210> 34 <211> 401 <212> DNA <213> Solanum lycopersicum (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = Susceptible allele; G = Resistant allele <400> 34 aggaagtttc ttccgtaaaa gttcaatgga ggaatcattt agttgagggt gctactcagg 60 agccaagtcc gatagtatgt tgatatcctc atctatttcc ttctactcct actctagttt 120 gaggtaatga tttcctcttg gtttgtttta tgtgttgtga gtcatgtaca ttttatgtgt 180 ttccatgatc tcattttgtt rtgcatgttc ttgaaaaagc ctatgttttg aaagaaatga 240 cttatatgat ttattttcct catgatgtgt gcatttagta tgagttgcct atagacttca 300 taatatgaat agatgaacat gtataagata aactttttga gaatgaattg tttaaaggct 360 ccatgagatt gtgttgagcg tgttttagct tggagaagtt a 401 <210> 35 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 35 gaagtgagtc ttacatcttt ttgttcaact ctttttttct ttcttttctc tttctctttt 60 ttttccttgt aattgataaa ttttcgtgag tcacctctct tgattaattt ttctattttt 120 tcctcattac ttttttcatc ccgacttttt gggtcatcac tcataatagc caccctccac 180 ttatgaattt gccatgagtc ragctacata tttcccaagg ttaggtcaag gccaagacaa 240 ggccagtttc tgcattaacc tctccactta tgattttgac ctaagttgag ttgtacattt 300 tcaagtaggg accacggcca atacattaaa ctcatggtgg gtgacttggt aaaaaaagaa 360 aggtctatta taggttcaac aactttggat caaaaaatga t 401 <210> 36 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 36 ggatgtttgg actagaccca tgatatcctg aaaaacataa aagaagatgg aatccttcgg 60 aagcaagaac cctcaccata gttaacttga actccctatt gtatcaacag agctcctatt 120 gatgatcatg aataattggt tcttcattat aaaatgatgt agataaattg tcttagtatg 180 tgaaatatac gaatatttaa rgggaattca aaagcgtaaa cataagattg aactggtgca 240 atagaaacac acttaactct tctaaactaa gtcgtctcaa cgaaacatag ttcaattcta 300 ctcaattata tgatattcaa atcagtgaaa gaagagtcaa atcaacaata agatattcaa 360 cgctaggtac tcatcgatca ctagttttttc cacttaggat a 401 <210> 37 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; C = resistant allele <400> 37 atgcacccat atatttccca ctcactttgg atgaaaatga cgttgaaaga tatttttaag 60 tcgcatgtat tcaatggtaa aagatgtgca ccccgtctat ttcatgttaa agtcaggaga 120 gtctgacata gaatgatatt tttatgttac ttttattcaa atgtggatga tgtgcacctt 180 atagaatacg tattgaggta sgaggagccc gatgttgagg gatattcata gtaaattata 240 ggaattagaa gtctttacat atatctaatc gatgaactat gatatgtcga attgatggac 300 atgatttatt tttcccaaag atactaccag ttgctcatct tattctttct acagatgtac 360 atacattcat atctgacgaa tggattatct tcattcatcc t 401 <210> 38 <211> 401 <212> DNA <213> Solanum lycopersicum (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = Susceptible allele; G = Resistant allele <400> 38 caactcatac cccaaacaac aaatttcatg aaagaagaaa aggaatgaaa caaattgcta 60 gaatgcttta tagcttcctg aagattagat gtggactcaa cacatcattc tggatgattc 120 tattgcacat tttctcttct actggagacc ggtaacctgc gctctcatac aaattttttt 180 acgacccaac ccactggacc rtgcgggaac ctactctaat atcttaaaag gagaacccta 240 ttttcctaat tgttataata tacagaagaa taagaaaatt aagatataga aataatttca 300 tatagattta tataaataag aatttaaatt tttcaaaatt aaggcttgta aagtaattaa 360 aaccctactg atctagtcta aataggtata ttatccagta a 401 <210> 39 <211> 401 <212> DNA <213> Solanum lycopersicum (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = Susceptible allele; A = Resistant allele <400> 39 ctaatttaag caaatattaa gacgttaatc acgagatgat tagtcgcaac aaattgaatg 60 aaaacagatt atgacccaat taatacaact aaattaaacg caaagatttt caagtatgac 120 atagtgatga caatctgggc aaaatttaat caaccccaat atgcaaataa tagagtaaaa 180 agagcaaata ttgtagggtc rtaaatgctt agaacaaggt tcataactat tattcaaaga 240 aatcacagaa ccatagatgg aatttaggaa aattttgtga gaaaagtaga tagtaattta 300 aacaaaagca aacccgaacg gatctgtcga gatccccttc agatgaaaac tctagaactt 360 catgtgaagc tgatgactga tgtggtggct catcgctgtt g 401 <210> 40 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; G = resistant allele <400> 40 ccacttcccg tgtagcctct tcttttttct tgttcctcca aagtattttg accaaagcta 60 tgtctctact ccttaacttc atgacttgtc ggtccagtat agccactggg acttcctcaa 120 atgataggtc ttgtgtaggt ttagtgtctt cggttttgat gacatgggaa ggttgtacta 180 aaaatgcata acatagatac rtggaagatt gggtgcactg cagctaactc aggaggtaac 240 actaactaat acgctacctg gccagttaag cataaaattt tataaggccc aatatatcta 300 ggactcaaca tatctttcct tcaaaatagc ataacacctt tcataggtga caccgtaaaa 360 aatacaaaat catcaatcta aaaatctaaa tccctacgcc g 401 <210> 41 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; G = resistant allele <400> 41 ccatactacc caggcccttg gagcacttag acttactccg atttggccga aatgggcatg 60 ttgatgtctt ttatccttaa gaatgacgtc aattgctcca taatagggga aaatatgaca 120 tttggcacaa tacggggtta ctcagacttc accctactag accaaacaaa tattcaacac 180 aatacaataa ttttgactca rtttgaacaa taaaagaaag ggaatcatga ttaaagatcg 240 ataaataatg atttcactta aagttaggca aaggaatagt cacacgatga ttacccagtg 300 atattcaaaa acaaaataca gatttcattc gagttcaaac acatatagag tttgagtttg 360 gaaaccaagc ttttttgttg aaatatattt gaaatgttag g 401 <210> 42 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 42 ttttttgttg ttggcgaaaa gttgttgcca attctatatt ttgttgtaat ggacatgcat 60 gcatacacga tttacttaat tttaggttac tcatgactac tttcatggat ggtataacct 120 ctccatattt tgtaatgatg gctaagcctc ctcactctta agggtgtgat tatgggattg 180 gtattgattt aacttagtgg rtttattgaa ttgctctatt ttatggtcat ttatcatgca 240 tttgaaaatt ttgcaatgtg tttaattcat aaattgaggt ggccaactga tttttgtatc 300 gatcttacat tgatgcttga aagtgaccaa tatgagtggg tgattagttc attgtttgat 360 aactagtagt aaatccaagg taatggattg gatttaaaat t 401 <210> 43 <211> 401 <212> DNA <213> Solanum lycopersicum <220> <221> Polymorphism <222> (201)..(201) <223> G = Susceptible allele; A = Resistant allele <400> 43 atgatgtaat gttgttgtta ttggtggtgg tgttggaagg ctctacttct acaaaggaat 60 ccattagttt ttttattttt ttttgagagt tttttagggt ttaataagag aaggacatgg 120 tgtggaggtt gaggttaatt gttgatttga ataatcaaaa gatttctata tttgtaagat 180 acaagataga gactagagaa rgattgaaaa ttggagaggc aaaaaaggaa gagtttgatg 240 aaaggattga tggggagagtg aatgaaagga ttcctttttc tctctctttg tttagctacg 300 ataaaaataa cttttaacga taatatatat atatatataa ataaaagtac taaatcttaa 360 cgatattagt caatagtcaa aggattcaat gttaatataa t 401 <210> 44 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; C = resistant allele <400> 44 tgtgcaatca aaatacaaat ccaatgtacc atgttttatt gttatttttt gattctcatt 60 ctgcgtgcag agtccatatt gaagctccga tttaatatga atcaccacta taggcaattc 120 aggggtgact tattttctca caatccaaaa ctcaaatttg aaatattaat taagaataaa 180 acaatttcac taccgcaacg mtacctttat caaatataac atatttatag agtctaacaa 240 ctctaaactt agagtccaaa atccaaggcc ccacggctat gtaaaccgta caaacaaacc 300 cattgtctcg tccacatcaa aactaggcaa accacaaacg ggtcgaattg ctaacacact 360 cagatccgtg ggcctcattg ctcctaccac ttaagataat a 401 <210> 45 <211> 401 <212> DNA <213> Solanum lycopersicum (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = Susceptible allele; G = Resistant allele <400> 45 caaatccaat gtaccatgtt ttattgttat tttttgattc tcattctgcg tgcagagtcc 60 atattgaagc tccgatttaa tatgaatcac cactataggc aattcagggg tgacttattt 120 tctcacaatc caaaactcaa atttgaaata ttaattaaga ataaaacaat ttcactaccg 180 caacgatacc tttatcaaat rtaacatatt tatagagtct aacaactcta aacttagagt 240 ccaaaatcca aggccccacg gctatgtaaa ccgtacaaac aaacccattg tctcgtccac 300 atcaaaacta ggcaaaccac aaacgggtcg aattgctaac acactcagat ccgtgggcct 360 cattgctcct accacttaag ataataagat aataatagta t 401 <210> 46 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 46 attatatcat attagtaata taattaacta tattgtatcg tatatcgata gttaaatatt 60 aaaagttcaa tcgattaact attttaccgt tttttttata aattagaggt ggcaaagctg 120 aactcgagcg aatggtactt cttcagtttt cgagatcgaa aatacgctac tggttttcgt 180 acaaatcggg ccacaatttc rggttattgg aaagcgacag gcaaagatcg gacggttgta 240 gatccgaaaa ctcgttcgat cgtagggatg agaaaaactc tggttttcta catgaataga 300 gctcctaatg gaattaaaac tggttggatc atgcatgaat ttcgcctcga aaatccacat 360 atacccccta aggtaattct tccttcattt taatttattt a 401 <210> 47 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; G = resistant allele <400> 47 tatttatgga gttcagatat ccctctccta ataagaagtc tgaggtgtaa caattctcct 60 ctaaagagag ctcaaagaac atagagcata aagctgagat tgcaaaagga agtattgatc 120 ttccttcgta tgtaggtcct tataccatgg ttgggtaata aacatctaaa tacacaaatc 180 tagatttttg cgattttaaa raggaaaagt atgagcactg cgataaggtt gtgaaggtat 240 tgtctgccaa tgataacctg gatgccattc ctagattcta tgcaatcatc aagaagattt 300 tgtctcctgc atttaaattg cacataacaa ggttagttct agagcctcta aataaaggtt 360 aaaccaaatg actatatgag ggatttctag cttcttgtac t 401 <210> 48 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 48 aaacatcaaa gatcgccaat tgttcacata gtttagtaaa tgcatgtttt ggttgaaatt 60 tgtggtattt ttaggtcaca tagtatctag caaatgtata gaggttgata caaagaaatt 120 ggactccgta gagaaatggc atagaccact attgcagatc gatattagga gattttttgg 180 tttaatagga cattattgga rgtttgttga agtattctca tatgttgctt ctcatttgat 240 gaccttaacc aaaataaata taagtttgag tggctaaaag cttgttagaa agtcttccat 300 gaattgaagg ataggaagct tgtgagaaag acttccatga atagaaggat aagctttatct 360 ccaccccagt gtttacttta ccggagggta ctgatggctt t 401 <210> 49 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; T = resistant allele <400> 49 ttgttttggg ttttgcatta tgaaagttga atatatgaaa atgtgcatac cttctcttta 60 tgaaaatgat gtaaataaat ttgatgatgc tttcactttt aaaatatcat aagtaacatg 120 aataattaaa tgaatatatg atcgtgaatg tatgtttatg actcaagaaa gattatagat 180 gagagtgtgt atatgttcta wgaagctttg ccacatgaca tgaatcacac atctagactt 240 gccttcaacg ctttttctgc tgttttctta aattatgtct taattaggat attattcgta 300 tatgtcacca taattataag tcacgttttc aatattatttccactagtag taaagcatct 360 ctaacatgaa gtgaatcaat ctgggcctta aaagctcttt t 401 <210> 50 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> C = susceptible allele; A = resistant allele <400> 50 gacaaccatc agtatgagaa ttttgtttat acaacgttat acaaatattg ccagagtcgc 60 cctatacatt taaaaagtat aaaactgaac tgaattgatg gatcgactaa aacactttct 120 tgaggcaggt gaggagccgc ccgacttgcg gtttgaatct atctacgatt gctgcatact 180 ttatgattat gtaaaatact maatcgattt agataattac tcaaacttgt gtttttacaa 240 ggtaactcaa gtgtactcaa tctctatgaa aaccctttac atttcgggaa gtagtacact 300 cttttcaaag tgaaaaaaat atctttttaa gggtaaactg aacttctctt tgtctagact 360 gaaaagcttt gaaaaattgt ttattctctt ctagaaaata g 401 <210> 51 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 51 gacttttgta gagataccaa ttaaacgatt aaaagtccta aaactggaga aaagaaacta 60 gagtatatca aaaggaaaaa tacaagtata tatatatata gaactaaaat aagtaaaata 120 catcatgtgc tcacccccct gtccggatca aaatgctcca cactagatca atgttggcta 180 ctggtgctca gactttcatc rcaaaaatag atgcagagcg tagcatgaaa accaaacaac 240 aggtaaccag taagaatact aaaatgacta aacttgaaat tagaagtaaa acgaaaacaa 300 ggaatagcaa gaccataggt caagaacaga agtttaagta acaatgaaat gcacacaagt 360 gtagaaagaa ctacaaaagt aatgcataag ctatctacaa c 401 <210> 52 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 52 tcaggcactt tataatctct aggtacttgt caataacccc atctatatagac acacattttt 60 catcaagaat catctttaac cactctgcct tttatctttt cattgacttt ggcggaggac 120 catgtagtgg atgtgccaac actataacct gcacaggtat tggaggagta tcagtggtag 180 ggtaagtctt tgtgatccta ratggatcat ttagcttctt agtttatattgt tcattccttt 240 gagttattga tagatcatcc ttatcagaac aaacaccatc acattctgat ttgtgtgggt 300 catttttgta atagccatca ctgtcagtaa tagaatctga taactcaaag atctggtctt 360 agtctttgcc tttctcatca gttttagaaa gtttaatagc c 401 <210> 53 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 53 ttgctacata tgactattct atggcaagat gtaattcata tgttgataca taaaattgtt 60 atgttattac aaataaatta catgtgacaa cataagtaag tcaaatattg caacatatga 120 ctattttgtg atgaaatgga agtcatgtgt tgctacatat aactgttcga ttgtgacaaa 180 taaatcacat gtgtcaacat rtgtaggtta tatggtgtca catatggctt tctgttgtga 240 aatacaaata tgttattaca ttaatatata aatcacatgt tttgataaaa tgtataagtc 300 atatgttgca acatatgtct attctgtcgc gagtaaaata accactcagt tgcaacacat 360 ataaccatct gttggaaaca cgaatgtgaa atattgaaaa a 401 <210> 54 <211> 401 <212> DNA <213> Solanum lycopersicum <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 54 agaatcaatt ggagcaactt acgtcccttt catcgaccaa cagaacatcg attccaccat 60 acctcaacac ctagcaaaac cattggtgga agagtactta cggaagaaac aacgggccgt 120 acatggattg aaggggcatc gatgcctccg tattcccaaa cttagcctgg tggtgaaagt 180 ccccaatatt acaagtccct raccaagacg acggatgtgc agcacgaacg aggggcattc 240 cttagagtca ccaacggacc gtcgacgggg tctcgttagt gaggtcagtt aactttgagt 300 cacattctat ttgggtcatt taaattagtt aggagtttag ggggttaatt aagggattaa 360 gagaggtcta attaagttta ttagtcaccc aataaagtcc a 401 <210> 55 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = Susceptible allele; A = Resistant allele <400> 55 gggtattgct cctagagtaa acattgttga gagagatatt acatatttat tgagatattt 60 tgtgagaatg aatcctccta ttattcatgg ctctaaggtt tgagaggatc cctaagagta 120 cctagatggt atgtagaagg tgttgagtga catgggggtg acttctaggg agaacgctga 180 gttagatttg tacaaaatga rggaggttgc taaagtgtgg ttcactcaat ggaaatataa 240 taggccgcta gagttgatcc ctataaagtg ggaagaactt aaagaagatt ttataggaaa 300 gtactttcca catgagaaga gggaggtgaa ggtcgagggg tttataaatc tcaagatagg 360 aaatatgagt gttgactaat actttttaaa gttctctatg a 401 <210> 56 <211> 401 <212> DNA <213> Solanum lycopersicum (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> C = susceptible allele; A = resistant allele <400> 56 tcttaggaaa tgacctatga tgctgcccaa tacaggtact cttgtttatt ttgtagaact 60 tgtcatgttt tattttggta tcatcttggg tatggattag ctttatgagt gttttgcttc 120 cacaggttgt agaacaaggt cagtgtagtt ccaatttcct aatgaaacta ttctagagtg 180 gaaggcatga aatttgatgc maaggggtca aatcatttct tctctgatgt ctcgtatgat 240 catagccaag gttttttata ccatgtggtg ctggtaagga cctagaatgt caaacttctt 300 ttattgagtc aggcctatgc ttagagaata cctagaagtt tttcctattg accttccaag 360 agttcctcca aaataagaaa ttctcttcgg ttggcattta t 401 <210> 57 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; T = resistant allele <400> 57 ttttagttaa attaattaac tattcttccc ttaataccta aataatcaca gaaccactta 60 atttattata tgatttatta taaaaacatg caggaaattt aaccctcaca ggcgaaaccc 120 agttgacaat ccatttgtga gtcaacggtt ggtgcttgcc tccgtccaca acaatcgttg 180 tcttggtcag agactggtgt wggcaagggc ttcctccatt tttctaagtg tggttctacg 240 gtttgcaatt acacccccatc gatccataca caaatcgttg tctgtatctc gtcgatgcat 300 atttcctagg atgtgatgac atcaactttc tacgatcctc ctcgagggcc attgattggt 360 cattgtggag tcatatccgg acgttttgac catgaatcac c 401 <210> 58 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 58 atgacttaaa attctttgat tgaagattta atttacgatt ttgtaagagg tagttgaatt 60 ggctaaggtt gcattgtgta gtgtcggttg ggctgcatat aagtaaaaga aatatgattg 120 gagaagaggt gactgatagt caaccaggtc atcaggacaa tatagatgat aacaatagtg 180 cttataagtc atatcatgct rgcaaaacgg gtgctatttt cttacaaaaa gatcatggca 240 atgtaacatt tcaagtcact agcatgagtc tttatctcct taaaatgaag gaacattatc 300 gagggctaga ccatgaatac ccgcatcagc atgtaagaaa ttttatagag atatgcagcc 360 cgttttaatt caaggagtca acccggcttt ggttatatttca a 401 <210> 59 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; G = resistant allele <400> 59 aaatttctat ttgttggaga agagaaccat cataggcaaa tgattagttc cattatacag 60 ccactactaa aaggtattgt gatactctta ccactatcat aggcaaacat atgcgactcg 120 cgtagcagta cctacaatca accccacaac aagccaaaag gtttttccct gaacaacttc 180 aacctttcct tcaatattgc racttctagg tccatcaaca ttccaagttc aaagcagtaa 240 aacaacggga gaaaaattac acaactacaa tccaaaatca ctagagtcct ccttcaacac 300 aataaaacac taatacaaca aaaacaatgt atagacttaa ctttcaaaga ttcaagataa 360 tataataggt tcagaatttt tacctagaac accaactcaa g 401 <210> 60 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 60 atgcttgtga tattccttgt atatctaaca tatctgtatt gctatgctca tcatgggagg 60 caacaatatc taataactca aaatttgatt ttgtatcagt gttggggtta agtaaggctt 120 cttcgagctt tctttttaat cttttttagt cataatcctt ttgagatgat gaacttgtac 180 ttaacttatc atcgtagaca rctagagctt atcctttgat cttaatgatt ttgcttaaat 240 atttgatcct ctctaattca tgaatattga aggaccaact aataatataa gagatctttt 300 tggtgataaa gaattgcata atttaatata ttctgataag gtaaatatttctctctac 360 ttgaaacttc tcaaactgta tttgatgttg agttgacaat a 401 <210> 61 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 61 aaacactata ggaaaaaatc cttgtacttg atctgccagc aataacagct tttatgtcct 60 gattttgaaa ctgaaatttc tcattcttca atcttctcgg ggatagacct tgtttttgag 120 tcacacatta gatttcctct tccatgtcct gattatttta aggagtaaat cagtagtcta 180 atcatcatca tcaagtttct rtcaatattg attattcatg tatacttcat attcttaatt 240 cataacttca taatcatcaa tcaaagggac aatatttact tggcaattgc catgtacttt 300 atcaggaggt caactaggag gaggttgtta aaatattggt ctgctcagaa tgttacgcgt 360 acggtgttga ttatcctaat catcaagttc atgtctttta t 401 <210> 62 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; C = resistant allele <400> 62 ggagggtgac gattctaaca aagaaactaa aacagatcaa taacctcaaa gaggaccttg 60 gctaaatagt aacaatcatg agtaagtgta ggaagatact agaaagcatg gattttctca 120 taggggtaga aaagaatcta cgaaaaataa aactgatagt tttaacagac aacatagtag 180 ggctaggagt agaggtgttt satcattaaa gccatatttt ttaatgctag gagtataaat 240 acagttggtg catttgaaag actataaaac cttaaaaaac ttcataattt gactatgatt 300 gatgtgttgg aaccttttgc aaatcattgg tatattaaat caattatgtg tcatttacaa 360 atggatcatg cttattggaa tgtcaataat aaaatttggt c 401 <210> 63 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; G = resistant allele <400> 63 caactagact agcttccgga ggtctttgtt gttcttggac gtttcacttt caaaatcctc 60 taagtgactt gtaaagctaa tattcaacat ttttagacct tacaacctca tgaaacatat 120 attaggctct atttatacct aaatcatttt gggttccctt cagttatact ttatggaccc 180 aaattttgaa aaacttaagc rcatctccta ccctaaacaa gtatttcaac attcaatcat 240 gagaaattgt catactgagg cttccaagta cttaatttta aatttgaacc ttaagtcaaa 300 acttaaatac agatcatgaa gttctttttt acagtatgaa cagactatct aacttggtgt 360 tgctaattaa acaatcgcat atagttatgg acaatacaaa a 401 <210> 64 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; G = resistant allele <400> 64 aatttgaacc ttaagtcaaa acttaaatac agatcatgaa gttctttttt acagtatgaa 60 cagactatct aacttggtgt tgctaattaa acaatcgcat atagttatgg acaatacaaa 120 accccatggt caagacccac tcctgaattc caaaaaattt aactatgaac aaatattcat 180 gttttctaaa ggaaattgtt rccttagacg agacaaggag tggtgtgaat gtgaagcgac 240 actaagtttc caattaagaa cgcacaactt cactgaaccc ggacaccgaa gtaatatggg 300 aatggaggtt aagaagaatt tgtgtgactt ggatgatata gggggttttg gggatgatat 360 gagttggagt agggattgat tggtgggaaa aaggagtgaa t 401 <210> 65 <211> 401 <212> DNA <213> Solanum lycopersicum <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 65 ttcctgatca ctgtcattgt catgttgctt acattgtctc cttttagccg catccttttt 60 ttgttttcta ggcttgtttt tactcttggg agtcctttcc agagtactag tatcaatcta 120 cttcccttta tctttatttt tcactttttc aagttgtttt tttttaaaaa aagaattatg 180 tttcttgtta tccctgttct rcacctcttg ttgactctgt tgttaatcta tttgttgatt 240 cctatttgta gaattatcaa tggatctaag gtttgaatta tggtcagtat cgaacctctc 300 atacaaaaaa agaggcaaac tccctctttg gtatcccctt cctgcatgtt agtggttttc 360 tcctatcacc ccccatcaat acctccaacc acttcatcag t 401 <210> 66 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = Susceptible allele; A = Resistant allele <400> 66 ctctacagcc tgatcattcg aaggacttaa ggctttaatt agagactcaa tagtatcatc 60 atcctcatac gtatcatcta gagaatggtt gtccctatcc aattcatctt cagaaatatt 120 cacagcatac tcatcaatca aaggtattgt attaacttga catatctgtt tcatcttatc 180 tggtggttct attgacggtg ragtcatata tctagtctgc aaaggtataa tatctaaacc 240 tttgttgtca ttggccatca caaatttttt tcatggttca tgatcctttc ctaagcttgt 300 tactattcac tgttctgctg tatactttct ctcctattag catcatccct tttttgtttg 360 ctttggctta ttttttctct tggggagtgct ttcaggagta c 401 <210> 67 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> C = susceptible allele; A = resistant allele <400> 67 tgttataaaa aaaatgagat catctcagat aatattttca gtatataacc agtaatatca 60 tatccagtaa tagaattgtc ccacatgcaa gttaaaaagg ttcagtaaca catttacttt 120 atataccatg tgaaaatcat ccaaattata aaatatcaat tgtggtaaga ttattactca 180 cagtacttgt gttgatgcac maaacttgtc agagaaatca ataaggtacc aaactcgcag 240 agaaatctat aaggcttcct tcgataaatc acaatcacat gacatggatc tcgagataat 300 tatttgctaa gactaattca aaactaagat aaatattatt ttaaactctt ttggactcca 360 ttttccatca aatctctaaa ataaaattat tcaactcata a 401 <210> 68 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 68 aaaaatttta ggcatgggta gctacctgca ttgcggttct tgttatcacc tagatatact 60 cttccagaca ccttttcaat atttacctaa gccccgaaga aatgaccttt agcaggaaaa 120 atagagaaat aagttattat acaggaaaca agattgcaag acaatattca attagaagtt 180 ttaccttctc aaatctttct rcgtacactg tgtgaaatca aagagaacac acaaataaga 240 catcaaaaca taaaatgacc atactcacaa aaaagcagag aaaataaacc ctcaaaaacg 300 gtacacagga aaccaacatg tgctcctctt ctgtccaagg agtccctctt cgccatttaa 360 tatatgcttt catattttgg ttgccattgt tttgcaagtt t 401 <210> 69 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 69 catcatatgc ttgagagtct tacctttatc attgacaagt gatgttgcag tgtgattttc 60 taagcttgca tataactcaa ttcatacatt ggaacaattg catacggtgt tcatgtaaat 120 gtacttcccg ttgtctaaga agttgaaaca caaagacaaa cttaacaact tcatggaact 180 acctggagaa tctgtgagta rttctggtac aagttcattg cattcataag aagtgttttg 240 aatcaccgca ttgattatga gtcactcaaa gagtattttg gttaaggaca ggatgacaat 300 cgtaagaaaa tgcttgatac tatcatggag gatcatatgg tgaattcact tttgaggaga 360 tcggtaaaaa attagagaat atttcccaaa ataataaagt a 401 <210> 70 <211> 401 <212> DNA <213> Solanum lycopersicum <220> <221> Polymorphism <222> (201)..(201) <223> A = Susceptible allele; C = Resistant allele <400> 70 tgtggtacat caaaaccctc aactaagaat tgttggtgtc atcaagcaac atattgagaa 60 tctagacaac acttgtatag aagcaacaaa tttaaaacca agcaatcata tgtctctcca 120 tattgaatct tattttaagt aaagttttgt tctcttagac gcaaacagtc taattttttt 180 aacatccaaa caagacataa maaaccaata aataacacca aatataatgtttctctatcc 240 ctagagtacc aattttcaga caacgtcacc attgccctta tttcaacaga attccccttt 300 ttcgctcaat gtatatgaag atttagtata gggattcctt caactctcat gctcagaagt 360 aattatcaag gacatgtaat tctcaatacc ataggattga c 401 <210> 71 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; C = resistant allele <400> 71 caaagtcata tagtaacaca ccattccaca aaagactcat tgaaactata acaactccta 60 acatggttta accataacat gacatacatt tcccaacata aaataccact tcacatatat 120 ctcatatata cccacagggg aactatataa aaataagcca aagttaactt ttacacatac 180 tcatcaaacc ataataccaa sataagcata aaaacataca ttttctccct caggcataaa 240 gataccatct catccaagca aacacatcta caagaccaca ggacaagaaa atataagaga 300 gagatcatat agatttaact tctttgtcac gacatgagaa tgatgaaaaa gggaaaatct 360 atgttctata tcatcacgct catggattat cagtcaccac c 401 <210> 72 <211> 401 <212> DNA <213> Solanum lycopersicum <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 72 ttctctttga gcaagcgatg ttggcaaatg aaaggcagtg taaccctagt cttgcacgta 60 taacatatgc catgtgcgca ttggcagggc aacattagat cgaccaaggg caggcaacat 120 catccaagtc tattgtgctt caggaaagag acaacggtca atgtcaagta gtatcgtcaa 180 ggtgacctta gttatggaat rtcacattag ttgttgatat tgcacgtcgc tcaatcaagg 240 gtaggcatgg atcgctccat catctgtggt ctgtgcacac tactcagcag ttgttaggct 300 tggtctttct gcatcgccct tggcctgcat acaatcacta gacaacatca gatgtgggag 360 gcactcattttttcatggcc tgcaaattgc tcagccgact a 401 <210> 73 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 73 ttctctttga gcaagcgatg ttggcaaatg aaaggcagtg taaccctagt cttgcacgta 60 taacatatgc catgtgcgca ttggcagggc aacattagat cgaccaaggg caggcaacat 120 catccaagtc tattgtgctt caggaaagag acaacggtca atgtcaagta gtatcgtcaa 180 ggtgacctta gttatggaat rtcacattag ttgttgatat tgcacgtcgc tcaatcaagg 240 gtaggcatgg atcgctccat catctgtggt ctgtgcacac tactcagcag ttgttaggct 300 tggtctttct gcatcgccct tggcctgcat acaatcacta gacaacatca gatgtggggag 360 gcactcattttttcatggcc tgcaaattgc tcagccgact a 401 <210> 74 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> C = susceptible allele; A = resistant allele <400> 74 cacctagacc atcaatatga ataataggcg cgggataaca gataacacttc ttaagaatgg 60 ataaacggaa aacatgatga atcgaatcca ataaactagg taacctcaac tcataaggaa 120 ccttacgaat atttttcaaa atttcatagg gacacacata actagtactc aacttacctt 180 tcatgccaaa tctcaccacc mctttcatag aaattttttt ttgatacacg ttatcatttt 240 cttcaaactc tatatctcct ctccaattat catcataaga attttttaaa ctatagtctg 300 tttgcaaccg gttcctgatg atatgaactt tctctaaggt cttttagata aaattgggac 360 caagaagcga agactcccca accctaaacc acacaacctg a 401 <210> 75 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; C = resistant allele <400> 75 ttataactta gatgacagaa aagatgttcc gtacctctat gatctcttgt ttgggatttt 60 tttattgttt ggtttgtgaa ttggtggagg ttgtggattt tacataacaa aagtttaata 120 gaggagttga caaagcgata catttgtatg tgtgcaacca taagatttta aaggctgaaa 180 tggtgtgtgt ctgagtgaag maaaatcaag attcttaagt aaaaaaggag ggcgggtaaa 240 agaaacaaaa aaatgatgag aagtactccc tccatcactt tcacatatat tctttggaat 300 tcacacacct cttaaaaaaa tgatttaaat aagttcttac tattataccc aaaatgttcc 360 attaacctcg ttaatggggt tttcttatct tcactggatt a 401 <210> 76 <211> 401 <212> DNA <213> Solanum lycopersicum <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; C = resistant allele <400> 76 acaaatgctt tgtcttaaca catactcata ggtcatcaag accttcacat tatgcacatg 60 cttaagttat aatacgataa taccctaatt aataaagtaa tgttcgatga gtccagatag 120 tttcaaaata tataaagtaa caccgacgat gccacattgt ttcacaagca tagcacataa 180 acctataata tatattatag mgaaagatag gtcataatac caccaataaa atctcacaac 240 tttactccac aataaatcaa taaacttaat atgccaaggc tcttacccat agccatgatt 300 actaattcaa tcaaataatt caaatctaca attaattgaa gatatgaatt tatcatttta 360 ggaaacctta cttacaattg tatcataatt tttcataatt c 401 <210> 77 <211> 401 <212> DNA <213> Solanum lycopersicum (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> C = susceptible allele; A = resistant allele <400> 77 attttttaat aaggttcaca cacaatataa tatatcctta atcttatatt gaatccttgg 60 ataaatagtc ctaatctcgt ggtccctatt cttcttcttc tcatatggtg ttcgtgagag 120 ttccaatgag agagacatgg gttttgattt gaagtctaga ttctaagggg ttcttttatt 180 ttttaaatag tcataaaaca mctaaaaata ccttaagtaa ccacatggtt tgacttttcc 240 aattcactct tttcacttaa aagtgaattg tgagaaatgc aggctccata gactatttga 300 cattgatcga ccactggttt gaaaattgtc catcctgtat atacgtagtc ttggtaagag 360 acttctacaa ggttcccttt tctcaggaga gagtctcaat t 401 <210> 78 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; T = resistant allele <400> 78 gcatatatgtttgtatttaa taataatatg aatcgtacca aatgaaatga atgaatatga 60 ataattgtat cccatgaatc aacatttgat tgtttaatta tgagaattaa caatgtgatt 120 gtgattgtta catgtagaat acattaggta tttcgttcca acacaatagc tgggagcgga 180 tatcaggtat cgacatatat wttatactgg gcgtcaaaat ccatcatact aatagtttgg 240 gtgtaggttt aataagagtg acattaactt gtcatataag catattgtat ttaatgtgta 300 aatggacatc ttttcataaa gataattgga ttttatatta tcttcttata tgtgacttca 360 tagtgttgta agctaattgc ttatatctca taatgaatga c 401 <210> 79 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> T = susceptible allele; A = resistant allele <400> 79 gacttacact attttttttg gagaggctac atgtgtgtca atattgtagc ttgaataaaa 60 agaaggtaat atgtagtttt taggtgtgta ataccctata taaaaatata taataagggc 120 atatatgtca tttgatacta ttttaaaaag aactaagttg aattgttttt atattgacct 180 aatggagttg tttaaaaaaa wtgggctata accctatagg aaaagttgta cctggcaaca 240 aataaaaaaa gataatgggg atcaagaggg gttcgctgcg tacatcacca agaagaaaaa 300 gaaaattttg aataagaaag agaggaagcg tgaaaaggag aggggacata tgtagaaaga 360 aaagcaaaga attcaactga agaacttaga ggggagactt t 401 <210> 80 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> T = susceptible allele; A = resistant allele <400> 80 gacttacact attttttttg gagaggctac atgtgtgtca atattgtagc ttgaataaaa 60 agaaggtaat atgtagtttt taggtgtgta ataccctata taaaaatata taataagggc 120 atatatgtca tttgatacta ttttaaaaag aactaagttg aattgttttt atattgacct 180 aatggagttg tttaaaaaaa wtgggctata accctatagg aaaagttgta cctggcaaca 240 aataaaaaaa gataatgggg atcaagaggg gttcgctgcg tacatcacca agaagaaaaa 300 gaaaattttg aataagaaag agaggaagcg tgaaaaggag aggggacata tgtagaaaga 360 aaagcaaaga attcaactga agaacttaga ggggagactt t 401 <210> 81 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> C = susceptible allele; A = resistant allele <400> 81 atgaaccccc aactctgtaa cagagcctta tggtataaat gtgtactttt ttaaaaaatg 60 tttggggatat tataaatgaa gacttgatgg gagtggaatt agattttttc agtgacaagg 120 agatccccat gtattttact cattctttta tagtgcttct actcaaagtg aatgatcctt 180 aaaatttgaa ggagttaagg mctattagtc tgagcaactt cattagtaaa atcatttcca 240 aactattatg cacaagattg agccctattc tgcctaaatt aatctatctc aacaagtatg 300 gttttgtaaa gggaagaagt gtaactgaaa atatcatgtc ggcacaggaa atcacccatc 360 aaattaaaaa tactatcata ggtagcaatg tcattatcaa a 401 <210> 82 <211> 401 <212> DNA <213> Solanum lycopersicum <220> <221> Polymorphism <222> (201)..(201) <223> C = susceptible allele; G = resistant allele <400> 82 agcaaaatga ctgacttatt tctcatcctc ctatgaatca attacaagaa gtggtcttct 60 ctatgaaccc ccaactctgt aacagagcct tatggtataa atgtgtactt ttttaaaaaa 120 tgtttgggat attataaatg aagacttgat gggagtggaa ttagattttt tcagtgacaa 180 ggagatcccc atgtatttta stcattcttt tatagtgctt ctactcaaag tgaatgatcc 240 ttaaaatttg aaggagttaa ggcctattag tctgagcaac ttcattagta aaatcatttc 300 caaactatta tgcacaagat tgagccctat tctgcctaaa ttaatctatc tcaacaagta 360 tggttttgta aagggaagaa gtgtaactga aaatatcatg t 401 <210> 83 <211> 401 <212> DNA <213> Solanum lycopersicum <220> <221> Polymorphism <222> (201)..(201) <223> C = susceptible allele; A = resistant allele <400> 83 ctggcagctg ttgatgagga gaaatctata ttgctagaat gtttgaaagt tggctagtag 60 gtgcctgccc tattagcttg cttcaactcc atttcccttc ctcctgaaat tcaaccaatt 120 ttgagttgtt aaatctgtta ctatttgtgg tgaattgttc taatggtcca attccaagcc 180 aattatctca ccaaaaggaa maattccaag cttgaagttt ccattggatg tattgctcta 240 cttgttgtag gttcatcagc atgtatttcc aagttaaaga atctccagta tcccaatttt 300 tgcttacagg gttggacctt tgttggtatt ttactctaaa aaattctccc cataaggttt 360 gtcttgttca aaaaatccac catcgtttga attggaaggc c 401 <210> 84 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; C = resistant allele <400> 84 agtttatgtg atcaatatag gctatattga tgccttatat gtctataacac aatgttgaat 60 tttgaatctt cctaattgac tatatgaaca ctatgatgag ttattgtgtt tattttgtag 120 aagtgtgtag ggggacttgg agtattctaa agtttaacct acgtgatact tgaataatat 180 tgtacatgtg ataatatgat mactaagtgt gtcttgttta ggtaaaccga tatcccttac 240 ttgatacatg aaagaatgtg aataagaata tgcatccttg acttaataag aaaagcaccg 300 ttttgattaa tgtatatgta tgaataaata tgatctttaa tatagtaaag gtcatttatg 360 tggaatcatt tagaaagaag tttacgatat ctttgatatt g 401 <210> 85 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 85 atttttagtt cctttagtta ctccttttga cattatcaat ttatagattt gcacttttaa 60 cataagacaa gttcgtcatt tctagggttc caattatatt ctattattaa cctacttaag 120 tcacaacaag gagctctaag ttggaatatt tagacagaca gagacacgga ctttttagat 180 agacttaata gactacacaa rcgcattcta tcattccaag ggacatcact acactagttt 240 tagcatgcaa tttcaaataa tttagtccaa aggacaagac caccctctgt atttctgtaa 300 caaactatga actagaattc aatgttaagg gaaaacaaaa taccatcaat gcagagtggt 360 gttgttgtga gttgaactat taaggagtat cctacgcaca c 401 <210> 86 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; T = resistant allele <400> 86 atcatcacta cttaatgata caaggaaatg ttttgccaaa ttgttcaaaa ctcaaatcac 60 taagtataga gcggaataat atatggataa ataagtaaca ttgggcatga cacataggca 120 aactagacca aaagggagca tgcaagttat acaagcattg cgcaatagaa ttacacggtg 180 tactagtgca tatgacctat wgggtagagt gtgagcgaaa gaactaaatc aaatgtagga 240 atggagtaga tgatcacatg aatacataat ttaagacatg tagactatat gacatgcaga 300 catataaaaa tgaactactg accagaaatc acattgagta agtgtattat atcgcataaa 360 taagtggaat aacatggcaa tgagtacaca tatgtaatat g 401 <210> 87 <211> 401 <212> DNA <213> Solanum lycopersicum <220> <221> Polymorphism <222> (201)..(201) <223> A = Susceptible allele; G = Resistant allele <400> 87 tcaaggaccc ttcgggcggt ccttagggat tcgtgactag tcgtttggac cctttatact 60 atatttgacc tatttaactt gtttttacaa gttttagact tcatatgaaa ctcccaaacc 120 tccaccacaa ttagggagtc tactacttcg atttagctat tttctagacg tcaatgtttt 180 tagttttcat tttggatcta rccttttcag taacatactt tattacatca aaataggctt 240 ggaaacatca ttttaaccat tatgtaaaag tcgacgcgca agtctaagtc atggaacttc 300 aagagtgtta cacttaagcc cccacacaac agtctatgac aataacaatg gaccagcagg 360 atggtccatt ggtaagttga tcttccttcg actgtatcgt c 401 <210> 88 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = Susceptible allele; C = Resistant allele <400> 88 cttggggttc tcattcactt tctacacaaa gaagatagga gggttcatcc tagtgaattc 60 cttcaagcgg gaagccgtgg tactagcatt ttgttaaaca cggagtccaa catccctatg 120 tacttgaacc tccatggctg cgacttgtga tttggcagtc atagcttgat ccaaagtaaa 180 aaatgtggac catatatctt maatcatgaa aggtggagga atgaccgaag gttgttcttg 240 aggaggcact tagttatatt gtggagggac ttggttttct tggggaggaa atccctcctt 300 agacaagtct tccccaactt ttctttcagc tgcacgtgta gtagtcatat cctatatcca 360 caaaaaaaat gattagaagg aaaaagacat gagaggattt t 401 <210> 89 <211> 401 <212> DNA <213> Solanum lycopersicum (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; G = resistant allele <400> 89 actttgaatg ccttgtacgg accataggac cttgtatagt ctgtacttgc ccttgtttaa 60 acttgtatga gcacactctt ttgcactttt attttcaact gaacttttaa tttcggaggt 120 gctacaaaag gctcattcat ataattattt attcactcaa atgaaatgaa tgaacaattt 180 ttttaatcaa taccattagc rctatatatc agtcggttca gctaagtttt gaagtttatc 240 gatttgactt atcgataatc agtttgtaga tattctaaac cattgagata ttttcattag 300 tgcggttatc aatttatcaa ttaagtgtga cataaacaac aatctttgag aaattgcata 360 tgagttgaga aattgcactt gctaagacca tctccaacct c 401 <210> 90 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 90 ctagttatca gtgtgaagca tgccatatct ataatttagg agactacaac actgcacaaa 60 atttctagct tctttcacac tcatttcgtg cattagagtt tgacctccga aaagtttctt 120 cctaatacgt gcattcgtgt gtttttaagt taatcatgcc tccacaaaga gcacttaaag 180 gttgtcctcc taggataaat rttgaggatt aaggggtaac caatgcacct gaagtgcaac 240 cccttgtaaa agttaacaat gttgagttct ctaagtctat ctcgatgtat agtaaaggtg 300 ttactaacca tgtttggaaa aaatgagggg ctagaaagga tgtagcgcaa cttcggggat 360 acgagagttc tagaggataa atccttcaag tttcactcta a 401 <210> 91 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; T = resistant allele <400> 91 aaagtttctc taaatttgta actacaaaga aaggaaactt tgggtaagga aactgacatc 60 ttttacatct ctgcttatta gttaaagagt tacaactata gattcacaca gacatttaat 120 ttgaagtgtt ccactttgtt taagaacata agtcatcaat aatcagtagt ggatatatct 180 acagaatgca ataatttgtt wactttgtga caggtctatt tgaaactcca agcacatgct 240 gcagcaagaa tgggaaataa tgtcaagaac tcatcagctt tcctaaagtc tccaacttct 300 acattacttc atacaattag tgaatctgag aaggcatcat atgttgccca tattaacaac 360 tatctcgtgg gagatgaatt tttgaaaaaa ttccttccta t 401 <210> 92 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 92 atttggttat cttatcttaa tgtatccttg ctaatgccat acattgacag aagaggtgct 60 caaacatgat tttcagcaat tattttgcta atcaagaact tggtttttgc tcaatatgca 120 aagagtcctt tacactttgt cctcacgtct ttgttacgat gtattaatac caatccattc 180 atgtgaacga tttctcaaat rtgtccacca tatctctctc tcaatgaatg acaacgaata 240 tgtattgaac atagtaggac ttagaagttt taaagggaat tagtttggca acctctcgcg 300 aactacaatt atcagggaac tacatgcacc aaggcaaaac agatccaaag aatgactgaa 360 tgttttttcg ctagtgagac cttagggtta tcaacaattt c 401 <210> 93 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = Susceptible allele; A = Resistant allele <400> 93 aagatagcct agtagtggta agttcctttg aaactatgtg tgacttccat ggtttaaatc 60 cccctggcta gaattttact ttttttagtt tttttttttt taagttccaa ttccgttttt 120 acagtttttc ttttaaaaat taaaacatgc taaaagtgtg gttttaaatc caaaagaaat 180 caagggtcac atttcttggg raaaaaattg ttggcttatt tacacgttta tatttttatt 240 ttttgaatcc ctgaatgaaa atcctgggtc tgccactgct aggtgtgtgt ttatcgacgc 300 aagtcctaaa aaaattacta ctgctttcaa aactaataag ccagaaaaaa ctgaaccaaa 360 tggacggtaa ttctttagtt tggtttgatt tggttttaga a 401 <210> 94 <211> 401 <212> DNA <213> Solanum lycopersicum (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 94 gttttttggt tcatctattg gtgtatttat agtgtatata ctggtagaat tgttaaattt 60 aggtcatata taaacaccaa ctagcatgat agttttttgg tttatctatt tgtgtattta 120 atgtataatc tggtgtagtt gatatattta aggtcataca tagtcaccaa ctaacatggt 180 agtttttatg ttcatcgatt rgtgtatttg aggcatctac attgattcag agaaaaaggg 240 cttgagttgc agcaacttct attcttaatg gacaacaggc tatcacagat gatagccttt 300 ttactaggaa ttcagatagt gtattttttg gtgtagttga tatatttagg tcgtatataa 360 acatcaattt tcatggtata tttttggtcc atccattggt g 401 <210> 95 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 95 ttcttgtcat atctatagtc tatagttata tgaacaaaag agttacagaa ctccacttct 60 ctacaatata ggatttacaa gatccctact taatgttttt gcttaaggtc ttttcttggt 120 cttcgacttg ctctgtgcgt catctgtgag attgatcttg actctctatt ggcggcttgt 180 ggatcattct caggtaactt ragttggcgg ttcaaactct aaaataaaca tcacaaaatg 240 acgaatctga atgggatgtg ttttttttag gaaaagaaag atacgagaat ccggaactaa 300 gacgtataat cctagattga aaaggagaaa taaggtgtat tgccttgaga gtttcaaatg 360 agacgtattg tcattgtggg ttgacctacg attatgttat c 401 <210> 96 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; C = resistant allele <400> 96 agcaaccaca accgatgagc ttagacagca aagcatagtt gtcttaagca gacaagtctt 60 actttcatga cgccttgtta gttgtttagg agtgttagtc taagctatta gaacaacttg 120 atctgtgtca gtcatagcca tcaaaaaacg cttgatctct tttgttgaat cctatttgca 180 tgaggttaac tttgacacct scagctgaat tattgaagct cttctacatg tttaggctta 240 atgttgttga tatcttaatg gaccttatga aactgctttg tgctaggctg tggatgaagc 300 ggaagaaaat gtttttctgt tttctcgtgg tatcaaaaat ttgtgggtcc aaggaaaaaa 360 ataatgtgat gttctgcgtt cgattctctc tattttgagc a 401 <210> 97 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; G = resistant allele <400> 97 ataccaagtt ttacacgccc tcaacattca ctttggatgc gactgataat caagaactat 60 tgttgaccac aagcgagccc ttggcgtggc ttaattctta gaaggagact tactcatgat 120 aagattattt taaaagtaac aataactcaa atgataactt agaattttta gaaataaaaa 180 ttcaactacc caaagtggta rctcaagtaa acataaaata aatgaaaagg agaagacttt 240 agaactagta tctatatatc tatctttgaa atctctaaat actatgagag atatagggac 300 aagactacca accaccctaa caaaactgaa taacaaaaca taataaatgg atcttccgaa 360 aatcaaggag gctcatcaaa tgactctgaa ctcgactgga t 401 <210> 98 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> C = susceptible allele; A = resistant allele <400> 98 actagaggct ttatgaggag tcacccgaat caatggcacg atcctatcct acggtggttg 60 tgtagttatg gggtataatt tatctaaaca ctttcctaac tccgtattca atacaaaac 120 tctcaaatca atgcaatgat tctcaataac tgtataaggt tccatgttag aaaaaaatgt 180 cccaaggaaa aattaagaat mtctatcttg aattacaact caatttaggt tcgactctct 240 gagtgttggg aagtgatcttttgggctatt gtagtaatcg gggaacttcc acggatttat 300 ggattatgta ggtaaatggg gccaaagact acatttgagt tcctcaggat agtttgagcc 360 aatgtggtgt aataattttc ctcgattcta atgttgttag t 401 <210> 99 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; T = resistant allele <400> 99 attatcatac cagtgttgtt gaaactgatt tttgaaatga taatttcaaa taggacaaat 60 attttttaat gacgatttag acttgtcttg taaaaata atgttgattt ttgatgcatt 120 attttggaaa aggggcattg ataatatatg agaagtacca taattttgat actaaattag 180 tggatttttt gtggcactaa wggggtacaa tgatgtaaaa tgaatttcaa aagtcattga 240 tggatatgtg tctatcctta acagtgtcat aagatgaaaa tagctaagtt tttgtttagg 300 agtagactga gaacatttgg aaataattgt gcatctagcc acatatataa cattatcaca 360 ccaaattaag agtgtccacg atttgtttca caaacagatc c 401 <210> 100 <211> 401 <212> DNA <213> Solanum lycopersicum (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = Susceptible allele; G = Resistant allele <400> 100 actcattcaa caccatcgtc cttcatcagc ttctactttt gagcgtactc atacttttgc 60 gacccttcac tctaaatttc cttataattt cttttgcata cttcttctgt caaatgaata 120 tttcatcttg gatttgttta acctccattc caagaaagaa agtcatctct ccgagatccg 180 tcatttcaaa gactttcatc rtctcctttt tcaactcttc tatgagcaca acattactcc 240 tcttactaaa agatcatcaa catacaaaga aattataatg atgtcagtgt taaaaatgct 300 ttatgtaaag agttgaagca cttaggcttt tttcaaaacc taagtaagaa agatgatcat 360 cgattctact ataccaaacc cttggaactt gctttaattt g 401 <210> 101 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 101 ctaaggattc cgtacgactt tacagaattg aattcgggtg ggtataactt tcgaaattga 60 tcttagagtg ttttctgagt aacgttggtt agtggtgcat tgtgaaatat ggaattgatt 120 aaatatatca ctttttcgtg taagcctccc tagcactgga ttttatcaat ctggcgggac 180 cattgtggtg gatcagatgc ractttaagt tgtaaatgaa ccccaaatgc ctttattctg 240 tacttttcga ctttggaatc taaggaatgg ccctgcaact ttttgatagt ttcccaccat 300 tcttaagtct aaaggtaagt gttcacctcc caaatccatt tttctatttg taaaacctat 360 tctcttgggt tattatcaat gggggaggat tttttaattg g 401 <210> 102 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; G = resistant allele <400> 102 gttactttaa tatttaattg tattataata aattctatat actaagggat gcagttattt 60 tataattttg agaaaataca tggcatattc gttcatctta cttgtgacct tttttttaat 120 agattatagt acattcctta ttaaatgggt taaagctatg atctggaaat ctccatgctt 180 aacgtctgta tgttttcaat rctatggtca aacaatttgc tcatataatt tgtgtacgtg 240 ttatgaattt gggatttttc atatgagtaa aatagttttt aaaaaaaatt ctgttatgtc 300 cttgtgggca taggttcaac cttgaagtaa atttagggat cataataatg ggtgttgtta 360 attttgaaat cttattatgg tcatttgttt gagtagattg c 401 <210> 103 <211> 401 <212> DNA <213> Solanum lycopersicum <220> <221> Polymorphism <222> (201)..(201) <223> T = Susceptible allele; A = Resistant allele <400> 103 tgcaacttct attcttcctt ccgcaggtgg gagctgtgta ttttatttat cttgtctagt 60 tgtactctta ttagcttttg tacttgttta actagatcca tgagagttga taaattactt 120 tacaagtttt aagtaaatgt gtgtctaaag atattattta taaaatcata ttattgcaat 180 tacttctgtt tccttaaaaa wtttcacatg tttaattatt gggatacgag agttctctta 240 cttaggtgtt agagtggtgc ctggacggct cggtgggttg gatcgtgaca taatatatga 300 atttgtcaaa aaaatttaca ttatttttgt gatcgctatt tcaatataat atacagtaag 360 catgcatata tgtacaatgg atatattttt gtcatgctct a 401 <210> 104 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> C = susceptible allele; A = resistant allele <400> 104 tgcgaggcac tcgccttgat ggttcttact acacttgggg caagtggggt aagtcttggt 60 gcttgaaaca cttccctaag acttagattc tggtgcccta accttctgat catacatgtt 120 cttagaggat ggaatactag ttatcatagt tctgctatgg ggttgaaaac ttttcctgac 180 tctacgagcg atttccacca mcaaatttct gctaagagta gtcatagttc ccagtcctaa 240 cctcttattc tccttggctt gtttcctaag cttatcaccc tcaacctgct gatcatgagt 300 cataagctta aggatgttca tatctcgtag taacatagaa cttctgcact cagttttcac 360 caaattttga ctccgtacaa gaaattattc atctgagccc t 401 <210> 105 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> C = Susceptible allele; A = Resistant allele <400> 105 agtacaaatt gcaacttttt caatgttaac gtctgctttt ttagtgtata aaaaagaagg 60 attcatgaac tcctcagtca tattctattt taaaatactt aaacatcttt tttaattatg 120 tctcaagcat gtcaaacatc taatgcaaaa aagacttacg tttgtcgttg tggtaattta 180 gctattttga ggatttcaca maccgatacg aacccagatc gataattatt taattgtgca 240 attggtgcat tgatcttttt ttaagtggct tgattatgat tcatcaacga gcaacccatc 300 aaaattgagt ctcggattcg agacatcaaa ttttcaaagc gttatcaaat ttcaaatatt 360 ctttatctcc ttattttatc tcatgtacaa cttgattgac t 401 <210> 106 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> C = susceptible allele; A = resistant allele <400> 106 tcatcgtagt cagtaagatt ttaccaagga attaaaattt attaagtatt aagctcatta 60 cattagaatt agcaccaaga tttccaaaaa gaactaaatt ggaattagca aaaatctgaa 120 atttgaagag ttaagttaag tatgagtttt gagtcaactt caaaggacca taaatattag 180 aacacgatga gttagatgtg mtacaagata ccatagggaa gatattcgaa taacctttgc 240 aaagcctttg agtttaactaa gtttcaagtt catacaagtg agatatgacc ttttgaagtt 300 aggttctcca gttaagcaaa gttagccaaa aatagtgaag gtattttggt ccttccctta 360 cccaaacaga tttaattcgt tttagtcata ttttagggtt a 401 <210> 107 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> C = susceptible allele; G = resistant allele <400> 107 aaaacaattt caattatgta gaatcatttt tcggccacat taaatcatat ttttatgtca 60 ttgaaccttg agaaaatact catccatatc aattattaaa agtttaattt atctatacgc 120 tatatttcaa ttaacaataa cgacatgcac gaattaaatt tttaacaaat gacataaatg 180 tgtcttgtct caaaattcga sgagatcttt cgttttcttt aatattcatg aaaaaacatt 240 gatccaaagt ggaaagttaa ggatgagttg gacatttttc acttaaaata atgtaacgtg 300 actccctcca ttttccccaa acgtaagtcc aagtcaactt gagacaccat attattataa 360 taaaaataga acaaacacaa atccataaat ttacaacttg a 401 <210> 108 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = susceptible allele; A = resistant allele <400> 108 ttccaatggg agaaacttga gaggaagtga aaatgtggtg gagataaaca tggttatgga 60 gagacatttg aggcaaaata tgagagaaat atttgagaga ttttagggga ttaaataagt 120 gagagagaat attaattatt aattattaat aaagaaatgc caaatttatt tacacaaaac 180 gtgtaaaatg gacattttgt rtcaatcttt taaaatctgg ctaatggatg ctataaattg 240 aagtctgagt tgacatgcta tgtcattttc ctcaatgggc tgttggagaa gagaattggg 300 ttcaatatgg gagacaaaac ttggctagaa ttgagttaat tactaagttt ggttaaaaat 360 taaataagat aaataaatta atgttactta attatgggaa a 401 <210> 109 <211> 401 <212> DNA <213> Solanum lycopersicum <220> <221> Polymorphism <222> (201)..(201) <223> C = susceptible allele; A = resistant allele <400> 109 cgtggacggt actcgacgac cattgttggt ccctaagcga acccttatcc tggctgacta 60 caagcggaag actaacttaa gcataccaaa aatcttaaaa ctgaaatgaa caacttagaa 120 taaaataatc tatttaacta gtcattaaat aggcaacttg agtctttaaa acatttaata 180 aaataaatta ttaataaaaa mttctcaact agactatcta tggagcctct aactgaaaaa 240 gatggaaatc gggacaccac gacatcttga ttaaactgaa aagtaaataa ggtcctccgg 300 aaacaaggag gttcaacgac taactcgaac tctaggatgt attaataaag ctcttgttaa 360 tgatcccgaa gacctgtgtt tgcatcatca attatgcaac c 401 <210> 110 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> G = Susceptible allele; A = Resistant allele <400> 110 agcttcctta cttatttaaa tgtgaaaaca tatcatttgg ggatacttag ttcccctata 60 cttttgaaga aaagaacttg aacttaactc tttactcttt acttagcttg aaacttgact 120 cttaaggaat atttagttcc cttatatttt ttgagaaatg cactcactct ttgctctttg 180 ctctatttga aacttaactc rtagggaata cttaattccc ttataaattt tgagttttaa 240 actcaaatca ttactctttt ctcaacttgt agtttaagcc ttaaaacaaa gtttaaaatg 300 ttgtttaaga ctctttaaaa tagtaagaac ttactttgac tttcttttta tttgtaagac 360 ttgattctta aattctttgg ctttgatatt aactttcctt g 401 <210> 111 <211> 401 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Polymorphism <222> (201)..(201) <223> A = susceptible allele; T = resistant allele <400> 111 tatatcagaa tgatcaaata atcgcgtctt tagaatttta taggcatcat tgttgctgct 60 aagatatttt gacctaatga tcaaataatc gcgtctttag aattttatag gcatcattgt 120 tgctgctaag atattttgat aggtcaaatg atgtaatagg gtttttgtag aggccagatc 180 gtaaattggt gaaggcaaaa wcagaaactg tacaatatga ttttgataga gatcagttct 240 ttttcttgag atgttatgga ggattcatct attaggatct agtacaagga aaatttgtta 300 tgtattgaag tatttgttga gaacattttt gaattacctt gtgtaagttt aagattatga 360 agaattcttt tctttttctt tctactagat gggtaagcac g 401 <210> 112 <211> 301 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> allele <222> (151)..(151) <223> Susceptible allele = C; Resistant allele = CT <400> 112 agtgatattg tcttcagcta tagaatatta tccagcccct ctagctttgg tcgatttttt 60 tttataacaa attttatcca agctatcatt gttttttttt ttttttcaat ttacagcaat 120 tgtttcccga ctagcctatc aatgttagag cttttttttg gtttgaacat cgttgtcttg 180 agaagcttaa tccatgttca ctgtaggcat tgttatttaa ttttcaattg agtttgttaa 240 tctgcctata gatattaatt tatttcctct tctttcgatg catatgatca atccagtcta 300 t301 <210> 113 <211> 301 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> allele <222> (151)..(151) <223> Susceptible allele = A; Resistant allele = AT <400> 113 acaatgacat gacatcaaaa ataatttaat ttatcatgtc aaatttgttt aaaaataaat 60 tgtaatcgag tgattttaaa gaataaagat gttaagttga gtgattttaa agacacaaac 120 taaaatttag tgactttaca agataatttc atatagttca ttgacctttt aagatattaa 180 ctcaaaaaat caataagtag tcacacacaa aaggtgattg caaagtaaat ttcaattttt 240 agcataagct tagtggggaa taccaatgac gaatctaaaa gtatcaatac aaaaaataga 300 a 301 <210> 114 <211> 301 <212> DNA <213> Solanum lycopersicum <220> <221> Polymorphism <222> (151)..(151) <223> T = Susceptible allele; C = Resistant allele <400> 114 aaatgttaat ttttttattt ataataaata ttaatatgtc ttagacttga acttttaagt 60 tcattaaaga tagttaaata tcgtatttga tatacttaac gaaaaagcta aaacgtaaaa 120 gaaaatataa taagtttata tcttcttctt ytttttttaa atttggattt gtgatagtag 180 ggctttgaga gaaaattctt tttataattt tttttttcat attcaaggct cgaacctaag 240 atctatgatt aaggaagaag tagcctttcc actatacaat acacgttcat aatgagttaa 300 t301 <210> 115 <211> 301 <212> DNA <213> Tomato (Lycopersicon esculentum) <220> <221> Allele <222> (151)..(151) <223> Susceptible allele = G; Resistant allele = GT <400> 115 gcaaaaaaat aaaaaataaa aaaacgctag acagattgat gactatttat gctcatttca 60 aaacataact aatttgtatt taattttttt ttaccttttt tgattatttt ttttgctgta 120 tgattttctc ggttctatta ttagttattt gtttttttaa atattaatca taataacata 180 aatacataat taatccctta acaaaataaa ataatgacat ttttaataaa caataaaatt 240 gttgctaaga agtcccacta aaagcttaaa tattgttgtt ttgaaaaaaa tttccccaag 300 g 301 BRIEF DESCRIPTION OF THE DRAWINGS

[0263] Figure 1 : Plot of p-values ​​of QTLs associated with ToBRFV resistance for traits corresponding to AUDPC based on F2 population (based on origin D and HMC1).

[0264] The vertical axis (y-axis) shows -log10 (p-value) and the horizontal axis (x-axis) represents all SNPs by SNP position (in physical distance bp) along the chromosome along the physical map.

[0265] Figure 2A :Adjusted value of fruit resistance:Turkey test icon

[0266] Figure 2B: Adjusted values ​​and confidence intervals for fruit resistance based on the presence of the resistance parent allele at QTL9

[0267] Figure 3 :Adjusted values ​​of fruit resistance of different genotypes

[0268] Figure 4 : Fruit score redistribution by QTL9 genotype

[0269] Figure 5 : Adjusted values ​​of leaf resistance with confidence intervals

[0270] Figure 6 : Adjusted values ​​of foliage resistance for different genotypes with confidence intervals

[0271] Example

[0272] Example 1 :Materials and methods.

[0273] 1.A. Source Verification Testing .

[0274] The test was performed in triplicate with approximately 15 plants per germplasm or genetic background tested. Plants were sown and infected at the 2-leaf stage. Scoring was then performed by visual assessment of leaves at 7, 14 and 28 days post infection.

[0275] For this test, the criteria are as follows:

[0276] 9: No symptoms

[0277] 5: Moderate mosaic and / or necrosis symptoms

[0278] 1: Severe mosaic and / or necrosis symptoms

[0279] At 32 days dpi, the four accessions were tested plant by plant by Elisa and the two susceptible controls were batch tested.

[0280] 1.B. Phenotyping of F2 population

[0281] Plants were sown and infected at the 2-leaf stage and then scored by visual assessment of leaves at 7, 14 and 28 days post infection.

[0282] For this test, the criteria are as follows:

[0283] 9: No symptoms

[0284] 7: Mild mosaic symptoms

[0285] 5: Moderate mosaic symptoms

[0286] 3: Strong mosaic symptoms and / or bubbling

[0287] 1: Very strong mosaic symptoms and / or bubbling and / or deformation

[0288] For QTL analysis, the inventors used different phenotypic variables / traits, specifically annotation at 14 dpi, annotation at 21 dpi, annotation at 28 dpi, AUDPC.

[0289] AUDPC (area under the disease progression curve) was calculated using the following formula:

[0290]

[0291] Wherein, "n" is the number of symptom assessments, "y" is the symptom intensity (1 to 9), and "t" is the time in dpi (days post inoculation).

[0292] 1.3.DNA extraction:

[0293] According to the manufacturer's procedure, use DNA was extracted from ground leaves using the Plant Kit (Macherey-Nagel). DNA purification was based on the Magnetic-bead10 technology for the isolation of genomic DNA from plant tissues. DNA concentration was determined using the Quant-iT TM Quantification by dsDNA Assay Kit.

[0294] 1.4. Protocol for evaluating ToBRFV resistance under field conditions

[0295] Inoculation phase: 10 and 17 days after planting. The plants are thus infected twice. Each time the 2 youngest leaves are inoculated. Finally, 4 different leaves are inoculated.

[0296] Inoculum preparation:

[0297] Isolate: ToBRFV Jordan local strain 2017. ToBRFV-infected young leaves were taken from naturally infected plants and from plants resistant to TYLCV (Ty) and TMV to avoid the presence of multiple viruses in the inoculum.

[0298] 1 g of young leaves with ToBRFV symptoms was required to prepare 4 mL of inoculum by grinding.

[0299] Verification and inoculation of inoculum:

[0300] Before inoculation, the inoculum was checked for the presence of ToBRFV using TMV immunostrips (which are not specific and can also recognize ToBRFV) and for the absence of PepMV (Pepino) using PepMV immunostrips. TMV immunostrips can detect the presence of ToBRFV in the inoculum as long as the infected plants are TMV-resistant.

[0301] The inoculum to be applied is positive on the TMV immunoassay and negative on the PepMV immunoassay.

[0302] The inoculum was applied to two young leaves of the plant to be tested by gently rubbing this leaf with a rough sponge soaked in the inoculum.

[0303] Symptom assessment

[0304] The first evaluation was done when the first bunch of fruits was red and the second bunch of fruits turned red.

[0305] When at least the 3rd string is red, the 2nd evaluation is performed.

[0306] Standards for leaf symptoms:

[0307] 9: no symptoms, / 7: weak symptoms on a few leaves, / 5: moderate symptoms on some leaves, / 3: moderate symptoms on all leaves, / 1: strong symptoms on all leaves.

[0308] Fruit symptom criteria:

[0309] 9: All fruits showed no symptoms

[0310] 7: Mild symptoms (discoloration) on one or a few fruits

[0311] 5: Mild / moderate fruit discoloration on at least 2-3 fruits

[0312] 3: Moderate / intense fruit discoloration and / or small fruit deformation on more than 30% of the fruits.

[0313] 1: Very intense discoloration and / or moderate / intense fruit deformation and / or necrotic spots on more than 50% of the fruits.

[0314] 1.5. Stemphylium spp. resistance assessment protocol

[0315] Stomachium is a plant pathogenic fungus; it is the causative agent of gray leaf spot on tomato. The Sm gene from the currant tomato (Lycopersicum pimpinellifolium) provides genetically dominant resistance to Stomachium.

[0316] Inoculum preparation:

[0317] Stolonifera, Sicilian strain, stored at -80°C. The inoculum was prepared directly from cryopreserved tubes after incubation on petri dishes with V8 medium. Conidia were obtained by scraping the surface of the medium, suspended in water containing 1% glucose, and then filtered on muslin cloth. Conidia containing 10 4 Up to 10 5 A solution of conidia.

[0318] Vaccination:

[0319] The seedlings to be tested are at the 3 expanded leaves stage, corresponding to 17 to 24 days after sowing.The inoculum is applied by spraying on all leaf surfaces until droplets form.

[0320] Symptom Assessment:

[0321] The leaves were then scored by visual assessment 7 to 8 days after infection.

[0322] For this test, the criteria are as follows:

[0323] 9: No symptoms

[0324] 7: Some brown necrotic lesions, fewer in number than susceptible plants

[0325] 1: There are small or large brown necrotic lesions on both sides of the leaves.

[0326] Example 2 : Identification of ToBRFV resistance donor and preliminary positioning of QTL.

[0327] Identification of suitable wild donors of ToBRFV resistance

[0328] The inventors screened over 500 different wild germplasms to identify potential sources of resistance to ToBRFV, thereby potentially introgressing resistance-conferring sequences in these wild germplasms into a tomato background, particularly in commercial plants.

[0329] Although the type of resistance the inventors expected was fruit tolerance / resistance, this test could not be applied to wild germplasm with different fruit size and form. Therefore, the inventors decided to rank the sources in the leaf symptom test as a surrogate for fruit resistance since this parameter could not be screened.

[0330] Among the screened wild germplasm, only four potential sources (0.9%) were identified in the species S. habrochaites, S. chilense and S. ribes, suggesting that, in contrast to other viruses, it is difficult to find sources of resistance to ToBRFV.

[0331] All of these sources had a high percentage of symptom-free plants, however these plants were all positive by ELISA, indicating that no overall resistance or immunity was found.

[0332] For the control, two plants, S1 and S2, known to be susceptible to ToBRFV were used; however, due to the 2 In the presence of the gene, the control plant S2 was resistant to TMV.

[0333] Plants were evaluated for potential resistance / tolerance at the foliage level; in fact, due to the different fruit shapes, colors, and sizes of these wild accessions, it was not possible to rank resistance at the fruit level.

[0334] Table A reports the results obtained:

[0335] Table A : Evaluation of ToBRFV resistance in 4 potential sources and 2 controls by visual scoring and ELISA testing

[0336]

[0337] However, after 32 dpi, all plants tested positive by ELISA, indicating that the resistance carried by these plants was not complete (Table A).

[0338] In view of the results obtained, the inventors decided to focus further work on source D, which showed a better level of leaf resistance at 28 dpi, although the aim of this study was to identify fruit resistance sources rather than leaf resistance sources.

[0339] F2 Positioning - HMC1* Source D - Manual Testing

[0340] Four F2 populations were developed by crossing the resistant wild-source D with the susceptible parent HMC1, which is a breeding line with an indeterminate growth habit and red round fruits weighing about 100 g. It contains Tm-2 2 Gene.

[0341] Visual scoring was performed on different days: 7, 14 and 28 dpi (see Table B above).

[0342] Table B shows the results of the F2 screening under artificial conditions: plants were scored on a scale of 1 to 9, where plants scoring “1” or “3” would be considered susceptible, plants scoring “5” would be considered moderately resistant, and plants scoring “7” or “9” would be highly resistant in terms of foliar resistance.

[0343] The number of plants with scores of 1, 3, 5, 7, and 9 is reported in columns 4-8. Column 9 (1=S) indicates the number of plants with scores of 1, 3, 5, or 7. Column 10 (9=R) indicates the number of plants with a score of 9. Columns 11 and 12 report the percentage of plants with a score of "S" (scores of 1, 3, 5, or 7) and a score of "R" (score of 9).

[0344] Table B: Scores of source D and its progeny

[0345]

[0346] QTL analysis

[0347] DNA was extracted as detailed in Example 1. For QTL analysis, the inventors used different phenotypic variables / traits: Annotated 14 dpi, Annotated 21 dpi, Annotated 28 dpi, AUDPC.

[0348] AUDPC (area under the disease progression curve) was calculated using the following formula:

[0349]

[0350] Wherein, "n" is the number of symptom assessments, "y" is the symptom intensity (1 to 9), and "t" is the time in dpi (days post inoculation).

[0351] Genotyping of the F2 population (based on source D and HMC1) was done using a panel of 169 SNPs. These SNPs were selected based on:

[0352] Polymorphism / allele frequency

[0353] SNP physical map distance is evenly distributed

[0354] QTL analysis was performed using the QTL detection (ANOVA) model for parental populations in MAST - A Marker Assisted Selection Tool (proprietary software).

[0355] Positioning results (see Figure 1 , illustrating the P-value plot for the trait corresponding to AUDPC) revealed two QTL candidates associated with ToBRFV resistance, which were located on chromosome 9 (QTL9) and chromosome 11 (QTL11), with the positive alleles coming from source D.

[0356] Table C summarizes the markers significantly associated with QTL9 and QTL11 associated with ToBRFV resistance and their locations in the tomato genome.

[0357] SNP chromosome Position SL2.5 P-value loci LOD R2. Locus TO-0196745 9 3 987 296 2.21E-05 4.66 0.04 TO-0145530 9 4 654 259 1.41E-07 6.85 0.05 TO-0178115 9 13 623 470 4.74E-06 5.32 0.04 TO-0145207 9 40 039 587 4.26E-06 5.37 0.04 TO-0008214 11 4 524 671 7.38E-08 7.13 0.05

[0358] The results showed that QTL9 responsible for ToBRFV resistance was located between position 3987296 and position 40039587 on chromosome 9 of the SL2.50 version of the tomato genome. This region of chromosome 9 is a region known to have a low recombination rate.

[0359] QTL11 responsible for ToBRFV resistance is located at position 4524671 on chromosome 11, also based on the SL2.50 version of the tomato genome.

[0360] Example 3 : QTL mapping and validation. Field testing.

[0361] BC1F2 QTL mapping and validation

[0362] A BC1F2 population between origin D and the susceptible parent HMC1 has been developed using the SNPs described in Table C. 158 individual plants have been phenotyped under field inoculation conditions in Jordan as described in Example 1.

[0363] Fruit symptoms were rated on a 9 to 1 scale:

[0364] 9: No symptoms - 7: Mild symptoms on a few fruits - 5: Moderate symptoms on some fruits - 3: Moderate symptoms on all fruits - 1: Strong symptoms.

[0365] Table D shows the results of the BC1F2 screening under field inoculation conditions: plants were scored on a scale of 1 to 9, where plants with a score of 1 or 3 would be considered susceptible, plants with a score of 5 would be considered moderately resistant, and plants with a score of 7 or 9 would be considered highly resistant. Fruit evaluation was not performed on source D due to fruit size, i.e. due to the small fruit of the currant tomato source.

[0366] Table D: Fruit scores of HMC1 and BC1F2 populations

[0367] name generations Number of plants 1 point 3 points 5 points 7 points 9 points HMC1 S parent 18 9 9 0 0 0 HMC1 x Source D BC1F2 158 44 38 43 18 15

[0368] DNA was extracted from leaves as described in Example 1.

[0369] The BC1F2 population was genotyped with a subset of SNPs significantly associated with ToBRFV resistance in the F2 mapping population. Marker trait associations were done by crossed ANOVA in MAST - Marker Assisted Selection Tool (proprietary software).

[0370] Mapping results showed that QTL9 was associated with fruit resistance to ToBRFV; the same region that had been associated with leaf resistance.

[0371] BC3F2 QTL Mapping - Field Testing

[0372] Three BC3F2 populations of approximately 140 individuals each between origin D and HMC1 were evaluated under inoculated field conditions. The inoculation protocol and symptom evaluation were the same as for BC1F2 and described in Example 1.

[0373] The scoring of these plants is detailed in Table E; the scale of scores 1 to 9 is the same as detailed for BC1F2.

[0374] Table E: Fruit scores of HMC1 and BC3F2 populations

[0375] name generations Number of plants 1 point 3 points 5 points 7 points 9 points HMC1 S parent 16 15 1 0 0 0 Pop1 BC3F2 141 16 46 29 35 15 Pop2 BC3F2 142 18 47 38 28 11 Pop3 BC3F2 143 22 51 29 23 18

[0376] DNA was extracted from leaves as described in Example 1.

[0377] BC3F2 individuals were genotyped with a subset of polymorphic SNPs on chromosomes 9 and 11 that were identified as associated with ToBRFV resistance in the F2 mapping population.

[0378] A genetic map of chromosomes 9 and 11 was constructed using JoinMap software to confirm the position and order of the markers.

[0379] QTL detection was performed using MapQTL software and genetic maps completed for these families.

[0380] The QTL mapping results confirmed the presence of a major QTL for fruit resistance to ToBRFV on chromosome 9. Peak-associated markers are described in Table F.

[0381] Table F: Peak-associated SNPs based on BC3F2 analysis

[0382]

[0383]

[0384] Example 4: Line resequencing and identification of unique SNPs.

[0385] Six tomato lines (including three ToBRFV tolerance / resistance sources, including source D and the line used in WO2018 / 219941 (HAZTBRFVRES1)) and three susceptible lines used as replicates in the mapping population were resequenced.

[0386] Seeds were sown, DNA was extracted from fresh leaves, and whole genome sequencing was performed.

[0387] The minimum sequencing depth was set to 20X. Sequencing was performed using Illumina NovaSeq 2x150nt technology.

[0388] Reads were mapped to the SL2.40 tomato reference genome and variant calling analysis was performed using samtools. In order to identify SNPs from source D as uniquely as possible, SNPs were filtered and alleles found in source D were compared with SNP alleles identified in other lines of the project and 360 tomato genomes ("Genomic analyses provide insights into the history of tomato breeding"; Lin et al. Nature Genetics, 2014).

[0389] On this basis, 310 unique SNPs from source D were identified in the interval containing QTL9 (from SL2.40ch09: 10 Mb to 55 Mb). To select the best SNPs, some quality filters were applied (unique Blast on the tomato genome and %AT in flanking sequences). A list of 101 SNPs was selected (see Table H).

[0390] 14 SNPs (see Table G) have been tested in a large number of backgrounds and they have confirmed their ability to track the presence of QTL 9. Five of them (see Table G) showed very good results in terms of specificity for origin D.

[0391] Table G: List of 14 specific SNPs in the QTL9 interval resequenced from source D.

[0392] The table gives the names of the 14 SNPs, the positions in the SL2.50 genome, the sequences with polymorphisms in brackets, and the susceptible and resistant alleles. The five SNPs that showed very good results are indicated with asterisks.

[0393] Polymorphisms are indicated in brackets. The "S" column reports the susceptible allele, replicating the presence of the parental HMC, while the "R" column indicates the resistant allele, as indicated in Source D.

[0394]

[0395]

[0396]

[0397]

[0398] Table H: List of 101 specific SNPs resequenced from source D in the QTL9 interval.

[0399] Table H shows the positions of the 101 SNPs identified by the inventors in the SL2.50 genome, the SEQ ID numbers of the sequences in the sequence listing, and the susceptible and resistant alleles. The 14 SNPs and 5 SNPs mentioned above showed very good results, indicated by one or two asterisks, respectively.

[0400] Table H. List of 101 specific SNPs in the QTL9 interval from LVSTBRFVRES2 resequencing

[0401]

[0402]

[0403]

[0404]

[0405]

[0406] Therefore, these SNPs allow to distinguish plants with QTL9 described in the present invention from plants derived from HAZTBRFVRES1 described in WO2018 / 219941, which have a different QTL providing tolerance to ToBRFV on chromosome 9. Therefore, the QTL disclosed in the present invention is significantly different in sequence from the QTL disclosed in WO2018 / 219941.

[0407] Example 5: Characterization of new QTL9 in field trials.

[0408] Two different trials were conducted in Jordan to confirm that in addition to the sequence differences between QTL9 of the present invention and the QTL mentioned in WO2018 / 219941, these different sequences also confer different types of ToBRFV resistance.

[0409] The first trial T1 (372 plants) was carried out in a tunnel in summer using different elite lines (checks), controls S1 and S2 mentioned in Examples 2-4, and plants containing the QTLs on chromosomes 9 and 11 mentioned in WO2018 / 219941.

[0410] A second trial, T2 (1165 plants), was conducted the following winter using two tunnels, including the same elite lines (check) and controls as in the previous trial, T1, and BC3F2 produced from source D, as described in Example 4.

[0411] In this example, the type / origin of the sequences found at the loci of QTL9 and QTL11 on chromosomes 6 and 9 of the test plants were defined as follows:

[0412] →Sequences found in elite lines at the QTL9 and QTL11 loci, as well as extended “alleles” of these loci in elite lines, are coded as “Re”;

[0413] →Sequences found in susceptible lines S1 and S2 at the QTL9 and QTL11 loci (“alleles” of these loci in susceptible lines) are coded as “S”;

[0414] → Sequences located at the QTL9 and QTL11 loci found in tolerant / resistant plants derived from HAZTBRFVRES1 described in WO2018 / 219941 (“alleles” of these loci in HAZTBRFVRES1) are coded as “Rh”;

[0415] → The sequences found in the resistant plant BC3F2 from origin D at the QTL9 and QTL11 loci (the "alleles" of these loci in the plants of the present invention) are coded as "Rd".

[0416] The plants were inoculated twice, first one week after planting and second two weeks later, as described in Example 1.

[0417] The plants were then scored for fruit and leaf symptoms according to the criteria mentioned in Example 1.4. Leaf symptoms were assessed at the adult stage (plants bearing red fruit), however, leaf symptoms were difficult to assess due to the sparse young leaves.

[0418] Statistical analysis of results.

[0419] The data were analyzed using a mixed model to determine the level of resistance conferred by the "allele" found at the QTL9 locus of the plants, taking into account other potential effects, namely the "allele" found at the QTL11 locus, the genotype of the plants, and the effects of tunneling. The mixed model was as follows:

[0420] Score = μ + (genotype) random + tunnel + QTL9 + QTL11 + ε

[0421] where score (fruit resistance or leaf resistance) is the observed variable, μ is the mean of the trait, ε is the residual, and (genotype) random, tunnel, QTL9 and QTL11 are the effects.

[0422] Since inspections are present in all tunnels, the tunneling effect is estimated.

[0423] The genotype effect was treated as a random effect to capture the variability of the population from which the tested varieties were drawn.

[0424] For each genotype and each trait (fruit symptoms and leaf symptoms) at the QTL9 locus, the inventors extracted adjusted values ​​in order to better estimate the potential of each genotype independent of other effects.

[0425] For example, for the genotype corresponding to Rd / Rd, the adjusted value is:

[0426] μ+QTL9[RdRd]+average(genotype)+average(tunnel)+average(QTL11)

[0427] where μ is the estimated mean of the trait (fruit symptoms or leaf symptoms), QTL9[Rd / Rd] is the estimated effect of genotype RdRd on QTL9, and Mean(genotype), Mean(tunnel) and Mean(QTL11) are the means of the corresponding estimated effects.

[0428] Tukey's test was used for multiple comparisons between adjusted values

[0429] result:

[0430] Effects of QTL9 on fruit symptoms:

[0431] For traits corresponding to fruit symptoms, the mixed model detailed above was used to calculate adjusted values ​​for the different tested genotypes regarding the QTL9 locus. The results are reported in Table I and are presented in Figure 2A and 2B Shown in.

[0432] Table I: Effects of QTL9 on fruit symptoms

[0433] QTL9_allele Fruit symptom adjustment Group N Rd 7,0853 A 203 R 5,73088 B 78 R 5,3609 BC 214 ReS 3,75473 CD 56 ReRe 3,46006 D 132 SS 2,51856 D 560

[0434] N = number of corresponding plants

[0435] Group: Group assigned according to Tukey test

[0436] For the sequence of the QTL9 locus, Rd, Rh, Re, and S correspond to the genotype of the plant.

[0437] From these results, it can be inferred that the presence of QTL9 defined in the present invention (corresponding to the Rd genotype in this example) provides a level of resistance that is significantly different from and significantly higher than the level of resistance provided by QTL2 defined in WO2018 / 219941 (corresponding to the Rh genotype in this example).

[0438] Furthermore, analysis of the effect of the alleles at QTL9 on fruit resistance showed that the Rd allele had a significant additive effect, as follows (extract from Table 1) and Figure 3 shown.

[0439] QTL9_allele Adjustment value Group N Rd 7,0853 A 203 R 5,3609 BC 214 SS 2,51856 D 560

[0440] Fruit score redistribution has also been determined by QTL9 genotypes. Figure 4 shown.

[0441] As shown in these results, QTL9 according to the present invention, in the homozygous state (genotype RdRd in this example), gave more than 80% of the plants a fruit score of 5, 7 or 9 (48, 61 and 59 out of 208, respectively). About 60% of the plants (120 out of 208) scored 7 or 9 after two rounds of infection, i.e., the fruit had almost no symptoms.

[0442] These results also demonstrate that QTL9 according to the invention, when present in a heterozygous state (genotype RdS in this example), gives about 50% of the plants a fruit score of 5, 7 or 9 (63, 36 and 13 out of 225, respectively). About 22% of the plants (49 out of 225) scored 7 or 9 after two rounds of infection, i.e. the fruit was almost symptom-free.

[0443] In contrast, for the RhRh genotype, also approximately 80% of the plants had fruit scores of 5, 7 or 9, but less than 35% of the plants had scores of 7 or 9 (30 and 1 of 89, respectively), ie, after two rounds of infection, the fruits were almost symptom-free.

[0444] Effects of QTL9 on leaf symptoms:

[0445] For traits corresponding to leaf symptoms, adjusted values ​​for the different tested genotypes regarding the QTL9 locus were calculated using the mixed model detailed above. The results are reported in Table J and are presented in Figure 5 Shown in.

[0446] Table J: Effects of QTL9 on leaf symptoms

[0447] QTL9_allele Adjusted leaf symptoms Group N Rd 6,73072 A 198 R 6,67866 A 199 R 5,57343 B 81 ReS 5,54822 ABC 51 SS 4,26684 CD 562 ReRe 3,51093 D 148

[0448] N = number of corresponding plants

[0449] Group: Group assigned according to Tukey test

[0450] For the sequence of the QTL9 locus, Rd, Rh, Re and S correspond to the genotype of the plant. From these results, it can be inferred that the presence of QTL9 defined in the present invention (corresponding to the Rd genotype in this example) provides a leaf resistance level that is significantly different from and significantly higher than the leaf resistance level provided by QTL2 defined in WO2018 / 219941 (corresponding to the Rh genotype in this example).

[0451] Furthermore, the results also showed that the heterozygous presence of QTL9 was sufficient to provide a high level of foliar resistance (the adjusted values ​​for genotypes RdRd and RdS were statistically identical).

[0452] Example 6: Lineage resequencing and identification of unique SNPs on chromosome 11.

[0453] The same experiments disclosed in Example 4 for the QTL on chromosome 9 were applied to the QTL identified by the inventors on chromosome 11. The SNP analysis was performed on the same plant population.

[0454] The SNPs are informative about the presence of QTL11 according to the invention and are reported in Table K below (SEQ ID NOs: 102-111), as well as their location in the genome of the SL2.50 version and the susceptible and resistant alleles.

[0455] Then, the inventors conducted further searches to identify other markers for the presence of introgression sequences that confer resistance to ToBRFV. These markers are very specific to the introgression sequences from source D that confer resistance to ToBRFV.

[0456] Table K: Markers corresponding to QTL11

[0457]

[0458]

[0459]

[0460]

[0461] Example 7: Genetic modification of tomato seeds by ethyl methane sulfonate (EMS)

[0462] Seeds of tomato varieties were treated with EMS by dipping approximately 2000 seeds of each variety in an aerated solution of 0.5% (w / v) or 0.7% EMS for 24 hours at room temperature.

[0463] Approximately 1500 treated seeds per variety per dose of EMS are germinated and the resulting plants are preferably grown in a greenhouse, e.g., from May to September, to produce seed.

[0464] After maturity, the M2 seeds were harvested and batched in one pool per treatment. The resulting pool of M2 seeds was used as starting material to identify individual M2 seeds and plants resistant to Tomato Brown Ruffle Fruit Virus.

[0465] Example 8: Resistance to Stolonifera

[0466] WO2020 / 018783 discloses a genetic region on chromosome 11 of tomato containing a Stolonifera resistance allele from tomato plant Gooseberry, and allegedly also a TBRFV resistance allele, both of which are so closely linked that they are characterized as very similar markers and therefore introgressed at the same time. To confirm that the QTL on chromosome 11 identified by the inventors is different from the resistance allele disclosed in WO2020 / 018783, the inventors tested the plants according to the invention for Stolonifera resistance.

[0467] The protocol for Stolonifera resistance was as disclosed in Example 1.5.

[0468] result:

[0469] More than 157 different plants from 5 different genotypes were tested with at least 18 replicates per genotype.

[0470] The genotypes / cultivars tested were:

[0471] - A Sclerotium resistant control (R)

[0472] - A moderately resistant control of Sclerotium (IR)

[0473] - A Spatholobus susceptible control (S)

[0474] -Source D

[0475] -BC5F3 HMC1 * Source D

[0476] The results for Sclerotium resistance are reported in Table L below.

[0477]

[0478] Table L: Stolonifera resistance.

[0479] "Mean" means the average score of all plants from the same family according to the symptom evaluation detailed in 1.5. The meaning indicates whether the cultivar is considered resistant (R) or susceptible (S). QTL11 is a QTL according to the invention; its presence was tested with the markers disclosed in the previous examples. NT means not tested.

[0480] Conclusion: QTL11 from source D providing ToBRFV resistance according to the present invention is not associated with resistance to Stolonifera, contrary to the genetic resistance to ToBRFV according to WO2020 / 018783, since the tested plants, while containing the QTL11 of the present invention, were not resistant to Stolonifera.

[0481] Therefore, it can be concluded that QTL11 of the present invention is different from the resistance on chromosome 11 disclosed in WO2020 / 018783.

[0482] Example 9: Analysis of ToBRFV resistance provided by QTL11.

[0483] An F2 population between source D and susceptible parent HMC2 has been obtained. HMC2 is a line that is highly susceptible to ToBRFV at the leaf level. As described in Example 1.B, 134 individual plants were phenotyped for leaf symptoms after inoculation with ToBRFV and genotyped based on SNP markers of QTL11.

[0484] For traits corresponding to foliar symptoms, adjusted values ​​for the different tested genotypes for the QTL11 locus were calculated using a mixed model similar to the one used for QTL9. The results are reported in Table M and are presented in Figure 6 Shown in.

[0485] Table M

[0486] QTL11 average value Standard Deviation variance CV N Minimum Maximum Median RR 8,66 1,14 1,29 13,12 35 5 9 9 RS 2,68 2,12 4,48 79,09 62 1 9 2 SS 2,14 1,92 3,68 89,79 37 1 9 1

[0487] Analysis of the effect of the alleles at QTL11 on foliage resistance showed a significant recessive effect of the resistance allele, as shown in Table M and Figure 6 shown.

Claims

1. A method for conferring resistance to Tomato Brown Rough Fruit Virus (ToBRFV) in a tomato (Solanum lycopersicum) plant, comprising the steps of: a) hybridization, Crossing a ToBRFV-resistant tomato plant with an initial tomato plant lacking a quantitative trait locus (QTL), comprising in the genome of a ToBRFV-resistant tomato plant a quantitative trait locus (QTL) on chromosome 9 (QTL9) and / or a QTL on chromosome 11 (QTL11), wherein each of said QTLs is introgressed from S. pimpinellifolium and confers resistance to ToBRFV on the plant, b) selecting plants carrying QTL9 and / or QTL11 among the progeny thus obtained; c) optionally, self-pollinating the plants obtained in step b) one or more times and selecting plants resistant to ToBRFV among the progeny thus obtained, in: - the QTL on chromosome 9 is located within the chromosomal region defined by SNP TO-0201220 shown in SEQ ID NO: 1 and SNP shown in SEQ ID NO: 101, - the QTL on chromosome 11 is located within the chromosomal region defined by the SNP represented by SEQ ID NO: 102 and the marker represented by SEQ ID NO: 115, and - said QTL is present in the genome of tomato plants resistant to ToBRFV and has the same sequence as the QTL present in the genome of seeds of LVSTBRFVRES2 NCIMB deposit number 43591.

2. The method according to claim 1, wherein: The QTL on chromosome 9 is identified using one of the resistance alleles of the SNP markers disclosed in Table H whose sequences are shown as SEQ ID NOs: 1-101.

3. The method according to claim 2, wherein: The QTL on chromosome 9 is identified by allele G of SNP TO-0201220 shown in SEQ ID NO: 1 and / or allele A of SNP TO-0201229 shown in SEQ ID NO:

10.

4. The method according to claim 1 or 2, wherein: The QTL on chromosome 9 is identified by at least one of the following alleles: allele G of SNP TO-0201220 shown in SEQ ID NO: 1, allele G of TO-0201221 shown in SEQ ID NO: 2, allele A of TO-0201222 shown in SEQ ID NO: 3, allele A of TO-0201223 shown in SEQ ID NO: 4, allele A of TO-0201224 shown in SEQ ID NO: 5, allele A of TO-0201225 shown in SEQ ID NO: 6, allele A of TO-0201226 shown in SEQ ID NO: 7, allele C of TO-0201227 shown in SEQ ID NO: 8, allele C of TO-0201228 shown in SEQ ID NO: 9, allele C of TO-0201229 shown in SEQ ID NO:

10. The method can be performed by using at least one of the TO-0201229 allele A shown in SEQ ID NO: 10, the TO-0201230 allele C shown in SEQ ID NO: 11, the TO-0201231 allele C shown in SEQ ID NO: 12, the TO-0201232 allele G shown in SEQ ID NO: 13, and the TO-0201233 allele G shown in SEQ ID NO: 14, or by using at least one of the SNPs TO-0201220 allele G, TO-0201221 allele G, TO-0201229 allele A, TO-0201231 allele C, TO-02012232 allele G, or TO-0201233 allele G.

5. The method according to claim 1, wherein: The QTL on chromosome 9 was found in the region defined by TO-0201220 shown in SEQ ID NO: 1 and TO-0201233 shown in SEQ ID NO:

14.

6. The method according to claim 1, wherein: The QTL on chromosome 11 is identified using one of the resistance alleles of the markers disclosed in Table K with sequences set forth in SEQ ID NOs: 102-115.

7. The method according to claim 6, wherein: The QTL on chromosome 11 is identified by at least one of the following alleles: allele G of TO-0201237 shown in SEQ ID NO: 102, allele A of TO-0201238 shown in SEQ ID NO: 103, allele A of TO-0201239 shown in SEQ ID NO: 104, allele A of TO-0201240 shown in SEQ ID NO: 105, allele A of TO-0201241 shown in SEQ ID NO: 106, allele CT of SL2.50ch11_9684449 shown in SEQ ID NO: 112, allele AT of SL2.50ch11_9779896 shown in SEQ ID NO: 113, allele C of SL2.50ch11_9823405 shown in SEQ ID NO: 114, and allele D of SL2.50ch11_9823406 shown in SEQ ID NO:

115. The GT allele of SL2.50ch11_9924232 shown in NO: 115, or is identified by at least one of the G allele of TO-0201237, the A allele of TO-0201238, the A allele of TO-0201239, the A allele of TO-0201240 and the A allele of TO-0201241.

8. The method according to claim 1, wherein: The QTL on chromosome 11 was found in the region defined by TO-0201237 shown in SEQ ID NO:102 and SL2.50ch11_9924232 shown in SEQ ID NO:

115.

9. The method according to any one of claims 1 to 3, wherein: The ToBRFV-resistant tomato plant in step a) further comprises a Tm-1 gene.

10. Use of a tomato (Solanum lycopersicum) plant resistant to ToBRFV as a breeding partner in a breeding program for conferring resistance to ToBRFV in tomato plants, wherein the genome of the ToBRFV-resistant tomato plant homozygously comprises a quantitative trait locus (QTL) on chromosome 9 (QTL9) and / or a QTL on chromosome 11 (QTL11), wherein each of said QTLs is introgressed from a S. pimpinellifolium gene and confers resistance to ToBRFV in the plant, in: - the QTL on chromosome 9 is located within the chromosomal region defined by SNP TO-0201220 shown in SEQ ID NO: 1 and SNP shown in SEQ ID NO: 101, - the QTL on chromosome 11 is located within the chromosomal region defined by the SNP represented by SEQ ID NO: 102 and the marker represented by SEQ ID NO: 115, and - said QTL is present in the genome of tomato plants resistant to ToBRFV and has the same sequence as the QTL present in the genome of seeds of LVSTBRFVRES2 NCIMB deposit number 43591.

11. A cell of a tomato plant resistant to Tomato Brown Ruffled Fruit Virus (ToBRFV), comprising in the genome of the plant a quantitative trait locus (QTL) on chromosome 9 (QTL9) and / or a QTL on chromosome 11 (QTL11), wherein each of the QTLs is introgressed from the S. pimpinellifolium gene and confers resistance to ToBRFV on the plant, wherein the genome of the cell comprises the QTL9 on chromosome 9 and / or the QTL11 on chromosome 11 independently conferring resistance to ToBRFV, wherein the cell is a non-regenerable cell, and in: - the QTL on chromosome 9 is located within the chromosomal region defined by SNP TO-0201220 shown in SEQ ID NO: 1 and SNP shown in SEQ ID NO: 101, - the QTL on chromosome 11 is located within the chromosomal region defined by the SNP represented by SEQ ID NO: 102 and the marker represented by SEQ ID NO: 115, and - said QTL is present in the genome of tomato plants resistant to ToBRFV and has the same sequence as the QTL present in the genome of seeds of LVSTBRFVRES2 NCIMB deposit number 43591.

12. The tissue culture of non-regenerative cells according to claim 11, wherein The genome of the cell comprises the QTL9 on chromosome 9 and / or the QTL11 on chromosome 11 which independently confer resistance to ToBRFV.

13. Use of a tomato plant or a part of said plant or a progeny of said plant as a breeding partner in a breeding program for conferring resistance to ToBRFV in tomato plants, wherein: The seeds grown into the tomato are deposited in NCIMB with the deposit number NCIMB 43591, homozygous for QTL9 and / or QTL11, which independently confer resistance to ToBRFV infection as defined in claim 1, in: - the QTL9 on chromosome 9 is located within the chromosomal region defined by SNP TO-0201220 shown in SEQ ID NO: 1 and SNP shown in SEQ ID NO: 101, - the QTL11 on chromosome 11 is located in the chromosomal region defined by the SNP represented by SEQ ID NO: 102 and the marker represented by SEQ ID NO: 115, and - said QTL is present in the genome of the tomato plant to be tested / selected and has the same sequence as the QTL present in the genome of the seeds of LVSTBRFVRES2 NCIMB deposit number 43591.

14. A method for detecting and / or selecting a tomato plant comprising a QTL introgressed from a tomato gene conferring ToBRFV resistance, wherein: The method comprises detecting a resistance allele according to Table H and Table K of at least one genetic marker associated with the QTL, wherein the genetic marker is selected among: - in the group comprising the SNP markers shown in SEQ ID NOs: 1-101, or - in the group comprising markers having sequences shown in SEQ ID NOs: 102-115, And wherein the QTL is present in the genome of the tomato plant to be detected / selected and has the same sequence as the QTL present in the genome of the seeds of LVSTBRFVRES2 NCIMB deposit number 43591.

15. The method according to claim 14, wherein: The genetic markers are selected from the following: - comprising SNP TO-0201220 of SEQ ID NO: 1, TO-0201221 of SEQ ID NO: 2, TO-0201222 of SEQ ID NO: 3, TO-0201223 of SEQ ID NO: 4, TO-0201224 of SEQ ID NO: 5, TO-0201225 of SEQ ID NO: 6, TO-0201226 of SEQ ID NO: 7, TO-0201227 of SEQ ID NO: 8, TO-0201228 of SEQ ID NO: 9, TO-0201229 of SEQ ID NO: 10, TO-0201230 of SEQ ID NO: 11, TO-0201231 of SEQ ID NO: 12, TO-0201232 of SEQ ID NO: 13 and ID NO: 14 as shown in TO-0201233, or -In a group comprising the marker sequences TO-0201237 shown in SEQ ID NO: 102, TO-0201238 shown in SEQ ID NO: 103, TO-0201239 shown in SEQ ID NO: 104, TO-0201240 shown in SEQ ID NO: 105, TO-0201241 shown in SEQ ID NO: 106, SL2.50ch11_9684449 shown in SEQ ID NO: 112, SL2.50ch11_9779896 shown in SEQ ID NO: 113, SL2.50ch11_9823405 shown in SEQ ID NO: 114 and SL2.50ch11_9924232 shown in SEQ ID NO:

115.

16. A method for detecting and / or selecting a tomato plant comprising a QTL on chromosome 9 and / or a QTL on chromosome 11 introgressed from a tomato gene of Ribes oleraceus and independently conferring resistance to ToBRFV, wherein: The method comprises: detecting at least one of the following alleles in a sample of genetic material of a plant to be selected: - For the QTL on chromosome 9, the detection sequence is allele G of SNP TO-0201220 shown in SEQ ID NO: 1, allele G of TO-0201221 shown in SEQ ID NO: 2, allele A of TO-0201222 shown in SEQ ID NO: 3, allele A of TO-0201223 shown in SEQ ID NO: 4, allele A of TO-0201224 shown in SEQ ID NO: 5, allele A of TO-0201225 shown in SEQ ID NO: 6, allele A of TO-0201226 shown in SEQ ID NO: 7, allele C of TO-0201227 shown in SEQ ID NO: 8, allele C of TO-0201228 shown in SEQ ID NO: 9, allele A of TO-0201229 shown in SEQ ID NO: 10, allele A of TO-0201221 shown in SEQ ID NO: 11, allele A of TO-0201222 shown in SEQ ID NO: 12 Allele C of TO-0201230 shown in ID NO: 11, allele C of TO-0201231 shown in SEQ ID NO: 12, allele G of TO-0201232 shown in SEQ ID NO: 13, and allele G of TO-020133 shown in SEQ ID NO: 14, or - For the QTL on chromosome 11, the detection sequence is allele G of TO-0201237 shown in SEQ ID NO: 102, allele A of TO-0201238 shown in SEQ ID NO: 103, allele A of TO-0201239 shown in SEQ ID NO: 104, allele A of TO-0201240 shown in SEQ ID NO: 105, allele A of TO-0201241 shown in SEQ ID NO: 106, allele CT of SL2.50ch11_9684449 shown in SEQ ID NO: 112, allele AT of SL2.50ch11_9779896 shown in SEQ ID NO: 113, allele C of SL2.50ch11_9823405 shown in SEQ ID NO: 114, or allele C of SL2.50ch11_9823405 shown in SEQ ID NO:

115. The allele GT of SL2.50ch11_9924232 shown in NO:115, and The QTL is present in the genome of the tomato plant to be detected / selected and has the same sequence as the QTL present in the genome of the seeds of LVSTBRFVRES2NCIMB deposit number 43591.

17. The method according to claim 16, wherein: The method comprises: detecting at least one of the following alleles: - for the QTL on chromosome 9, detecting SNP TO-0201220 allele G, TO-0201221 allele G, TO-0201229 allele A, TO-0201231 allele C, TO-02012232 allele G or TO-0201233 allele G, or -For the QTL on chromosome 11, detect allele G of TO-0201237, allele A of TO-0201238, allele A of TO-0201239, allele A of TO-0201240, allele A of TO-0201241, allele CT of SL2.50ch11_9684449, allele AT of SL2.50ch11_9779896, allele C of SL2.50ch11_9823405 or allele GT of SL2.50ch11_9924232.

18. Use of a genetic marker for detecting the presence of a sequence introgressed from a tomato plant and conferring resistance to ToBRFV, wherein: The genetic markers are selected from the group consisting of: - a group of resistance alleles comprising the SNP markers whose sequences are shown in SEQ ID NOs: 1-101, or - a group of resistance alleles comprising markers having sequences shown as SEQ ID NOs: 102-115, and, Among them, the sequence introgressed from the gooseberry tomato gene corresponds to the sequence present in the genome of the seeds of LVSTBRFVRES2NCIMB deposit number 43591.

19. The use according to claim 18, wherein The genetic markers are selected from the following: - comprising a TO-0201220 shown in SEQ ID NO: 1, a TO-0201221 shown in SEQ ID NO: 2, a TO-0201222 shown in SEQ ID NO: 3, a TO-0201223 shown in SEQ ID NO: 4, a TO-0201224 shown in SEQ ID NO: 5, a TO-0201225 shown in SEQ ID NO: 6, a TO-0201226 shown in SEQ ID NO: 7, a TO-0201227 shown in SEQ ID NO: 8, a TO-0201228 shown in SEQ ID NO: 9, a TO-0201229 shown in SEQ ID NO: 10, a TO-0201230 shown in SEQ ID NO: 11, a TO-0201231 shown in SEQ ID NO: 12, a TO-0201232 shown in SEQ ID NO: 13 and a TO-0201233 shown in SEQ ID NO:

14. NO: 14 from the list shown in TO-0201233, or -In a group comprising the marker sequences TO-0201237 shown in SEQ ID NO: 102, TO-0201238 shown in SEQ ID NO: 103, TO-0201239 shown in SEQ ID NO: 104, TO-0201240 shown in SEQ ID NO: 105, TO-0201241 shown in SEQ ID NO: 106, SL2.50ch11_9684449 shown in SEQ ID NO: 112, SL2.50ch11_9779896 shown in SEQ ID NO: 113, SL2.50ch11_9823405 shown in SEQ ID NO: 114 and SL2.50ch11_9924232 shown in SEQ ID NO:

115.

20. A method for conferring resistance to ToBRFV in a tomato plant, comprising the steps of: a) crossing plants grown from deposited seeds NCIMB 43591 or progeny thereof carrying QTL9 on chromosome 9 and / or QTL11 on chromosome 11 introgressed from tomato and independently conferring ToBRFV resistance in NCIMB 43591 with a starting tomato plant, b) selecting plants carrying QTL9 and / or QTL11 among the progeny thus obtained; c) optionally, self-pollinating the plants obtained in step b) one or more times and selecting plants resistant to ToBRFV among the progeny thus obtained, The QTL on chromosome 9 is located in a chromosome region defined by SNP TO-0201220 shown in SEQ ID NO: 1 and SNP shown in SEQ ID NO: 101, and the QTL on chromosome 11 is located in a chromosome region defined by SNP shown in SEQ ID NO: 102 and marker shown in SEQ ID NO: 115, and The QTL9 and / or QTL11 have the same sequence as the QTL9 and / or QTL11 present in the genome of the seeds of LVSTBRFVRES2 NCIMB deposit number 43591.

21. A method for improving the yield of tomato plants in an environment infected with ToBRFV, comprising growing a tomato plant comprising in the genome of the tomato plant a QTL9 on chromosome 9 and / or a QTL11 on chromosome 11 which is introgressed from a tomato gene from Ribes oleraceus and independently confers resistance to ToBRFV to the plant, wherein: The QTL9 and / or QTL11 have the same sequence as the QTL9 and / or QTL11 present in the genome of the plant with seed LVSTBRFVRES2NCIMB deposit number 43591, and for QTL9, it can be identified by at least one of the allele G of SNP TO-0201220 shown in SEQ ID NO: 1, the allele G of TO-0201221 shown in SEQ ID NO: 2, the allele A of TO-0201229 shown in SEQ ID NO: 10, the allele C of TO-0201231 shown in SEQ ID NO: 12, and the allele G of TO-0201233 shown in SEQ ID NO: 14, and for QTL11, it can be identified by at least one of the allele G of TO-0201237 shown in SEQ ID NO: 102, the allele A of TO-0201238 shown in SEQ ID NO: 103, the allele A of TO-0201239 shown in SEQ ID NO:

114. At least one of the allele A of TO-0201239 shown in NO: 104, the allele A of TO-0201240 shown in SEQ ID NO: 105, the allele A of TO-0201241 shown in SEQ ID NO: 106, the allele CT of SL2.50ch11_9684449 shown in SEQ ID NO: 112, the allele AT of SL2.50ch11_9779896 shown in SEQ ID NO: 113, the allele C of SL2.50ch11_9823405 shown in SEQ ID NO: 114, and the allele GT of SL2.50ch11_9924232 shown in SEQ ID NO: 115 can be identified.

22. A method for reducing tomato production losses under conditions of ToBRFV infection, comprising growing a tomato plant comprising in the genome of the tomato plant a QTL9 on chromosome 9 and / or a QTL11 on chromosome 11 introgressed from a tomato gene from C. cerana and independently conferring resistance to ToBRFV to the plant, wherein: The QTL9 and / or QTL11 have the same sequence as the QTL9 and / or QTL11 present in the genome of the plant with seed LVSTBRFVRES2NCIMB deposit number 43591, and for QTL9, it can be identified by at least one of the allele G of SNP TO-0201220 shown in SEQ ID NO: 1, the allele G of TO-0201221 shown in SEQ ID NO: 2, the allele A of TO-0201229 shown in SEQ ID NO: 10, the allele C of TO-0201231 shown in SEQ ID NO: 12, and the allele G of TO-0201233 shown in SEQ ID NO: 14, and for QTL11, it can be identified by at least one of the allele G of TO-0201237 shown in SEQ ID NO: 102, the allele A of TO-0201238 shown in SEQ ID NO: 103, the allele A of TO-0201239 shown in SEQ ID NO:

114. At least one of the allele A of TO-0201239 shown in NO: 104, the allele A of TO-0201240 shown in SEQ ID NO: 105, the allele A of TO-0201241 shown in SEQ ID NO: 106, the allele CT of SL2.50ch11_9684449 shown in SEQ ID NO: 112, the allele AT of SL2.50ch11_9779896 shown in SEQ ID NO: 113, the allele C of SL2.50ch11_9823405 shown in SEQ ID NO: 114, and the allele GT of SL2.50ch11_9924232 shown in SEQ ID NO: 115 can be identified.

23. The method according to claim 21 or 22, comprising: - Identification of a tomato plant resistant to ToBRFV, in whose genome it comprises QTL9 on chromosome 9, which is introgressed from the gene of currant tomato and confers resistance to ToBRFV to the fruit of the plant; or identification of a tomato plant resistant to ToBRFV, in whose genome it comprises QTL11 on chromosome 11, which is introgressed from the gene of currant tomato and confers resistance to ToBRFV to the leaves of the plant, wherein said QTL9 and / or QTL11 have the same sequence as the QTL9 and / or QTL11 present in the genome of the plant of seed LVSTBRFVRES2NCIMB deposit number 43591; - growing the plant in an environment infected by ToBRFV or under conditions infected by ToBRFV.

Images