Polypeptide targeting palmitoylation modification of aplnr protein and its application in treatment of cancer pain

Abstract

The application discloses a polypeptide targeting palmitoylation modification of APLNR protein and application thereof in cancer pain treatment, in particular, application of APLNR protein and a palmitoylation modification site of the APLNR protein in relieving morphine tolerance in treatment of cancer pain. It is found by the application that the palmitoylation modification of APLNR is one of important response factors of neuropathic cancer pain, and a polypeptide targeting palmitoylation modification of APLNR protein is developed by taking the APLNR protein as a target, and the polypeptide is combined with morphine to treat cancer pain, so that the cancer pain can be effectively reduced, and the occurrence of morphine tolerance can be relieved, thereby providing a new strategy for clinical treatment of cancer pain and relief of morphine tolerance.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the APLNR protein and the application of APLNR protein palmitylation modification sites in alleviating morphine resistance in the treatment of cancer pain, and further relating to a polypeptide that targets the palmitylation modification of APLNR protein and the application of the polypeptide in the preparation of drugs for treating cancer pain. Background Technology

[0002] Cancer is one of the leading diseases threatening human survival. While advancements in diagnostic techniques and treatment have extended the survival time of cancer patients, the pain caused by tumors inflicts immense physical and psychological suffering. Statistics show that approximately 40% of cancer pain patients experience neuropathic cancer pain. Managing neuropathic cancer pain is challenging. Clinically, opioids are often used in combination with other adjuvant analgesics. However, long-term use of opioid analgesics, such as morphine, easily leads to drug tolerance, significantly weakening their analgesic effect. Therefore, nearly half of patients still struggle to control their pain. Thus, there is an urgent need to discover new targets that can alleviate morphine resistance, providing new strategies for the clinical treatment of cancer pain.

[0003] Palmitoylation is an important post-translational modification of proteins, typically mediated by the DHHC protein family, which contains DHHC domains. Palmitoylation links to cysteine ​​residues in proteins via thioester bonds and is a crucial regulatory mechanism for protein localization, intracellular transport, and stability. Recent studies have shown that palmitoylation plays a significant role in tumor cell proliferation and migration, and is closely related to neuronal development and glial cell differentiation and maturation. In the development of neuropathic cancer pain, glial cells in the nervous system are activated, and these activated glial cells further exacerbate cancer pain by synthesizing and releasing pro-inflammatory cytokines, leading to persistent pain. Research has found that palmitoylation plays a vital regulatory role in the activation and proliferation of microglia and astrocytes through key proteins such as STAT3 and GFAP. These studies suggest that palmitoylation may play a crucial role in the development and progression of neuropathic cancer pain.

[0004] This invention aims to elucidate the application of an APLNR protein and its palmitylation modification site in alleviating morphine resistance during cancer pain treatment, and to elucidate the application of a polypeptide targeting palmitylation modification of the APLNR protein and its combination with morphine in the preparation of drugs for treating cancer pain. Summary of the Invention

[0005] In view of this, the present invention provides an application of the APLNR protein and its palmitoylation modification site in alleviating morphine resistance during cancer pain treatment. The present invention discovers that APLNR palmitoylation modification is one of the important response factors in the development of neuropathic cancer pain. By targeting the APLNR protein, a peptide targeting APLNR protein palmitoylation modification is developed for combined treatment with morphine to treat cancer pain. This effectively reduces spontaneous pain and alleviates the development of morphine resistance, providing a new strategy for the clinical treatment of cancer pain and the alleviation of morphine resistance.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] This invention first provides the application of APLNR protein as a novel target in alleviating morphine resistance during cancer pain treatment.

[0008] This invention further provides the application of the palmitoylation modification site of APLNR protein in alleviating morphine resistance during the treatment of cancer pain.

[0009] The present invention further provides a polypeptide that targets palmitoylation modification of APLNR protein, wherein the polypeptide is a fusion polypeptide of an APLNR protein palmitoylation inhibitory polypeptide and a cell membrane-penetrating peptide.

[0010] Preferably, the APLNR protein palmitoylation inhibitory polypeptide is one or more of the following polypeptides:

[0011] (A) A polypeptide having the amino acid sequence shown in SEQ ID No. 2;

[0012] (B) A polypeptide having more than 80% homology with the amino acid sequence shown in SEQ ID No. 2;

[0013] (C) A derivative polypeptide formed by adding, substituting or deleting one or more amino acids of the amino acid sequence shown in SEQ ID No. 2, and having the same or substantially the same function as the polypeptide described in (A);

[0014] Preferably, the cell-penetrating peptide is cell-penetrating peptide R9.

[0015] The present invention further provides a nucleic acid comprising a nucleic acid sequence encoding a polypeptide targeting palmitoylation modification of the APLNR protein as described above.

[0016] The present invention further provides an expression vector comprising the nucleic acid as described above.

[0017] The present invention further provides a host cell, the host cell comprising the expression vector as described above.

[0018] The present invention further provides the use of the peptide targeting palmitoylation modification of APLNR protein as described above in the preparation of a drug for treating cancer pain, wherein the drug contains morphine.

[0019] The present invention further provides a combination drug composition comprising the polypeptide and morphine as described above;

[0020] Preferably, in the combined drug composition, the injection dose ranges of the polypeptide and morphine are 25-50 μg / animal and 5-10 μg / animal, respectively.

[0021] The present invention further provides the use of the combination drug composition as described above in the preparation of drugs for treating cancer pain.

[0022] The present invention further provides a medicament for treating cancer pain, comprising the combination drug composition as described above.

[0023] The beneficial effects of this invention are as follows:

[0024] This invention discovers that palmitoylation modification of the APLNR protein is one of the important response factors in the development of neuropathic cancer pain and is associated with its occurrence. This invention obtained the palmitoylation modification site of the APLNR protein by constructing a mouse model of neuropathic cancer pain and developed a peptide targeting this modification. Combining this peptide with morphine can reduce spontaneous pain and alleviate morphine tolerance. This provides a new strategy for the clinical treatment of cancer pain (especially neuropathic cancer pain) and the alleviation of morphine tolerance. Attached Figure Description

[0025] Figure 1 The changes in the incidence of spontaneous pain in the neuropathic cancer pain model mice in Example 1 are shown.

[0026] Figure 2 Analysis of DHHC family expression in the spinal cord of the neuropathic cancer pain model mouse in Example 2;

[0027] Figure 3 Identification and analysis of palmitoylated modified proteins in the spinal cord of the neuropathic cancer pain model mouse in Example 3;

[0028] Figure 4 Analysis of palmitoylation modification of APLNR protein in the spinal cord of the neuropathic cancer pain model mouse in Example 4;

[0029] Figure 5 Identification and analysis of palmitoylation modification sites of APLNR protein in Example 6;

[0030] Figure 6 This shows the changes in the incidence of spontaneous pain in mice with a neuropathic cancer pain model treated with a peptide targeting palmitoylation modification of the APLNR protein in combination with morphine, as described in Example 7. Detailed Implementation

[0031] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0033] The first aspect of this invention discloses the application of APLNR protein as a novel target in alleviating morphine resistance during the treatment of cancer pain.

[0034] The second aspect of this invention discloses the application of palmitoylation modification sites of APLNR protein in alleviating morphine resistance during the treatment of cancer pain, specifically palmitoylation modification sites being Cys at positions 325 and / or 326 in the APLNR protein.

[0035] Cancer pain, as discussed in this article, refers to pain directly caused by tumors (such as tumor compression or invasion of the peripheral or central nervous system); or neuropathic pain caused by nerve damage resulting from radiotherapy, chemotherapy, or surgery in cancer patients. Approximately 40% of cancer pain patients experience neuropathic cancer pain. Clinically, cancer pain is primarily relieved or treated with opioid analgesics, such as morphine. However, these drugs are prone to drug tolerance, significantly weakening their analgesic effect.

[0036] Apelin, or APJ receptor (genetic symbol APLNR), is a G protein-coupled receptor containing seven hydrophobic transmembrane domains. Apelin (also known as APLN) is a 36-amino acid peptide encoded by the APLN gene in humans and is an endogenous ligand for the APJ receptor. It is found in many tissues, such as the heart, kidneys, pancreas, lungs, vascular system, central nervous system, liver, adipose tissue, gastrointestinal tract, brain, adrenal glands, endothelium, and human plasma. The Apelin / APJ system participates in various physiological functions and pathological processes, playing important roles in inflammation and oxidative stress. Apelin / APJ is distributed in pain-related structures, such as the amygdala, hypothalamus, dorsal raphe nucleus, and spinal cord, participating in nociception and playing a crucial role in the sensitization of neuropathic pain. Therefore, the APLNR protein (amino acid sequence shown in SEQ ID No. 1) may be associated with the development and progression of neuropathic cancer pain.

[0037] This application, through the construction of a mouse model of neuropathic cancer pain, found that as cancer pain progresses, the palmitoylation level of APLNR protein in the dorsal horn tissue of the spinal cord gradually increases, confirming that palmitoylation modification of APLNR protein is one of the important response factors in the occurrence of neuropathic cancer pain.

[0038] Furthermore, this application designed experiments to predict and identify the palmitoylation modification sites of the APLNR protein, and found that the APLNR protein has two palmitoylation modification sites, namely Cys325 and Cys326.

[0039] The third aspect of this invention discloses a polypeptide that targets palmitoylation modification of APLNR protein, wherein the polypeptide is a fusion polypeptide of an APLNR protein palmitoylation inhibitory polypeptide and a cell membrane-penetrating peptide.

[0040] The APLNR protein palmitoylation inhibitory polypeptide is one or more of the following polypeptides:

[0041] (A) A polypeptide having the amino acid sequence ACTSMLCCGQSRCAG (SEQ ID No. 2);

[0042] (B) A polypeptide having more than 80% homology with the amino acid sequence shown in SEQ ID No. 2;

[0043] (C) A derivative polypeptide formed by adding, substituting or deleting one or more amino acids of the amino acid sequence shown in SEQ ID No. 2, and having the same or substantially the same function as the polypeptide described in (A).

[0044] The polypeptide in (B) above is a polypeptide that has more than 80% homology with the amino acid sequence shown in SEQ ID No. 2. For example, it may be a polypeptide that has 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology with the amino acid sequence shown in SEQ ID No. 2.

[0045] Furthermore, the fusion polypeptide in this invention is obtained by linking the aforementioned APLNR protein palmitoylation inhibitory polypeptide with a cell-penetrating peptide in a manner known in the art. The specific method can be solid-phase or liquid-phase synthesis, etc., which will not be elaborated here. In some specific embodiments of this invention, the cell-penetrating peptide is cell-penetrating peptide R9, whose amino acid sequence is RRRRRRRRR, and the amino acid sequence of the fusion polypeptide is shown in SEQ ID No. 3 (RRRRRRRRRACTSMLCCGQSRCAG).

[0046] A fourth aspect of the present invention provides a nucleic acid comprising a nucleic acid sequence encoding a polypeptide targeting palmitoylation modification of the APLNR protein as described in the third aspect of the present invention.

[0047] The encoded nucleic acid sequence can be in the form of DNA or RNA, and the DNA form includes cDNA, genomic DNA or artificially synthesized DNA.

[0048] The fifth aspect of the present invention provides an expression vector comprising the nucleic acid as described in the fourth aspect of the present invention. Specifically, the encoded nucleic acid sequence described in the fourth aspect of the present invention can be inserted into the expression vector. The expression vector described herein is not particularly limited, as long as it can be stably replicated in the host. Specific examples include, but are not limited to, plasmids, bacteriophages, plant cell or mammalian cell viruses or other similar vectors well known in the art.

[0049] The method for constructing the expression vector in this invention is not particularly limited; any conventional method in the art is acceptable, and will not be described in detail here.

[0050] A sixth aspect of the present invention provides a host cell comprising an expression vector as described in a fifth aspect of the present invention.

[0051] The host cell may be any type well known in the art, such as a eukaryotic cell or a prokaryotic cell.

[0052] The seventh aspect of the present invention provides the use of a polypeptide targeting palmitoylation modification of the APLNR protein as described in the third aspect of the present invention in the preparation of a medicament for treating cancer pain, wherein the medicament contains morphine.

[0053] The eighth aspect of the present invention provides a combined drug composition, which comprises the polypeptide as described in the third aspect of the present invention and morphine; the "combination" or "combination use" as described herein means that two or more active substances can be administered to a subject simultaneously as separate preparations or in any order as separate preparations in turn.

[0054] Preferably, in the combined drug composition, calculated by the total injection amount per mouse, the injection dosage ranges of the polypeptide and morphine are 25 - 50 μg / mouse and 5 - 10 μg / mouse respectively.

[0055] The ninth aspect of the present invention provides the use of the combined drug composition as described in the eighth aspect of the present invention in the preparation of a drug for treating cancer pain.

[0056] The tenth aspect of the present invention provides a drug for treating cancer pain, which contains the combined drug composition as described in the eighth aspect of the present invention.

[0057] In the above drug for treating cancer pain, taking the combined drug composition composed of the polypeptide and morphine as described in the third aspect of the present invention as the active ingredient, it can be understood that the above drug for treating cancer pain also includes any pharmaceutically acceptable excipients, such as excipients, diluents, etc., which will not be specifically elaborated here.

[0058] Furthermore, in the above drug for treating cancer pain, both the polypeptide or the combined drug composition should be in a therapeutically effective dose. It can be understood that the therapeutically effective dose here refers to an amount sufficient to relieve or treat cancer pain; after being used for a specific patient or medical subject, the following changes may occur: the condition of cancer pain is improved.

[0059] The present invention will be described below through specific examples. It should be noted that the following specific examples are only for illustrative purposes and do not limit the scope of the present invention in any way. In addition, unless otherwise specified, the methods without specific conditions or steps recorded are all conventional methods, and the reagents and materials used can be obtained from commercial channels.

[0060] Example 1 Construction of a mouse neuropathic cancer model

[0061] Prepare materials

[0062] Mouse ascites tumor S-180 cells were purchased from the Cell Bank of the Shanghai Institute of Chinese Academy of Sciences; SPF-grade adult healthy C57BL / 6 mice, half male and half female, 6 - 8 weeks old, weighing 20 - 25 g, were provided by Chengdu Yakang Biotech Co., Ltd., license number: SCXK(Sichuan)2020 - 034.

[0063] Analytical methods

[0064] The animal experiment protocol was approved by the Laboratory Animal Ethics Committee of the Hefei Institutes of Physical Science, Chinese Academy of Sciences. In accordance with animal ethics requirements, the animals were first raised for one week in the animal facility of the Hefei Institutes of Physical Science, Chinese Academy of Sciences, in a specific pathogen-free animal (i.e., SPF grade) facility to acclimatize to the environment.

[0065] The specific steps are as follows: Mouse ascites tumor S-180 cells were cultured in RPMI-1640 medium containing 10% (v / v) high-quality fetal bovine serum and 1% (v / v) penicillin (100 U / ml)-streptomycin (0.1 mg / ml) under 37°C and 5% CO2 conditions; when the cells reached 80% confluence, they were digested with 0.25% trypsin, and the cells were collected by centrifugation; the cells were resuspended in PBS, collected by centrifugation, and the cell concentration was adjusted to 1×10⁶ cells / ml by adding serum-free medium. 7 Mice were weighed and anesthetized with 7% chloral hydrate via intraperitoneal injection (5 ml / kg). After satisfactory anesthesia (stable respiration and no spontaneous limb movement after injection), the mice were placed on the operating table. 0.1 ml (approximately 1 × 10⁻⁶) was dispensed into a 1 ml syringe. 6 (Number of cells) were inoculated into the peritoneal cavity of mice; after 7 days of culture, mice in good condition with abundant ascites were selected, and the ascites fluid was extracted as the tumor source, centrifuged to remove the ascites fluid; the ascites fluid was then adjusted to 1×10⁻⁶ cells using serum-free culture medium. 7 per ml.

[0066] The experimental mice were weighed again and anesthetized with an intraperitoneal injection of 7% chloral hydrate (5 ml / kg). After satisfactory anesthesia (stable respiration and no spontaneous limb movement after injection), the mice were placed on the operating table, and their right legs were fixed. The mice were randomly divided into a model group and a control group with equal numbers of mice. 0.2 ml (2 × 10⁻⁶) was dispensed into a 1 ml syringe. 6 (One cell), the needle was inserted at an angle to the administration surface into the sciatic nerve muscle of the right leg of the model group mice. A slight resistance was felt, and the cells were slowly injected. When withdrawing the needle, the thumb and forefinger of the left hand were pressed against the injection site for a moment to prevent leakage of cell fluid. The control group mice were injected with an equal volume of ascites supernatant at the same location. After the modeling was completed, the mice were returned to their original feeding positions. From 9:00 to 10:00 AM daily, the spontaneous pain behavior of raising and licking the right paw of the model group and control group mice was observed for 1 minute each time, for a total of 3 times, and the incidence rate was recorded.

[0067] Results Analysis

[0068] The results are as follows Figure 1 As shown, it can be seen that the model group mice began to exhibit spontaneous pain behavior of lifting and licking their right paws on the fifth day of modeling; and as the modeling time increased, the incidence of spontaneous pain in the model group mice gradually increased, indicating the successful establishment of a neuropathic cancer pain model.

[0069] Example 2: Analysis of DHHC family expression in spinal cord tissue of a mouse model of neuropathic cancer pain

[0070] Prepare materials

[0071] Tissue from the dorsal horn (right side) of the spinal cord at L4-L6 in a mouse model of neuropathic cancer pain on day 12 after cell inoculation;

[0072] All PCR primers were synthesized by Nanjing Genewiz Biotechnology Co., Ltd., and the specific information is as follows:

[0073]

[0074] Analytical methods

[0075] The establishment of the neuropathic cancer pain model was the same as in procedure 1. On day 12 after cell inoculation, the experimental animals were euthanized using carbon dioxide inhalation. The L4-L6 vertebrae were completely dissected, and the dorsal horn tissue of the right spinal cord at L4-6 was carefully dissected.

[0076] Spinal cord tissue was placed in a 1.5 ml centrifuge tube containing 1 ml TRIzol; homogenized using a homogenizer, and the homogenized sample was incubated at room temperature (15-30℃) for 5 minutes to allow complete separation of the nucleic acid-protein complex, followed by centrifugation for 10 minutes (4℃, 10000g); the supernatant was collected, 0.2 ml chloroform was added, and the mixture was vigorously vortexed for 15 seconds and incubated at room temperature for 3 minutes; it was then centrifuged again for 15 minutes (4℃, 10000g); the aqueous phase was transferred to a new tube (approximately 0.5 ml), and an equal volume (0.5 ml) of isopropanol was added, and the mixture was incubated at room temperature for 10 minutes; it was then centrifuged for 10 minutes (4℃, 10000g), the supernatant was discarded, and 1 ml of 75% ethanol was added to wash the RNA precipitate; the precipitate was centrifuged at 7500×g for 5 minutes at 4℃, the supernatant was discarded, and the RNA precipitate was vacuum-dried; 100 μl of RNase-free water was added, and the mixture was pipetted several times and incubated at 55-60℃ for 5 minutes to dissolve the RNA; the RNA was then dissolved using a Thermo NanoDrop syringe. Quantify RNA samples using the 2000 standard, following the instructions in the manual.

[0077] Based on the quantitative results, 100 ng of RNA sample was taken and qRT-PCR was performed using the TransGen Biotech One-Step qRT-PCR Kit (TansScript II Green One-Step qRT-PCR SuperMix), following the instructions. Roche LightCycler Use the 480II real-time quantitative PCR system for PCR reaction and analysis, following the instructions.

[0078] Results Analysis

[0079] See results Figure 2 .pass Figure 2 It can be seen that, compared with the control group, the expression of DHHC family members ZDHHC5, ZDHHC9, ZDHHC17 and ZDHHC19 in the spinal cord of the neuropathic cancer pain model mice was increased to varying degrees, indicating that palmitoylation modification may be involved in the development of neuropathic cancer pain.

[0080] Example 3: Identification and analysis of palmitoylated modified proteins in the spinal cord of a mouse model of neuropathic cancer pain

[0081] Prepare materials

[0082] Tissue from the L4-L6 dorsal horn (right side) of the spinal cord in a mouse model of neuropathic cancer pain, 12 days after cell seeding; reagents were prepared as follows:

[0083] ①N-Ethylmaleimide (NEM) (prepare fresh for use): First, prepare a 2M stock solution with anhydrous ethanol, then dilute it with WB and IP lysis buffer to a 50mM working solution, pH 7.4;

[0084] ② Hydroxylamine (HAM): Prepared with WB and IP lysis buffer, concentration 1M, pH 7.4, and stored at -20℃;

[0085] ③HDPD-Biotin: Dissolve 1 mg of HDPD-Biotin powder in 463 μL of DMSO to a concentration of 4 mM, pH 6.2. Dissolution can be promoted at 55-60℃. Then dilute with WB and IP lysis buffer to a working concentration of 50 μM and store at -20℃.

[0086] Analytical methods

[0087] The method for obtaining L4-6 spinal cord tissue from the neuropathic cancer pain model mouse was the same as in Example 2. Freshly collected spinal cord tissue samples were rinsed with PBS buffer and weighed (20 mg). The protease inhibitor PMSF and RIPA lysis buffer were mixed at a ratio of 1:100 (final PMSF concentration: 1 mM), placed on ice, and 200 μl was added to the spinal cord tissue. The tissue was homogenized again using a homogenizer, and then repeatedly pipetted approximately 200 times to fully lyse the spinal cord cells (operated on ice). The tissue was centrifuged for 10 minutes (4°C, 10000 g). The supernatant was then transferred to a new 1.5 ml centrifuge tube, and protein quantification was performed using the BCA kit from Beyotime Biotechnology Co., Ltd., following the manufacturer's instructions. Two replicates were set for each sample. Based on the protein quantification results, the protein concentration was adjusted to 2 mg / mL.

[0088] Take 500 μg of protein, add 12.5 μL of NEM, rotate at low speed on a vertical rotator, and incubate at 4°C for 1 hour; fill the centrifuge tube with acetone at -20°C all at once, and let it stand at -20°C for 40 minutes; centrifuge for 20 minutes (4°C, 5000g), remove the supernatant, and repeat twice; add 200 μL of PBS, and divide the sample into two 100 μL tubes.

[0089] The experimental group was added with 500 μL of 1M HAM, and the control group was added with 500 μL of WB and IP lysis buffer. Both were incubated on a vertical spinner at room temperature for 1 h. 500 μL of HPDP-Biotin was added to each tube and incubated at room temperature for 1 h. Acetone at -20°C was added to the centrifuge tubes, and the tubes were incubated at -20°C for 40 minutes. The tubes were centrifuged for 20 minutes (4°C, 5000g), and the supernatant was removed. This process was repeated twice. 200 μL of PBS was added to dissolve the supernatant. Streptavidin magnetic beads (M270, 65305) were vortexed for 10 seconds to mix thoroughly. The yellow pipette tip was trimmed by 3 mm, and 30 μL of the magnetic beads (per centrifuge tube) was pipetted into 500 μL of PBS. Wash twice with PBS. Place the centrifuge tube on a magnetic rack for 20 seconds to adsorb the column beads, then discard the PBS. Add the mixture dissolved in PBS to the magnetic beads and rotate at low speed on a vertical rotator at room temperature for 1 hour. Adsorb the magnetic beads with a magnetic rack, discard the supernatant, and wash the magnetic beads 5 times with PBST, inverting them 7-8 times each time. Discard the PBST, add 40 μL of 2×SDS Loading buffer to the magnetic beads, and boil at 100°C for 10 minutes. Adsorb the magnetic beads with a magnetic rack and keep the supernatant for later use.

[0090] In this laboratory, we used 30% N-methyl-3-bisacrylamide to prepare a 10% separating gel and a 4% stacking gel according to the formula. First, we added the separating gel and then sealed it with isopropanol. After the separating gel solidified (about 25 minutes at room temperature), we removed the isopropanol and added the stacking gel. We inserted the comb and waited for the stacking gel to solidify. We took 20 μl of protein sample and added it to the sample well. Finally, we added the pre-stained protein marker. We turned on the power and adjusted the voltage to 80V. After the protein sample entered the separating gel, we increased the voltage to 100V. According to the pre-stained marker, we stopped electrophoresis when the smallest molecular weight protein marker was 1 cm away from the bottom edge of the separating gel.

[0091] After electrophoresis, the gel was collected and proteins were stained with silver using the Beyotime Biotechnology Co., Ltd. rapid silver staining kit, following the instructions. Protein bands with a molecular weight of 40-55 kDa were cut with a sterile, protein-free scalpel and identified by mass spectrometry.

[0092] Results Analysis

[0093] See results Figure 3 .pass Figure 3As can be seen, compared with the control, there was an increased expression of a protein at the 40kDa position in the neuropathic cancer pain model group; mass spectrometry identification revealed that this band was the protein APLNR, indicating that the palmitoylation modification level of APLNR protein in mice was upregulated in the neuropathic cancer pain model.

[0094] Example 4: Analysis of palmitoylation modification of APLNR protein in the spinal cord of a mouse model of neuropathic cancer pain

[0095] Prepare materials

[0096] L4-L6 spinal cord tissues of a mouse model of neuropathic cancer pain on days 5, 10, and 15 after cell inoculation.

[0097] Analytical methods

[0098] The establishment of the neuropathic cancer pain model was the same as in Example 1. The method for obtaining L4-6 spinal cord tissue from the neuropathic cancer pain model mice was the same as in Example 2. The lysis, total protein extraction, acyl-biotin exchange reaction, and protein electrophoresis of the L4-6 spinal cord tissue from the neuropathic cancer pain model mice were the same as in Example 3. Then, Western blotting analysis was performed. The specific steps are as follows:

[0099] Before electrophoresis, prepare the PVDF membrane, filter paper, sponge, etc. Soak the PVDF membrane in methanol for about 30 seconds, then soak it, the filter paper, sponge, and clamp in cold transfer buffer. After preparation, cut off the gel block, assemble it, and start the transfer. Surround the outside of the transfer tank with ice to cool it down. Turn on the power and maintain a constant current of 400mA for 60 minutes (depending on the molecular weight of the target band).

[0100] After the transfer was completed, the PVDF membrane was removed from the transfer tank, the front and back sides were marked, and then rinsed in TBST buffer for 10 minutes, 3 times. The PVDF membrane was then blocked with 5% skim milk powder and decolorized by shaking at room temperature for 1 hour.

[0101] After sealing, the PVDF membrane was rinsed in TBST buffer for 10 minutes, 3 times. The PVDF membrane was then immersed in Streptavidin (HRP) antibody, mouse anti-APLNR antibody and mouse anti-β-actin antibody solution, respectively, and incubated overnight (about 16 hours) at 4°C with shaking.

[0102] The next day, after removing the membrane, incubate at room temperature with shaking for 30 minutes, then rinse with TBST for 10 minutes, 3 times. Add horseradish peroxidase (HRP)-labeled goat anti-mouse IgG solution and incubate at 37°C for 1 hour (note that this step is not required for PVDF membranes incubated with Streptavidin (HRP) antibody). Rinse with TBST for 10 minutes, 3 times. Develop the color with an ECL luminescence kit and save the data.

[0103] Results Analysis

[0104] See results Figure 4 ,pass Figure 4 The results show that as the modeling time of the neuropathic cancer pain model increases, the palmitoylation level of APLNR protein gradually increases.

[0105] Example 5: Prediction of APLNR palmityl modification sites

[0106] Prepare materials

[0107] The protein palmitoylation modification site prediction tool CSS-Palm 2.0 software is available from the website http: / / csspalm.biocuckoo.org (free and open to the public).

[0108] Analytical methods

[0109] The amino acid sequence (SEQ ID No. 1) of APLNR (Homo sapiens, NP_005152.1) was input into CSS-Palm2.0 software, and Thershold was set to Medium to predict the palmitoylation modification sites of APLNR.

[0110] Results Analysis

[0111] The results are shown in Table 1.

[0112] Table 1 Prediction results of APLNR palmitylation modification sites

[0113] Position Peptide Score Cutoff Cluster 1 325 QACTSMLCCGQSRCA 16.611 2.412 B 2 326 ACTSMLCCGQSRCAG 8.198 3.717 C

[0114] Based on the prediction results in Table 1, the APLNR protein has two potential palmitoylation modification sites, namely Cys325 and Cys326.

[0115] Example 6: Identification and Analysis of APLNR Palmitylation Modification Sites

[0116] Prepare materials

[0117] The mouse microglia cell line BV2 was purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences. After the frozen BV2 cells were thawed, they were cultured in DMEM medium supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin at 37°C and 5% CO2. When the cell confluence reached 80%-90%, the cells were passaged.

[0118] Analytical methods

[0119] Use the Invitrogen website (https: / / www.thermofisher.cn / cn / zh / home / life-science / genome-editing / geneart-crispr / invitrogen-truedesign-genome-editor.html) to design the APLNR CRIPSR point mutation sequences. The specific information is as follows:

[0120] CRISPR Target Sequence Donor DNA APLNR S325 ACAGCAGAGCATGGAGGTGC CTCCATGCTCGCCTGTGGCCA APLNR S326 ACAGCAGAGCATGGAGGTGC ATGCTCTGCGCTGGCCAGAG

[0121] According to the designed target gene sequences, use sgRNA, Truecut Cas9 Protein V2 Reagent, and CRIPSRMAX reagent to construct APLNR C325A (cysteine at position 325 of APLNR is mutated to alanine), C326A (cysteine at position 326 of APLNR is mutated to alanine), and C325A and C326A (cysteines at positions 325 and 326 of APLNR are both mutated to alanine) mutant cells in BV2 cells. Operate specifically according to the instructions.

[0122] The lysis, total protein extraction, acyl-biotin exchange reaction, and protein electrophoresis of APLNR C325A, C326A, C325A and C326A BV2 cells are the same as in Example 3, and the Western Blot analysis is the same as in Example 4.

[0123] Results Analysis

[0124] The results are shown in Figure 5 . It can be seen from Figure 5 that compared with the unmutated wild-type BV2 cells, the palmitoylation modification bands of APLNR in APLNR C325A, C326A, C325A and C326A BV2 cells are weakened. Among them, the palmitoylation modification level of APLNR in APLNR C325A and C326A BV2 cells will be significantly inhibited, indicating that Cys 325 and Cys 326 are the palmitoylation modification sites of APLNR.

[0125] Example 7 Analysis of the Effect of Targeting APLNR Palmitoylation-Modified Polypeptide Combined with Morphine on Neuropathic Cancer Pain in Mice

[0126] Material preparation

[0127] SPF-grade adult healthy C57BL / 6 mice, half male and half female, 6 - 8 weeks old, weighing 20 - 25 g, were provided by Chengdu Yakang Biotechnology Co., Ltd., license number: SCXK (Chuan) 2020 - 034.

[0128] The palmitoyl-modified peptide APLNR-S1 (RRRRRRRRR-ACTSMLCCGQSRCAG, SEQ ID No. 3) and the control peptide APLNR-S0 (RRRRRRRRRR-ACTSMLAAGQSRCAG, SEQ ID No. 20) were synthesized by Nanjing Genscript Biotech Co., Ltd.

[0129] Analytical methods

[0130] The establishment of the mouse neuropathic cancer model was the same as in Example 1.

[0131] The neuropathic cancer pain model group was divided into experimental groups starting on day 10 after cell seeding. Specific grouping and injection information are as follows:

[0132]

[0133] Mice were administered intrathecal injections every morning. A 30G needle (0.3mm outer diameter) was used to draw up the injection solution. Using the thumb or forefinger of the dominant hand, the intervertebral spaces along the midline of the bilateral iliac bones were located. An indentation was made with the fingernail to indicate the L5-L6 intervertebral space as the injection site. The needle was gently inserted vertically (or slightly at 70-80°) into the intersection of the indentation, keeping the syringe vertical. When the bone was touched, the angle was slowly reduced to approximately 30°. The needle was then slid into the intervertebral space, and the injection solution was injected at a rate of 1 μl every 4 seconds. After injection, the needle was held in place for approximately 1 minute, and then the syringe was gently rotated out to avoid leakage. After injection, the limb function of the mice was assessed to observe for weakness or paralysis in the limbs.

[0134] Before and 30 minutes after intrathecal injection of the drug, spontaneous pain behavior of mice in each experimental group lifting and licking their right paw was observed for 1 minute each time, for a total of 3 times, and the incidence rate was recorded.

[0135] Results Analysis

[0136] See results Figure 6 .pass Figure 6It can be seen that, compared with the control group, morphine injection on day 2 significantly inhibited spontaneous pain behavior in mice with cancer pain. However, on day 5 of continuous drug treatment, the inhibited spontaneous pain behavior in the Morphine injection group increased, indicating that the mice with cancer pain developed morphine treatment tolerance. Compared with the morphine group and combination group 1, spontaneous pain behavior in mice in combination group 2 was better inhibited on days 2 and 5, indicating that using the palmitoylated modified peptide APLNR-S1 targeting the APLNR protein in combination with morphine can effectively enhance the analgesic effect of morphine and alleviate the occurrence of morphine tolerance.

[0137] Furthermore, based on Example 7, using the same implementation method as Example 7, corresponding experiments were conducted for different combination groups, and the specific information is as follows:

[0138]

[0139] The results showed that the combination of APLNR-S1, a palmitoylated modification peptide targeting APLNR protein, in groups 3-5, with morphine could effectively enhance the analgesic effect of morphine and effectively alleviate the occurrence of morphine tolerance.

[0140] In conclusion, the combined use of APLNR protein palmitoylation-modifying peptides with morphine can effectively enhance the analgesic effect of morphine and alleviate the development of morphine tolerance. This is because the APLNR protein palmitoylation-modifying peptides, when used in combination with morphine, target and inhibit the palmitoylation modification of APLNR, thus delaying the progression of cancer pain and inhibiting the development of morphine resistance.

[0141] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0142] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A polypeptide targeting the palmitoylation modification of the APLNR protein, characterized in that, The palmitoylation modification site is Cys at position 325 and / or Cys at position 326 in the APLNR protein, and the amino acid sequence of the polypeptide is shown in SEQ ID No.

3.

2. A nucleic acid, characterized in that, The nucleic acid comprises a nucleic acid sequence encoding the polypeptide for targeting palmitoylation modification of the APLNR protein according to claim 1.

3. An expression vector, characterized by, The expression vector comprises the nucleic acid according to claim 2.

4. A host cell, characterized in that, The host cell comprises the expression vector according to claim 3.

5. Use of the polypeptide for targeting palmitoylation modification of the APLNR protein according to claim 1 in the preparation of a drug for relieving drug resistance of morphine in the treatment of cancer pain.

6. A combination pharmaceutical composition for treating cancer pain, comprising, The combined pharmaceutical composition comprises the polypeptide according to claim 1 and morphine.

7. Use of the combined pharmaceutical composition according to claim 6 in the preparation of a drug for treating cancer pain.

8. A medicament for treating cancer pain, characterized by comprising a compound of the formula (I) or a pharmaceutically acceptable salt thereof. The combined pharmaceutical composition according to claim 6.

Images