piR-36249 gene analogs and their use in preventing and treating cancer

Abstract

The present invention provides a piR-36249 gene analog, which is synthesized according to the piR-36249 gene sequence. The analog can directly bind to OAS2 mRNA by means of base complementary pairing, significantly promoting the protein expression level of the tumor suppressor gene OAS2, thereby effectively inhibiting the proliferation and invasion of testicular cancer cells and promoting apoptosis of cancer cells, ultimately achieving the purpose of inhibiting tumor growth, indicating that the piR-36249 gene analog can be used as a biomarker and prognostic indicator for testicular cancer, and has potential value for biomedical development.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a piR-36249 gene analog and its use in preventing and treating cancer. Background Art

[0002] PIWI-interacting RNA (piRNA) is a non-coding RNA with a length of 23-36 nucleotides, which was first discovered in mammalian germ cells. piRNA can form a complex with PIWI protein and participate in important biological processes such as transposon silencing, genome rearrangement, spermatogenesis and germ stem cell maintenance. The PIWI-piRNA pathway is considered to be the immune system of the reproductive system. PIWI-piRNA protects the germ cell genome by identifying and inhibiting harmful genetic elements such as transposon elements. Once transposon elements spread unrestricted, they will cause genome damage and gene mutations, which are closely related to physiological and pathological processes such as male infertility and testicular cancer.

[0003] From a genetic and developmental perspective, mammalian male germ cells can be divided into two different categories of piRNA: pre-pachytene piRNA and pachytene piRNA. In the testes of adult male mice, pachytene piRNA is the most abundant, accounting for more than 95% of the total piRNA. Knocking out proteins related to the pachytene piRNA pathway can lead to spermatogenesis arrest. For example, a research group found that mouse pachytene piRNA can mediate the cleavage of testicular tissue mRNA, indicating that piRNA can play a similar function to siRNA in mouse testicular tissue, and this function is necessary for the development and maturation of male germ cells. Recent studies have shown that the PIWI / piRNA pathway is basically lost during the transformation of normal germ cells into testicular cancer cells, and its loss may be the cause of germ cell carcinogenesis.

[0004] Testicular cancer is considered to be a cancer caused by abnormal development of male germ cells, of which testicular germ-cell tumor (TGCT) accounts for 95% of testicular cancer. Histologically, TGCT can be divided into seminomas and non-seminomas. Seminomas are similar to primordial germ cells (PGCs) tumors, while non-seminomas include undifferentiated embryonal tumors, differentiated embryonal teratomas, and extraembryonic yolk sac choriocarcinomas. The incidence of embryonal tumors accounts for about 87% of non-seminomas, which seriously endangers male health and reproductive ability. TGCT is a rare tumor in the general population, but it is one of the most common malignant tumors in men aged 15-44 years. At present, the diagnosis of TGCT mainly relies on physical examination, ultrasound, magnetic resonance imaging, determination of serum tumor markers and pathological examination. According to the testicular cancer guidelines issued by the European Association of Urology (EAU), approximately 15-30% of TGCT patients will relapse after first-line chemotherapy and will require additional treatment. Studies have found that primary TGCT can metastasize to the retroperitoneal lymph nodes, brain, neck, heart, pulmonary artery, inferior vena cava and aorta, lung, liver, stomach and cartilage. This reflects the aggressive biological characteristics of testicular tumors, and also puts forward the difficulties and challenges faced by the treatment of testicular cancer. At present, the standard treatment of TGCT is radical orchiectomy, combined chemotherapy centered on cisplatin (diamminedichloroplatinum, DDP), radiotherapy and retroperitoneal lymph node dissection. However, the side effects of TGCT treatment on other organs will become a long-term risk factor for the survival of TGCT patients. Literature reports that TGCT patients have kidney disease, secondary leukemia, internal carotid artery occlusion and stroke related to chemotherapy, which seriously increases the family's economic burden and social pressure. More importantly, the normal development of testicular tissue and specific gene expression and regulation are necessary conditions for the final formation of normal sperm, and abnormal spermatogenesis is the main cause of male infertility. Therefore, finding a suitable specific target and developing a new TGCT treatment strategy is the direction that everyone has been working hard to achieve.

[0005] In recent years, a large amount of evidence has shown that abnormal expression of piRNA is significantly associated with the occurrence, progression and invasion of various cancers, including gastric cancer, breast cancer, kidney cancer, colon cancer and lung cancer. For example, piRNA-30473 promotes the development of diffuse large B-cell lymphoma (DLBCL) by upregulating the expression of m6A mRNA methylase WTAP, increasing the m6A level of hexokinase 2 (HK2), and increasing the expression of HK2. In human breast cancer, SEPW1P is a reverse transcription pseudogene of the protein-coding gene SEPW1. piR-36712 guides PIWI protein to bind to SEPW1P RNA, degrade SEPW1P RNA, release more miRNA to bind to SEPW1 mRNA, and promote its degradation. The reduction of SEPW1 protein weakens its inhibition of P53 and P21, thereby inhibiting cancer cell proliferation, invasion and migration. Therefore, piRNA may become a potential cancer diagnostic indicator, prognostic marker or cancer treatment target. Although the importance of piRNA in various cancers is increasingly recognized, its role and potential mechanism in testicular cancer are still not fully understood. Studies have found that small noncoding RNAs, as tumor suppressor genes or oncogenes in testicular germ cell tumors, are expected to become new biomarkers for the detection of testicular cancer, poor prognostic indicators, and potential targets for the development of new therapies in the future. Therefore, identifying piRNAs associated with testicular cancer and elucidating their mechanisms will be an exciting and meaningful task. Summary of the invention

[0006] Problems to be solved by the invention

[0007] The present invention has been made in view of the above-mentioned prior art, and its object is to provide a piR-36249 gene analog that can prevent and treat testicular cancer.

[0008] Means for solving problems

[0009] In order to solve the above problems, the inventors conducted in-depth research, and found for the first time that abnormal expression of piR-36249 gene analogs is related to testicular cancer, thereby providing a piR-36249 gene analog.

[0010] Specifically, the present invention relates to the following aspects:

[0011] 1. A piR-36249 gene analog, the sequence of which is the sequence shown in SEQ ID NO: 1.

[0012] 2. A pharmaceutical composition comprising the piR-36249 gene analog described in item 1 and a pharmaceutically acceptable carrier.

[0013] 3. Use of the piR-36249 gene analogue described in Item 1 in the preparation of a drug for inhibiting the proliferation and invasion of testicular cancer cells.

[0014] Effects of the Invention

[0015] According to the present invention, when the piR-36249 gene analog is transfected into testicular cancer cells, it upregulates the expression of OAS2 mRNA by targeting the 3'UTR of OAS2 mRNA, thereby significantly inhibiting the proliferation, invasion and migration of testicular cancer cells and promoting the apoptosis of testicular cancer cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 A: The piR-36249 gene analog was co-transfected into testicular cancer cells (NT2) with the control group, and the relative expression level of the piR-36249 gene analog was detected by RT-qPCR to confirm the overexpression effect of the piR-36249 gene analog (n = 3).

[0017] Figure 1 B: The proliferation of NT2 cells transfected with piR-36249 gene analogs was detected by CCK8 colorimetry (n = 3).

[0018] Figure 1 CD: Fluorescently labeled 5-ethynyl-2-deoxyuridine (Edu) can replace thymidine and be incorporated into newly synthesized DNA in cells to detect the proliferation of NT2 cells. The cell nucleus was stained with Hoechst-33342 (blue, as shown by arrow 1), Edu staining (red, as shown by arrow 2), and the merged image (purple, as shown by arrow 3). The scale bar is 50 μm.

[0019] Figure 1 EF: The cell scratch assay was used to analyze the effect of piR-36249 gene analogs on the migration ability of NT2 cells. The scale bar is 200 μm. ImageJ software was used to quantify the relative migration area of ​​NT2 cells (n = 3). The data results are expressed as mean ± standard deviation, and statistical significance is expressed as *P<0.05, **P<0.01, ***P<0.001.

[0020] Figure 2 A: The piR-36249 gene analogs and the control group were respectively transferred into NT2 cells, and the effect of piR-36249 gene analogs on NT2 cell apoptosis was detected by flow cytometry.

[0021] Figure 2B: Flowjo_V10_CL software was used to quantify the apoptosis ratio (n = 3). The data results are expressed as mean ± standard deviation, statistical insignificance is expressed as ns, and significance is expressed as *P<0.05, **P<0.01, ***P<0.001.

[0022] Figure 3 A: The expression of OAS2 gene in NT2 cells after transfection with piR-36249 gene analog was detected by RT-qPCR, with GAPDH mRNA as the internal reference (n = 3).

[0023] Figure 3 BC: Western blots were used to detect the effect of piR-36249 gene analogs on the expression level of OAS2 protein.

[0024] Figure 3 D: Schematic diagram of the predicted binding sites of piR-36249 gene analogs on OAS2 mRNA.

[0025] Figure 3 E: NT2 cells were co-transfected with piR-36249 gene analogs, negative control, vector control, wild-type OAS2-3'UTR and mutant OAS2-3'UTR, and the luciferase activity of each group was detected by microplate reader (n = 3). Data are expressed as mean ± standard deviation, statistical insignificance is expressed as ns, and significance is expressed as ***P<0.001.

[0026] Figure 3 FG: NT2 cells were transfected with siRNA to knock down OAS2. Western blot was used to detect the changes in OAS2 protein expression. ImageJ software was used to quantify the expression level of OAS2 protein. The internal reference protein was GAPDH (n = 3).

[0027] Figure 3 HI: The cell proliferation detection reagent Edu was used to detect the proliferation of NT2 cells after knocking down the OAS2 protein. The cell nuclei were stained with Hoechst-33342 (blue, as shown by arrow 1), Edu staining (red, as shown by arrow 2), and merged images (purple, as shown by arrow 3). The scale bar is 50 μm. DETAILED DESCRIPTION

[0028] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments and with reference to the accompanying drawings.

[0029] The methods used in the following examples are conventional methods unless otherwise specified, and the reagents used are commercially available reagents unless otherwise specified.

[0030] The base sequences of the piR-36249 gene analogs in the following examples are shown in Table 1. The piR-36249 gene analog sequences and the negative control group RNA sequences in the table (the control group sequence was designed based on the nematode gene sequence, has no homology with any mammal, is suitable for the study of different human genes, and eliminates interference with human cell research) were synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd.

[0031] Table 1: Base sequences of piR-36249 gene analogs

[0032]

[0033] Example 1: Detection of the expression effect of piR-36249 gene analogs in cancer cells

[0034] The present invention designs piR-36249 gene analogs according to the piR-36249 gene base sequence (GGGGGTATAGCTCAGTGGTAGAGCATTTGA, SEQ ID NO: 3). In order to determine whether the analogs can be successfully expressed in cancer cells and exert their functions, the human germ cell line NT2 (full name NTERA-2, a human testicular teratoma cell, provided by the Peking Union Medical College Cell Resource Center) related to the piRNA research field was selected, and the piR-36249 gene analogs and negative control group were respectively transferred into NT2 cells using jetPRIME® (Polyplustransfection, #409-10) transfection reagent, and the final concentration of the piR-36249 gene analogs was 20 nm / L, and the expression level of the piR-36249 gene analogs was detected by RT-qPCR experiment (the experiment was performed according to the Hairpin-itTM miRNAs quantitative RT-PCR kit provided by Shanghai Jima Company).

[0035] like Figure 1 As shown in the results of A, the piR-36249 gene analog can be successfully expressed in NT2 cells. More importantly, the base sequence length of the analog is relatively short, which makes it very easy to be transferred into cells and has high expression efficiency, making it more suitable for clinical use.

[0036] Example 2: Effects of piR-36249 gene analogs on proliferation, invasion and apoptosis of testicular cancer cells

[0037] Since cell proliferation is crucial for the development of cancer cells, we first explored whether piR-36249 gene analogs are involved in regulating the proliferation of testicular cancer cells. An appropriate amount of NT2 cells were seeded in a cell well plate, and piR-36249 gene analogs and control groups were transferred into NT2 cells within 24 hours. Cell samples were collected 48 hours after transfection, and cell growth was evaluated using cell proliferation detection reagents (CCK8, #BB-4202-2 and BeyoClick™ EdU-647, #C0081S).

[0038] like Figure 1 As shown in BD, the results of CCK8 colorimetry and Edu experiments showed that the expression of piR-36249 gene analogs significantly inhibited the proliferation of NT2 cells compared with the control group.

[0039] Afterwards, NT2 cells were inoculated into cell culture plates; within 24 hours, the piR-36249 gene analogs and the negative control group were transferred into NT2 cells; 48 hours after transfection, a 20 cm ruler was placed in the center of the cell well, and the cells were scratched vertically once along the edge of the ruler with a 200 μL pipette tip, and then rinsed twice with phosphate buffered saline (1×PBS); then, bright field observation was performed using a microscope (OLYMPUS, IX73) 0 hour and 24 hours after scratching, and the cell scratch area was photographed to evaluate the effect of piR-36249 gene analogs on the invasive ability of testicular cancer cells.

[0040] Figure 1 EF analysis results showed that piR-36249 gene analogs could significantly inhibit the invasion ability of NT2 cells.

[0041] These data suggest that piR-36249 inhibits the proliferation and invasion of testicular cancer cells.

[0042] To investigate whether piR-36249 gene analogs inhibit the proliferation of testicular cancer cells by affecting cell apoptosis, piR-36249 gene analogs and control groups were transferred into NT2 cells, and the cells were stained with Annexin V-FITC and propidium iodide (the experiment was performed according to the Annexin V-FITC / PI apoptosis detection kit, #A211-02, provided by Novazonics), and the apoptosis of testicular cancer cells was detected by flow cytometry (BECKMAN, CytoFLEX).

[0043] Figure 2 AB analysis results showed that the expression of piR-36249 gene analogs could induce early and late apoptosis in NT2 cells, while the control group had no significant inhibitory effect on NT2 cell apoptosis.

[0044] These results suggest that piR-36249 gene analogs may affect cell proliferation by inducing apoptosis in testicular cancer cells.

[0045] Example 3: Effects of piR-36249 gene analogs on gene expression levels in testicular cancer cells and screening and verification of target genes

[0046] Studies have found that piRNA can inhibit or activate gene expression by binding to mRNA through incomplete base pairing. Therefore, NT2 cells transfected with piR-36249 gene analogs or negative control groups were collected, RNA samples were extracted for transcriptome sequencing analysis (RNA-Seq sequencing platform provided by Berry Genomics, only mRNA detection), and the candidate gene OAS2 (full name 2'-5'-oligoadenylate synthetase 2, Homo sapiens (human), GenBank ID: 4939) was screened out, and the changes in mRNA expression levels of the candidate gene OAS2 in NT2 cells transfected with piR-36249 gene analogs or negative control groups were detected by RT-qPCR.

[0047] Figure 3 AThe results showed that the expression level of OAS2 gene was abnormally increased.

[0048] In addition, Western blot experiments were performed to detect the changes in OAS2 protein levels in NT2 cells transfected with piR-36249 gene analogs and the control group.

[0049] Figure 3 BC results showed that the expression level of OAS2 protein was significantly upregulated after expressing piR-36249 gene analog.

[0050] To further investigate whether piR-36249 gene analogs can bind to OAS2 mRNA through incomplete base pairing, the candidate gene OAS2 was aligned using the piRNA target gene prediction software miRanda (http: / / www.bioinformatics.com.cn).

[0051] The results showed that the piR-36249 gene analogue may interact with the 3'UTR of OAS2 mRNA. Therefore, the 3'UTR sequence of the OAS2 gene was cloned into the target vector plasmid pmirGlo (Promega, #E133A), and the dual luciferase reporter gene experiment was used to verify whether there was an interaction between the piR-36249 gene analogue and the 3'UTR of OAS2 mRNA. Subsequently, the piR-36249 gene analogue, negative control group, vector control group, wild-type OAS2-3'UTR and mutant OAS2-3'UTR (the mutation site is to replace the base sequence of the piR-36249 gene analogue on the 3'UTR of OAS2 mRNA with AT and GC. After the binding site is mutated, the piR-36249 gene analogue will no longer bind to the OAS2-3'UTR) as shown in the figure. Figure 3 As shown in D, the luciferase activity was detected after co-transfection into NT2 cells (the experiment was performed according to the Dual-Glo® Luciferase Assay System kit, #E2920 provided by Promega).

[0052] Among them, the sequence information of piR-36249 gene analogs binding to OAS2-3'UTR is shown in Table 2.

[0053] Table 2: Sequence information of piR-36249 gene analogs binding to OAS2-3'UTR

[0054]

[0055] Note: The black bold indicates the specific binding site of the piR-36249 gene analog on OAS2-3'UTR

[0056] Figure 3 E The results showed that the luciferase activity was significantly reduced in NT2 cells co-transfected with the piR-36249 gene analog and the wild-type OAS2-3'UTR reporter gene plasmid, while the luciferase activity of the mutant OAS2-3'UTR group did not change significantly.

[0057] These results suggest that the piR-36249 gene analogue upregulates the expression of OAS2 mRNA and promotes the level of OAS2 protein by targeting OAS2-3'UTR.

[0058] According to literature reports, OAS2 is a tumor suppressor that can regulate the occurrence and development of some tumors, such as colorectal cancer and breast cancer. Therefore, in order to further verify the effect of OAS2 expression on the proliferation of testicular cancer cells, siRNA targeting the OAS2 gene (sequence information: 5'-GCCCACCAAACUAAAGGAU-3', SEQ ID NO:6, synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd.) was designed and transfected into NT2 cells for knockdown experiments. The knockdown effect was detected by Western blot experiments.

[0059] Figure 3 FG results showed that the expression level of OAS2 protein was significantly decreased in NT2 cells after siRNA transfection.

[0060] In addition, the proliferation of NT2 cells with knockdown of OAS2 gene was evaluated by cell proliferation detection reagent (BeyoClick™ EdU-647, #C0081S).

[0061] Figure 3 HI results showed that knockdown of OAS2 significantly promoted the proliferation of NT2 cells.

[0062] In summary, piR-36249 gene analogs can inhibit the growth of testicular cancer cell NT2 by promoting the expression of OAS2 mRNA and increasing the level of OAS2 protein. This also further illustrates that piR-36249 gene analogs can inhibit tumors and have potential for drug development.

[0063] The specific embodiments described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. Use of a piR-36249 gene analog in the preparation of a drug for inhibiting the proliferation and invasion of testicular cancer cells, wherein the sequence of the piR-36249 gene analog is the sequence shown in SEQ ID NO:

1.

2. Use of a pharmaceutical composition in the preparation of a drug for inhibiting the proliferation and invasion of testicular cancer cells, the pharmaceutical composition comprising a piR-36249 gene analog and a pharmaceutical carrier, the sequence of the piR-36249 gene analog being the sequence shown in SEQ ID NO: 1.

Images