A method for preparing adrenaline by whole-cell catalysis

Abstract

The invention discloses a method for preparing adrenaline by whole-cell catalysis. The whole-cell catalysis strategy is adopted to construct a biosynthetic pathway of exogenous adrenaline in Escherichia coli. Escherichia coli is used as a chassis cell and dopamine is used as a substrate. By expressing exogenous dopamine β-hydroxylase and phenylethanolamine-N-methyltransferase, the substrate dopamine can be converted into adrenaline and secreted outside the cell. The method is simple, the product is easy to collect and separate, and no expensive coenzyme is required.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a method for preparing adrenaline by whole-cell catalysis. Background Art

[0002] Epinephrine (Epinephrine or Adrenaline, abbreviated as E or A) is a hormone and neurotransmitter secreted by the adrenal glands. Epinephrine is a sympathomimetic amine that directly acts on the adrenal α and β receptors. It is a vasoactive drug commonly used in clinical practice to prevent shock. It is also used in the treatment of other allergic diseases such as bronchial asthma and urticaria. It is beneficial for local hemostasis and prolonged drug effect when used in combination with local anesthetics. Epinephrine increases the contractility of the heart, dilates the blood vessels of the heart, liver, and bones, and contracts the blood vessels of the skin and mucous membranes. It is a must-have for rescuing critically ill people or animals.

[0003] The synthesis of adrenaline is generally a chemical method. CN113735720A discloses a method for synthesizing (±) adrenaline, that is, formate is used as a hydrogen donor, palladium carbon is used as a catalyst, and adrenolide hydrochloride is reduced to (±) adrenaline under the condition that the pH of the reaction solution is 2.0-4.0 and nitrogen is introduced. This synthesis method has the advantages of high yield and easy scale-up production. CN112409193A discloses a method for refining adrenaline, that is, adrenaline is first reacted with L-tartaric acid to prepare L-tartaric acid adrenaline tide product, remove the right-handed isomer, and improve the optical rotation; then the obtained L-tartaric acid adrenaline salt is dissolved in water, and after decolorization, ammonia water of appropriate concentration is added dropwise for crystallization to obtain a finished adrenaline product with a melting point that meets the index. The chemical synthesis and refining process involves many steps, and the reaction conditions and catalyst requirements are relatively high.

[0004] Compared with chemical synthesis, microbial transformation has developed rapidly in recent years. It is environmentally friendly, does not require high-pressure catalysts, has low pollution and high product yield. CN 111607624A discloses a method for preparing adrenaline by biotransformation, which specifically includes the following steps: first constructing Escherichia coli genetic engineering bacteria BL21 (DE3) / pET28a-PNMT expressing phenylethanolamine-N-methyltransferase (PNMT); culturing genetic engineering bacteria BL21 (DE3) / pET28a-PNMT and inducing expression of PNMT; centrifuging to eliminate impurities and obtain a crude enzyme solution of PNMT; finally, norepinephrine and S-adenosyl-methionine (SAM) are used as substrates, and the PNMT crude enzyme solution is added to react to obtain the product adrenaline. The extracellular biotransformation method is simpler and more efficient than chemical synthesis, but it is necessary to express the target protein first and add the coenzyme SAM, resulting in high costs. Summary of the invention

[0005] The purpose of the present invention is to overcome the defects of the prior art and provide a method for preparing adrenaline by whole-cell catalysis.

[0006] The technical solution of the present invention is as follows:

[0007] A method for preparing adrenaline by whole-cell catalysis, using recombinant Escherichia coli as a cell catalyst, reacting in a reaction system containing substrate dopamine, converting dopamine into adrenaline and secreting it outside the cell, the recombinant Escherichia coli expressing dopamine B-hydroxylase derived from humans, cattle, chickens or corn and phenylethanolamine-N-methyltransferase derived from humans, rabbits or guinea pigs, the nucleotide sequence of the dopamine β-hydroxylase is shown in SEQ ID NO.01, 02, 03 or 04, and the nucleotide sequence of the phenylethanolamine-N-methyltransferase is shown in SEQ ID NO.05, 06 or 07.

[0008] In a preferred embodiment of the present invention, the dopamine β-hydroxylase and the phenylethanolamine-N-methyltransferase are both derived from humans, and their nucleotide sequences are shown in SEQ ID NOs.01 and 05.

[0009] In a preferred embodiment of the present invention, the recombinant Escherichia coli uses pTrc99A as an expression vector.

[0010] In a preferred embodiment of the present invention, the chassis cell of the recombinant Escherichia coli is E. coli MG1655 or E. coli BW25113.

[0011] In a preferred embodiment of the present invention, the concentration of dopamine in the reaction system is 2.5-3.4 g / 100 mL, and the solvent of the reaction system is 0.1 M Tris buffer with a pH of 6.5.

[0012] Further preferably, the reaction conditions are: maintaining the dissolved oxygen content at 0.8-1.04 mM, and reacting in a shaker at 30° C. and 220 rpm for 2-3 hours.

[0013] A recombinant Escherichia coli for catalyzing the preparation of adrenaline, which uses pTrc99A as an expression vector, uses E. coli MG1655 or E. coli BW25113 as a chassis cell, carries dopamine β-hydroxylase and phenylethanolamine-N-methyltransferase, the nucleotide sequence of the dopamine β-hydroxylase is shown in SEQ ID NO.01, 02, 03 or 04, and the nucleotide sequence of the phenylethanolamine-N-methyltransferase is shown in SEQ ID NO.05, 06 or 07.

[0014] In a preferred embodiment of the present invention, it carries dopamine β-hydroxylase and phenylethanolamine-N-methyltransferase whose nucleotide sequences are shown as SEQ ID NO. 01 and 05, respectively.

[0015] The method for constructing the above-mentioned recombinant Escherichia coli comprises the following steps:

[0016] (1) mixing the dopamine β-hydroxylase gene, the phenylethanolamine-N-methyltransferase gene and pTrc99A at a molar ratio of 3:3:1 to construct a recombinant plasmid;

[0017] (2) Transforming the recombinant plasmid into the chassis cells to obtain the recombinant Escherichia coli.

[0018] The use of the above recombinant Escherichia coli in the preparation of adrenaline.

[0019] The beneficial effects of the present invention are as follows: the present invention adopts a whole-cell catalytic strategy to construct a biosynthetic pathway of exogenous adrenaline in Escherichia coli, uses Escherichia coli as a chassis cell, uses dopamine as a substrate, and expresses exogenous dopamine β-hydroxylase (dopamine β-hydroxylase, DBH) and phenylethanolamine N-methyltransferase (phenylethanolamine N-methyltransferase, PNMT), so that the substrate dopamine can be converted into adrenaline and secreted outside the cell. The present invention is simple, the product is easy to collect and separate, and no expensive coenzyme is required. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the HPLC detection chart of adrenaline prepared in Example 1 of the present invention, wherein ① is adrenaline with a retention time of 5.1 min. DETAILED DESCRIPTION

[0021] The technical solution of the present invention is further illustrated and described below through specific implementation modes in combination with the accompanying drawings.

[0022] The technical route of the present invention is as follows:

[0023]

[0024] In the following embodiments:

[0025] Dopamine β-hydroxylase can also be derived from cattle (Bos taurus) (nucleotide sequence shown in SEQ ID NO.02), chicken (Gallus gallus) (nucleotide sequence shown in SEQ ID NO.03) or corn (Zea mays) (nucleotide sequence shown in SEQ ID NO.04).

[0026] Phenylethanolamine-N-methyltransferase can also be derived from Oryctolagus cuniculus (nucleotide sequence shown in SEQ ID NO.06) or Cavia porcellus (nucleotide sequence shown in SEQ ID NO.07).

[0027] Example 1

[0028] (1) Constructing an expression vector for synthesizing adrenaline, the specific steps are as follows:

[0029] The dopamine β-hydroxylase and the phenylethanolamine-N-methyltransferase in this embodiment are both derived from humans (Homosapiens), and their nucleotide sequences are shown in SEQ ID NOs. 01 and 05:

[0030] A. Design primers DBH-F & DBH-R (as shown in SEQ ID NO: 08 and 09) based on the dopamine β-hydroxylase gene sequence from human, and use the human genomic DNA sequence as a template to obtain the Hs-dbh gene by PCR amplification using primers DBH-F & DBH-R; the PCR amplification uses Q5 high-fidelity DNA polymerase (NEB), and the reaction conditions are: 98°C pre-denaturation for 5 min, 98°C denaturation for 28 s, 56°C annealing for 40 s, 72°C extension for 2 min, for a total of 30 cycles;

[0031] B. Using human genomic DNA sequence as template and human phenylethanolamine-N-methyltransferase gene sequence as primers PNMT-F & PNMT-R (as shown in SEQ ID NOs: 10 and 11), PCR amplification was performed using primers PNMT-F & PNMT-R to obtain Hs-pnmt gene; the PCR amplification used Q5 high-fidelity DNA polymerase (NEB), and the reaction conditions were: 98°C pre-denaturation for 5 min, 98°C denaturation for 28 s, 56°C annealing for 30 s, 72°C extension for 1 min, for a total of 25 cycles;

[0032] C. Using pTrc99A plasmid as template, primers ptrcA-F & ptrcA-R (as shown in SEQ ID NO: 12 and 13) were designed, and PCR amplification was performed to obtain the pTrc99A vector fragment; the PCR amplification used Q5 high-fidelity DNA polymerase (NEB), and the reaction conditions were: 98°C pre-denaturation for 5 min, 98°C denaturation for 28 s, 56°C annealing for 60 s, 72°C extension for 3 min, for a total of 35 cycles;

[0033] D. The above Hs-dbh gene, Hs-pnmt gene and pTrc99A vector fragments were mixed at a concentration ratio of 3:3:1. The three fragments were sequentially connected using Gibson Assembly seamless connection technology to construct a recombinant plasmid, i.e., incubated in a 50°C water bath for 30 minutes and then cooled on ice; then, the 42°C heat shock method was used to transform E. coli T1 competent cells (E. coli MG1655 in this example, which can also be replaced by E. coli BW25113), cultured overnight, and the clones grown on the plate containing ampicillin antibiotics were picked. After sequencing verification, the plasmid was extracted and named pTrc99-AE.

[0034] (2) Whole-cell catalytic synthesis of adrenaline

[0035] A. Inoculate a single colony containing the above-mentioned pTrc99-AE into 5 mL of LB liquid culture medium containing ampicillin antibiotics, and culture overnight at 37°C and 200 rpm with shaking to obtain a seed culture solution;

[0036] B. Transfer the above seed culture solution into 50 mL of LB medium containing 10 G / L glucose and ampicillin antibiotics; when OD 600 When pH ≈ 0.6, add 0.5 mol / L isopropyl-β-D-thiogalactoside (IPTG), continue culturing at 22°C and 150 rpm, and add 10 mM sodium ascorbate (or calcium ascorbate), maintain the dissolved oxygen content at 0.8-1.04 mM, and control the pH at 6;

[0037] C. Continue to culture for 6 hours until OD 600 When the pH value was ≈3, the bacteria were collected, resuspended with 50 mL of Tris buffer (0.1 M, pH 6.5), and poured into a 250 mL Erlenmeyer flask. Then, Tris buffer (0.1 M, pH 6.5) containing 3 g / L of dopamine was added as a substrate into the flask to make the final concentration of dopamine in the reaction system reach 3 g / L. The dissolved oxygen content was maintained at 0.8-1.04 mM, and the reaction was carried out in a shaker at 30°C and 220 rpm for 2-3 h. Samples were taken regularly for detection.

[0038] (3) Adrenaline production detection

[0039] Epinephrine production was measured using a 2695 HPLC (Waters, USA) equipped with a PDA detector and a Sunfire C 18Chromatographic column (5μm, 4.6mm×150mm) Waters Company, USA). Detection wavelength 280nm, column temperature 25℃, mobile phase containing 10% methanol in phosphate-sodium dihydrogen phosphate buffer (100mmol / L), flow rate 1.0mL / min. Prepare adrenaline standard solutions with concentrations of 0.1G / L, 0.5mg / L, 1G / L, 2G / L and 3G / L, respectively, filter through 0.22μm organic filter membrane and use liquid phase detection. Use external standard absolute quantification method, obtain the peak area corresponding to each concentration of standard solution by HPLC analysis, and establish the relationship curve between adrenaline concentration and peak area. Then, from the HPLC peak area result, it can be obtained that when 3g / L dopamine is added as substrate, 2.06g / L can be obtained. Figure 1 For epinephrine shown, the molar conversion was 61.7%.

[0040] SEQ ID NO: 01

[0041]

[0042] SEQ ID NO: 02

[0043]

[0044]

[0045] SEQ ID NO: 03

[0046]

[0047]

[0048] SEQ ID NO: 04

[0049]

[0050] SEQ ID NO: 05

[0051]

[0052]

[0053] SEQ ID NO: 06

[0054]

[0055] SEQ ID NO: 07

[0056]

[0057] SEQ ID NO: 08

[0058] DBH-F: atttcacacaggaaacagaccatggatgcccgccctcagtcgctgggc

[0059] SEQ ID NO: 09

[0060] DBH-R: tcagcctttgcccccaccatggggctacggtctgcgccgctcat

[0061] SEQ ID NO: 10

[0062] PNMT-F:ttggtgggggcaaaggctgaatgagcggcgcagaccgtagcccca

[0063] SEQ ID NO: 11

[0064] PNMT-R:tcacagcccaaccttctgaccgggtaccgagctcgaatt

[0065] SEQ ID NO: 12

[0066] ptrcA-F:aattcgagctcggtacccgggga

[0067] SEQ ID NO: 13

[0068] ptrcA-R: ccatggtctgtttcctgtgtgaaattg

[0069] The above description is only a preferred embodiment of the present invention, and therefore cannot be used to limit the scope of the present invention. That is, equivalent changes and modifications made according to the patent scope of the present invention and the contents of the specification should still fall within the scope of the present invention.

Claims

1. A method for preparing epinephrine by whole-cell catalysis, characterized in that: Using recombinant Escherichia coli as a cell catalyst, reacting in a reaction system containing a substrate dopamine, converting dopamine into adrenaline and secreting it outside the cell, the recombinant Escherichia coli expresses human dopamine β-hydroxylase and human phenylethanolamine-N-methyltransferase, the nucleotide sequence of the dopamine β-hydroxylase is shown in SEQ ID NO.01, and the nucleotide sequence of the phenylethanolamine-N-methyltransferase is shown in SEQ ID NO.05; The recombinant Escherichia coli uses pTrc99A as the expression vector and the chassis cells are E. coli MG1655; The final concentration of dopamine in the reaction system is 3 g / L. The solvent of the reaction system is 0.1 M Tris buffer with a pH of 6.

5. The reaction system consists of the above solvent and dopamine. The reaction conditions are: maintaining a dissolved oxygen content of 0.8-1.04 mM, reacting in a shaker at 30°C and 220 rpm for 2-3 hours, and 2.06 g / L of epinephrine can be obtained, with a molar conversion rate of 61.7%.

2. A recombinant Escherichia coli for catalyzing the production of adrenaline, characterized in that: It uses pTrc99A as the expression vector and E. coli MG1655 is a chassis cell, carrying dopamine β-hydroxylase and phenylethanolamine-N-methyltransferase, the nucleotide sequence of the dopamine β-hydroxylase is shown in SEQ ID NO.01, and the nucleotide sequence of the phenylethanolamine-N-methyltransferase is shown in SEQ ID NO.05; The construction method of the recombinant Escherichia coli comprises the following steps: (1) The dopamine β-hydroxylase gene, the phenylethanolamine-N-methyltransferase gene and pTrc99A were mixed at a molar ratio of 3:3:1 to construct a recombinant plasmid; (2) Transforming the recombinant plasmid into the chassis cells to obtain the recombinant Escherichia coli.

3. Use of the recombinant Escherichia coli according to claim 2 in the preparation of adrenaline.

Images