Coding gene and preparation method of recombinant porcine interferon-alpha / interleukin-2 fusion protein

Abstract

The present invention relates to the field of genetic engineering technology, and specifically relates to the coding gene and preparation method of recombinant porcine interferon-α / interleukin-2 fusion protein. The present invention provides the coding gene of recombinant porcine interferon-α / interleukin-2 fusion protein, and the nucleotide sequence of the coding gene is shown as SEQ ID NO.1. The coding gene of the recombinant porcine interferon-α / interleukin-2 fusion protein can achieve high-efficiency and soluble expression in Escherichia coli, and a soluble recombinant porcine interferon-α / interleukin-2 fusion protein is prepared; the purified recombinant porcine interferon-α / interleukin-2 fusion protein has high biological activity on different cell lines, its virus proliferation inhibitory activity is significantly higher than that of inclusion body protein, and its anti-PEDV virus effect is significant, and it can effectively protect piglets against the attack of PEDV.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a coding gene and a preparation method of a recombinant porcine interferon-alpha / interleukin-2 fusion protein. Background Art

[0002] With the rapid development of the pig farming industry, the morbidity and mortality caused by porcine viral infectious diseases have been continuously increasing; in particular, immunosuppressive diseases cause serious damage to the immune system of pigs, resulting in vaccine immune failure and bringing great losses to the pig farming industry; for some porcine viral diseases, there are still no available vaccines at present, and these factors increase the difficulty of preventing and controlling porcine viral diseases. In addition, the unreasonable use or even abuse of antibiotics has led to problems such as excessive drug residues in pork, serious drug resistance of pathogenic bacteria, and environmental pollution.

[0003] Interferon (IFN) is a class of cytokines with broad-spectrum antiviral, anti-tumor and immune activation functions on the same type of cells. Mammalian interferons are divided into two major categories: type I and type II. IFN-alpha belongs to type I interferon. Alpha interferon can play an anti-tumor effect by inhibiting tumor cell proliferation and promoting apoptosis of tumor cells. In addition, it can also regulate the activities of immune cells (including macrophages, DC cells, B cells, T cells, innate immune NK cells, etc.), such as promoting the activation, proliferation and secretion of corresponding cytokines of CD4 + T cells and CD8 + T cell activation, proliferation, and secretion of corresponding cytokines, promoting the killing activity and proliferation of NK cells, and down-regulating the function of inhibitory T cells (Tregs).

[0004] Interleukin-2 (IL-2), also known as T cell growth factor (TCGF), can induce the growth and differentiation of T lymphocytes in the body, activate cytotoxic T lymphocytes (CTLs) and NK cells, stimulate cells to secrete cytokines such as tumor necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma), and improve the cellular immune capacity of the body; IL-2 can also activate B lymphocytes, promote antibody secretion, enhance the antigen presentation ability, bactericidal ability and cytotoxicity of macrophages, thereby playing antiviral and anti-tumor roles. Therefore, the genetically engineered IL-2 protein preparation can not only be used as a therapeutic agent for antiviral diseases, autoimmune diseases and anti-tumor, but also can be used as an adjuvant to enhance the immune effect of vaccines, and has broad application prospects. Developing a recombinant porcine interferon-alpha / interleukin-2 fusion protein with both the functions of alpha interferon and interleukin-2 can provide an efficient genetically engineered antiviral preparation for the prevention and control of porcine diseases, which is of great significance for the prevention and control of porcine diseases. Summary of the Invention

[0005] The present invention provides a coding gene, a recombinant vector and a recombinant bacterium of recombinant porcine alpha interferon / interleukin-2 fusion protein, as well as a preparation method of the recombinant porcine alpha interferon / interleukin-2 fusion protein.

[0006] In previous studies, the applicant constructed a PoIFN-α-linker-PoIL-2 chimeric gene and expressed it in the form of inclusion bodies in a prokaryotic expression system, initially demonstrating its dual biological activities of PoIFN-α and PoIL-2 proteins on cells. However, since a large amount of protein is lost after the complex denaturation and renaturation of inclusion body proteins, and the biological activity is relatively low, the preparation efficiency and application value of recombinant porcine alpha interferon / interleukin-2 fusion protein are significantly reduced, greatly limiting its application. The present invention realizes the soluble expression of recombinant porcine alpha interferon / interleukin-2 fusion protein by performing soluble modification on the PoIFN-α-linker-PoIL-2 chimeric gene. It is measured that the recombinant porcine alpha interferon / interleukin-2 fusion protein has inhibitory effects on various viruses in different cells, indicating that the recombinant protein has broad-spectrum antiviral activity and can play a good preventive role against porcine viral diseases.

[0007] Specifically, the present invention provides the following technical solutions

[0008] In the first aspect, the present invention provides a coding gene of recombinant porcine alpha interferon / interleukin-2 fusion protein, and the nucleotide sequence of the coding gene is as shown in SEQ ID NO.1.

[0009] The sequence shown in SEQ ID NO.1 is specifically as follows:

[0010] TGTGACCTGCCTCAGACCCACTCCCTGGCCCACACCCGCGCCCTGAGACTGCTGGCCCAGATGAGAAGGATTTCCCCATTTAGCTGCCTGGATCACAGAAGAGACTTCGGCAGCCCTCACGAAGCCTTCGGCGGAAACCAGGTGCAGAAGGCCCAGGCCATGGCCCTGGTGCACGAGATGCTGCAGCAGACGTTCCAGCTGTTTAGCACTGAGGGATCCGCCGCCGCCTGGAACGAAAGCCTCCTGCACCAGTTCTGCACCGGCCTGGACCAGCAGCTGCGCGATCTGGAGGCCTGCGTGATGCAGGAGGCCGGACTGGAGGGGACGCCCCTGCTGGAGGAGGATTCCATTCTGGCCGTGAGGAAATATTTCCACCGGCTGACCTTATACCTGCAGGAGAAGTCCTACTCCCCTTGCGCGTGGGAGATCGTGAGGGCCGAAGTGATGAGATCCTTCAGCAGCAGCACCAACCTCCAGGACAGACTGAGAAAAAAGGAGGGCGGCGGCGGCAGCGGAGGCGGCGGCTCCGGCGGCGGGGGCAGCGCCCCCACCAGCTCCAGTACCAAAAACACCAAGAAGCAGCTGGAGCCCCTGCTGCTGGATCTGCAGCTCCTGCTGAAGGAAGTGAAAAACTACGAGAACGCCGATCTGTCTCGCATGCTGACTTTCAAGTTCTATATGCCTAAGCAGGCCACAGAGCTGAAGCATCTGCAGTGCCTGGTGGAGGAGCTGAAGGCCCTGGAGGGCGTCCTGAACCTGGGCCAGAGTAAAAACTCTGACTCCGCCAACATCAAAGAAAGCATGAACAACATCAACGTGACCGTGCTGGAGCTGAAGGGCAGCGAGACCTCCTTCAAGTGCGAGTATGACGACGAGACCGTGACCGCCGTGGAATTCCTGAACAAGTGGATCACCTTTTGCCAGTGCATCTACTCAACACTGACT。

[0011] The coding gene with the nucleotide sequence shown in SEQ ID NO.1 is the gene encoding the recombinant porcine interferon-alpha / interleukin-2 fusion protein obtained by specific codon optimization in the present invention. This coding gene can achieve high-efficiency and soluble expression of the recombinant porcine interferon-alpha / interleukin-2 fusion protein in Escherichia coli. The expressed recombinant porcine interferon-alpha / interleukin-2 fusion protein has the dual biological activities of PoIFN-α and PoIL-2 proteins, and its biological activity is significantly improved compared with the inclusion body protein.

[0012] In the present invention, the recombinant porcine interferon-alpha / interleukin-2 fusion protein is obtained by connecting porcine interferon-alpha and porcine interleukin-2 with a flexible linker. Among them, the flexible linker is (G4S). 3 。

[0013] In the second aspect, the present invention provides an expression cassette, and the expression cassette contains a promoter and the coding gene of the recombinant porcine interferon-alpha / interleukin-2 fusion protein described above.

[0014] Regarding the type and sequence of the promoter, the present invention has no special limitation, and all promoters capable of initiating gene transcription can be selected.

[0015] In the third aspect, the present invention provides a recombinant vector, and the vector contains the coding gene of the recombinant porcine interferon-alpha / interleukin-2 fusion protein described above.

[0016] The above recombinant vector can be a plasmid vector or a viral vector.

[0017] Preferably, the vector is the pET-32a vector containing the coding gene of the recombinant porcine interferon-alpha / interleukin-2 fusion protein described above.

[0018] The above recombinant vector is obtained by ligating the coding gene of the recombinant porcine interferon-alpha / interleukin-2 fusion protein with the pET-32a vector.

[0019] In the fourth aspect, the present invention provides a recombinant bacterium, and the recombinant bacterium contains the coding gene of the recombinant porcine interferon-alpha / interleukin-2 fusion protein described above or the expression cassette or the recombinant vector.

[0020] Preferably, the recombinant bacterium is Escherichia coli.

[0021] More preferably, the recombinant bacterium is Escherichia coli BL21 containing the above recombinant vector.

[0022] In the fifth aspect, the present invention provides the application of the coding gene of the recombinant porcine interferon-alpha / interleukin-2 fusion protein or the expression cassette or the recombinant vector or the recombinant bacterium in the preparation of the recombinant porcine interferon-alpha / interleukin-2 fusion protein.

[0023] Sixth aspect, the present invention provides a method for preparing recombinant porcine interferon-α / interleukin-2 fusion protein, the method comprising: culturing the recombinant bacterium to express recombinant porcine interferon-α / interleukin-2 fusion protein.

[0024] Preferably, during the culturing of the recombinant bacterium, IPTG is used to induce the expression of recombinant porcine interferon-α / interleukin-2 fusion protein, the concentration of IPTG used for the induction is 0.2 - 1.0 mmol / L, and the temperature of the induction is 20 - 30 °C.

[0025] More preferably, the concentration of IPTG used for the induction is 0.2 mmol / L, the temperature of the induction is 25 °C, and the induction time is 8 - 10 h.

[0026] Preferably, the method further comprises: collecting the culture broth and performing affinity chromatography to purify the recombinant porcine interferon-α / interleukin-2 fusion protein.

[0027] In the above method, after affinity chromatography, the recombinant porcine interferon-α / interleukin-2 fusion protein is obtained after desalting by dialysis and removing imidazole.

[0028] The beneficial effects of the present invention are as follows: The coding gene of the recombinant porcine interferon-α / interleukin-2 fusion protein provided by the present invention can achieve high-efficiency and soluble expression in Escherichia coli, and a soluble recombinant porcine interferon-α / interleukin-2 fusion protein is obtained; the purified recombinant porcine interferon-α / interleukin-2 fusion protein has high biological activity on different cell lines, and its antiviral proliferation activity is significantly higher than that of inclusion body proteins. Verified by animal experiments, the recombinant porcine interferon-α / interleukin-2 fusion protein has a significant anti-PEDV virus effect and can effectively protect piglets from PEDV attack; the coding gene, vector, recombinant bacterium and preparation method provided by the present invention are expected to be used for the batch production and clinical application of rPoIFN-α, laying a foundation for the large-scale production and clinical popularization and application of recombinant porcine interferon-α / interleukin-2 fusion protein. Brief Description of the Drawings

[0029] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0030] Figure 1Electrophoresis detection results of the full-length PoIFN-α-linker-PoIL-2 chimeric gene amplified by SOE-PCR in Example 1 of the present invention. Among them, M: DNA Marker; 1: PoIFN-α-linker; 2:.linker-PoIL-2; 3: PoIFN-α-linker-PoIL-2 chimeric gene.

[0031] Figure 2 Identification of rT-PoIFN-α-linker-PoIL-2 plasmid and rpET-32a-PoIFN-α-linker-PoIL-2 plasmid in Example 1 of the present invention. Among them, A: PCR amplification result of rT-PoIFN-α-linker-PoIL-2 plasmid; B: PCR amplification result of rpET-32a-PoIFN-α-linker-PoIL-2 plasmid; C: Double digestion identification of rpET-32a-PoIFN-α-linker-PoIL-2 plasmid; M: DNA Marker; 1: PCR amplification product of rT-PoIFN-α-linker-PoIL-2; 2: PCR amplification product of rT-PoIFN-α-linker-PoIL-2; 3: Double digestion product of rpET-32a-PoIFN-α-linker-PoIL-2 plasmid.

[0032] Figure 3 SDS-PAGE of the rPoIFN-α-linker-PoIL-2 protein expression product in Example 2 of the present invention. Among them, M: Protein relative molecular weight standard; 1: BL21 induced expression control; 2: pET-32a empty vector induced expression control; 3: Induced precipitate; 4: Induced supernatant.

[0033] Figure 4 Effect of different concentrations of IPTG on the expression of rPoIFN-α-linker-PoIL-2 protein in Example 2 of the present invention. Among them, M: Protein relative molecular weight standard; 1: rPoIFN-α-linker-PoIL-2 protein induced by 0.2 mmol / L IPTG; 2: rPoIFN-α-linker-PoIL-2 protein induced by 0.5 mmol / L IPTG; 3: rPoIFN-α-linker-PoIL-2 protein induced by 0.7 mmol / L IPTG; 4: rPoIFN-α-linker-PoIL-2 protein induced by 1 mmol / L IPTG.

[0034] Figure 5Effect of different induction temperatures on the expression of rPoIFN-α-linker-PoIL-2 protein in Example 2 of the present invention. Here, M: protein relative molecular weight standard; 1: supernatant induced at 20°C; 2: precipitate induced at 20°C; 3: supernatant induced at 25°C; 4: precipitate induced at 25°C; 5: precipitate induced at 30°C; 6: supernatant induced at 30°C; 7: precipitate induced at 37°C; 8: supernatant induced at 37°C.

[0035] Figure 6 Effect of different induction times on the expression of rPoIFN-α-linker-PoIL-2 protein in Example 2 of the present invention. Here, M: protein relative molecular weight standard; 1: rPoIFN-α-linker-PoIL-2 protein induced for 6 h; 2: rPoIFN-α-linker-PoIL-2 protein induced for 9 h; 3: rPoIFN-α-linker-PoIL-2 protein induced for 12 h; 4: rPoIFN-α-linker-PoIL-2 protein induced for 18 h.

[0036] Figure 7 SDS-PAGE of purification of rPoIFN-α-linker-PoIL-2 protein in Example 2 of the present invention. Here, M: protein relative molecular weight standard; 1: purified rPoIFN-α-linker-PoIL-2 protein.

[0037] Figure 8 In Example 5 of the present invention, 48 h after PEDV challenge, 5 / 5 pigs in the challenge control group showed disease; 5 / 5 pigs in the porcine interferon prevention group were protected. Among them, the left figure is the challenge control group. 48 h after challenge, all 5 pigs in the control group showed typical diarrhea symptoms of PEDV infection, 5 / 5 showed disease; the right figure is the interferon prevention group. 48 h after challenge, none of the pigs showed typical diarrhea symptoms of PEDV infection, 5 / 5 were protected. Detailed implementation manners

[0038] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions in the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the present invention. Obviously, the described embodiments are some but not all of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments in the present invention without making creative efforts fall within the protection scope of the present invention.

[0039] The present invention uses the splicing by overlap extension-PCR (SOE-PCR) method to construct a PoIFN-α-linker-PoIL-2 chimeric gene by connecting the Porcine interferon alpha (PoIFN-α) gene and the Porcine interleukin-2 (PoIL-2) gene through a gene flexible linker. Without changing the original amino acid composition of interferon, the PoIFN-α-linker-PoIL-2 chimeric gene is subjected to solubility modification based on the codon preference of Escherichia coli. The modified PoIFN-α-linker-PoIL-2 gene is cloned into the expression vector pET-32a(+) for prokaryotic expression, and recombinant bacteria capable of stable soluble expression are screened out. The expressed recombinant fusion protein is purified using a nickel-chromium affinity chromatography column.

[0040] The activity of the rPoIFN-α-linker-PoIL-2 protein in specific immune reactions with anti-PoIL-2 monoclonal antibody and anti-PoIFN-α monoclonal antibody is detected by the ELISA method. The activity of the rPoIFN-α-linker-PoIL-2 protein in inhibiting the proliferation of different viruses on different cell lines is detected by the cytopathic effect inhibition method. An antiviral infection experiment is used to verify the effect of the rPoIFN-α-linker-PoIL-2 protein in preventing the infection of porcine epidemic diarrhea virus in pigs. After verification, a large amount of soluble expression of the PoIFN-α-linker-PoIL-2 chimeric gene is obtained in Escherichia coli, and the molecular weight of the expressed rPoIFN-α-linker-PoIL-2 protein is approximately 55 kD. The purity of the rPoIFN-α-linker-PoIL-2 protein reaches over 90% after purification by the nickel-chromium affinity chromatography column; the purified rPoIFN-α-linker-PoIL-2 can have specific immune reactions with anti-PoIFN-α monoclonal antibody and anti-PoIL-2 monoclonal antibody, and the measured relative contents of PoIFN-α protein and PoIL-2 protein are 49 pg / mL and 195 pg / mL respectively; the rPoIFN-α-linker-PoIL-2 protein has the activity of inhibiting virus proliferation on different cells, but there are differences in its activity of inhibiting virus proliferation on different cells. The activity unit of inhibiting VSV on PK-15 is 1.8×10 5 IU·mg -1 , the activity unit of inhibiting VSV on WISH cells is 2.5×10 5 IU·mg -1 , and the activity unit of inhibiting PRV on PK-15 cells is 2.2×10 4 IU·mg -1, the activity unit of inhibiting SVA on PK-15 cells is 1.3×10 5 IU·mg -1 , the activity unit of inhibiting PEDV on Vero cells is 3.2×10 4 IU·mg -1 ; The antiviral infection test results showed that the rPoIFN-α-linker-PoIL-2 soluble protein had a significant anti-PEDV virus effect, reaching 5 / 5 protection.

[0041] The main reagents, plasmids and instruments used in the following examples are as follows: The expression vector pET-32a(+), vesicular stomatitis virus (VSV), pseudorabies virus (PRV), Seneca virus (SVA), and porcine epidemic diarrhea virus (PEDV) were all provided by the Henan Provincial Animal Disease Prevention and Control Center. Restriction endonucleases EcoRⅠ, HindIII, DNA Marker, protein molecular weight standard, etc. were purchased from Takara; Tryptone and Yeast extract were purchased from Oxoid; The protein purification kit (His-Bind Purification kit, catalog number 70239-3) was purchased from Novagen, and the DNA agarose gel kit and BCA protein concentration assay kit were purchased from Beyotime Biotechnology Co., Ltd. The gel imaging analysis system is a product of Alpha Innotech Corporation in the United States; The ultrasonic cell disruptor is a product of Sonics Corporation in the United States.

[0042] The following PEDV test virus seeds used in the examples are as follows: The virus for PEDV challenge has a virus content of ≥1.0×10 5.5 TCID50.

[0043] The experimental animals used in the following examples are as follows: 15-day-old healthy and susceptible piglets, with negative PEDV nucleic acid in anal swabs and serum samples, and PEDV neutralizing antibody ≤1∶4.

[0044] Example 1 Construction of the PoIFN-α-linker-PoIL-2 Chimeric Gene and Its Expression Vector

[0045] 1. Design and synthesis of primers

[0046] The gene linker is a flexible linker (G4S) rich in glycine (G) and serine (S) 3, consisting of 15 amino acids, was designed by the laboratory of Henan Animal Disease Prevention and Control Center. According to the sequenced rpQE-30 / PoIFN-α gene sequence (GenBank accession number: AB369102) and the rpQE-PoIL-2 gene sequence in GenBank (accession number: AB194099), a total of 4 primers were designed using Oligo6.0 software for the amplification of SOE-PCR. The primer sequences are as follows: P1: 5′-CCGGAATTCTGTGACCTGCCTCAGACCC-3′ (containing EcoRI restriction site); P2: 5′-GCCACCGCCAGAGCCACCTCCGCCTGAACCGCCTCCACCCTCC TTCTTCCTGAGTCTG-3′, with a full length of 58bp, and the partial linker length is 39bp. It is the downstream primer used for amplifying the PoIFN-α-linker part of the PoIFN-α-linker-PoIL-2 chimeric gene; P3: 5′-GGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGGCA CCTACTTCAAGCTCTAC-3′, which is the upstream primer used for amplifying the linker + PoIL2 part of the chimeric gene; P4: 5′-TACGGATCCAGTCAGTGTTGAGTAGATGC-3′, (containing Hind III restriction site). The above primers were synthesized by Dalian TaKaRa Biotechnology Co., Ltd.

[0047] 2. Construction of PoIFN-α-linker-PoIL-2 chimeric gene

[0048] Refer to the method reported by Yan Ruoqian et al. (Yan Ruoqian, Wu Zhiming, Zhang Zhiling, Sheng Min, Liu Guanghui, Zhao Mingjun. Fusion expression and activity study of porcine α interferon / interleukin-2 gene [J]. Acta Veterinaria et Zootechnica Sinica, 2009, 40(02): 248-255.) to construct the PoIFN-α-linker-PoIL-2 chimeric gene. Use a DNA recovery kit to recover the PCR product of about 945bp. The two ends of the PCR product are respectively equipped with EcoRⅠ and HindIII restriction enzyme sites.

[0049] The results showed that three PoIFN-α-linker-PoIL-2 chimeric genes were successfully constructed by SOE-PCR method, and their nucleotide sequences were shown as SEQ ID NO.1, 2, and 3 respectively. The size of the PoIFN-α-linker PCR amplification product was about 523bp; the size of the linker-PoIL-2 PCR amplification product was about 422bp; the three chimeric genes were identified by PCR using P1 / P4 primers, and the size of the PCR products of the three chimeric genes was about 945bp, which was consistent with the expected results( Figure 1 ).

[0050] 3. Solubility modification and cloning of PoIFN-α-linker-PoIL-2 chimeric gene

[0051] According to the codon preference of Escherichia coli and considering factors such as GC content, the PoIFN-α-linker-PoIL-2 chimeric gene was modified for solubility. In order to obtain a chimeric gene that can achieve efficient soluble expression, the present invention carried out a large number of screenings and verifications on the codon optimization method of the PoIFN-α-linker-PoIL-2 chimeric gene, and found that it was not only based on codon preference to replace rare codons with Escherichia coli-preferred codons and ensure an appropriate GC content to achieve the efficient soluble expression of the PoIFN-α-linker-PoIL-2 chimeric gene. Although many codon-optimized chimeric genes do not contain rare codons and have an appropriate GC content, their soluble expression levels are still relatively low. The following takes three codon-optimized chimeric genes screened during the R & D process as examples for illustration.

[0052] For convenient cloning operation, an EcoRⅠ site was inserted at the 5' end of the PoIFN-α-linker-PoIL-2 chimeric gene, and a HindⅢ site was inserted at the 3' end. The expected length of the amplified target fragment was 945 bp. The modified PoIFN-α-linker-PoIL-2 gene (the 3 PoIFN-α-linker-PoIL-2 chimeric genes described in 2 above, the 3 PoIFN-α-linker-PoIL-2 chimeric genes differed in the codon-optimized bases, that is, the optimized gene sequences were different, and their sequences were respectively as shown in SEQ ID NO.1-3) was ligated with the pGEM-T Easy vector to construct the recombinant cloning plasmid pGEM-T Easy-PoIFN-α-linker-PoIL-2, which was transformed into JM109 competent cells. Positive cloning plasmids were screened by the blue-white spot test, and PCR, plasmid double digestion and sequencing identification were carried out. The correctly identified recombinant plasmid pGEM-T Easy-PoIFN-α-linker-PoIL-2 and pET-32a(+) were digested with EcoRⅠ and HindⅢ, and the target gene fragment and vector fragment were recovered and ligated with T4 DNA ligase to construct the recombinant expression plasmid pET-32a-PoIFN-α-linker-PoIL-2. The recombinant expression plasmid was transformed into E. coli BL21(DE3) competent cells, positive clones were screened, plasmids were extracted, and double digestion (EcoRⅠ / HindⅢ) identification was carried out. The correctly identified recombinant plasmid was sent to Invitrogen (Shanghai) Trading Co., Ltd. for sequencing.

[0053] The 3 constructed soluble expression cloning plasmids pGEM-T Easy / PoIFN-α-linker-PoIL-2 were respectively subjected to PCR amplification to obtain 3 specific bands of 945 bp ( Figure 2 of A). The sequencing results confirmed that rT-PoIFN-α-linker-PoIL-2 was successfully constructed. The 3 constructed recombinant expression plasmids pET-32a / PoIFN-α-linker-PoIL-2 were identified by PCR, and specific bands appeared at 945 bp ( Figure 2 of B). Specific bands appeared at 945 bp and 5900 bp after digestion with EcoRⅠ and HindIII, and the sizes were consistent with the expectations (see Figure 2 of C). Sequencing and alignment analysis were carried out on the 3 positive recombinant expression plasmids pET-32a / PoIFN-α-linker-PoIL-2 respectively, and the results showed that there were no nucleotide mutations or deletions, and the insertion directions and positions were correct. It was shown that the rpET-32a / PoIFN-α-linker-PoIL-2 expression plasmid was successfully constructed.

[0054] Expression and Purification of rPoIFN-α-linker-PoIL-2 Protein in Example 2

[0055] 1. Expression of rPoIFN-α-linker-PoIL-2 Protein and Optimization of Induction Expression Conditions

[0056] Pick the correctly identified E. coli BL21(DE3) recombinant bacteria in Example 1, and optimize and screen the induction expression conditions such as IPTG concentration, temperature, and time for the BL21 empty bacteria and pET-32a empty vector control. After induction expression, centrifuge to collect the bacterial cell precipitate. After freezing and thawing at -80°C, resuspend the bacterial cells in lysis buffer, ultrasonically lyse on ice bath, centrifuge, and collect the supernatant and precipitate. Analyze the soluble expression of rPoIFN-α-linker-PoIL-2 protein by SDS-PAGE.

[0057] The results showed that after IPTG induction, 1 of the 3 recombinant expression plasmids PoIFN-α-linker-PoIL-2 constructed in Example 1 (the chimeric gene sequence is shown in SEQ ID NO.1) was highly expressed in E. coli BL21(DE3). The protein expression level accounted for more than 80% of the total bacterial protein, with a size of about 55 kD, which was consistent with the expected size. Moreover, the content of the target protein in the supernatant was significantly higher than that in the precipitate (as Figure 3 ), indicating that the recombinant protein PoIFN-α-linker-PoIL-2 was soluble; through SDS-PAGE electrophoresis analysis and thin layer scanning analysis, the expression level of rPoIFN-α-linker-PoIL-2 protein expressed in the supernatant accounted for 80% of the total expression in the whole bacterial cells, with a size of about 55 KD; while the expression level of rPoIFN-α-linker-PoIL-2 protein expressed in the precipitate accounted for 10% of the total expression in the whole bacterial cells. Among the other 2 genes, the gene shown in SEQ ID NO.2 could not be expressed, and the gene shown in SEQ ID NO.3 could not be stably and highly expressed.

[0058] The optimization results of the induction conditions are as Figure 4 、 Figure 5 and Figure 6 shown. When the IPTG concentration is 0.2 mmol / L, the induction temperature is 25°C, and the induction time is 9 h, the expression level of the target protein is the highest and then tends to be stable.

[0059] 2. Purification of rPoIFN-α-linker-PoIL-2 Protein

[0060] Centrifuge to collect the induced Escherichia coli cells, add lysis buffer, suspend and mix well, break the cells by ultrasonic treatment, centrifuge, and collect the supernatant. Purify the obtained cell supernatant by affinity chromatography according to the instructions of the His-tag protein purification kit, and collect the eluted protein for 12% SDS-PAGE analysis. Dialyze to remove salt and imidazole at 4 °C, and collect the protein.

[0061] The results showed that after purifying the rPoIFN-α-linker-PoIL-2 protein using a nickel-chromium affinity chromatography column, a purified protein with a purity of over 90% was successfully obtained ( Figure 7 ).

[0062] 3. Detection and removal of endotoxin

[0063] Use Triton X-114 extraction to remove the endotoxin contained in the purified rPoIFN-α-linker-PoIL-2 protein. The specific steps are as follows: Add 1% Triton X-114 to the purified protein, stir magnetically at 4 °C for 60 min to fully mix; place in a 30 °C water bath for 40 min, stirring occasionally; centrifuge at 25 °C at 15000 g for 15 min, carefully remove the upper aqueous phase, and perform two cycles in total; use ToxinSensor TM chromogenic LAL endotoxin detection kit to detect the endotoxin content in the sample.

[0064] The results showed that after detection with the ToxinSensor TM chromogenic LAL endotoxin detection kit, the endotoxin content in the rPoIFN-α-linker-PoIL-2 protein before endotoxin removal was 400 EU / mL, and the endotoxin content after removal was less than 50 EU / mL, meeting the requirements of the Veterinary Pharmacopoeia.

[0065] Example 3 Detection of specific immunoreactivity of rPoIFN-α-linker-PoIL-2 protein

[0066] Use Porcine IFN-α ELISA detection kit and Porcine IL-2 ELISA detection kit to detect whether the rPoIFN-α-linker-PoIL-2 protein can specifically immunoreact with anti-PoIFN-α and anti-PoIL-2 monoclonal antibodies to determine whether it has the immunological activity of PoIFN-α-linker-PoIL-2 protein, and quantify the rPoIFN-α-linker-PoIL-2 protein. Detection was carried out according to the instructions of the kit. The OD 450Compare the values with the standard curve to calculate the relative quantification of PoIFN-α and PoIL-2 in the rPoIFN-α-linker-PoIL-2 protein.

[0067] The results showed that the purified rPoIFN-α-linker-PoIL-2 protein could react with anti-PoIFN-α and anti-PoIL-2 monoclonal antibodies, indicating that rPoIFN-α-linker-PoIL-2 had the biological activity of specific immunoreaction with anti-PoIFN-α and anti-PoIL-2 monoclonal antibodies. Compare the OD450 value of the purified rPoIFN-α-linker-PoIL-2 protein with the protein standard curve. According to the standard curve equation, the relative content of PoIFN-α protein in the rPoIFN-α-linker-PoIL-2 protein was calculated to be approximately 49 pg / mL, and the relative content of PoIL-2 protein was approximately 195 pg / mL.

[0068] Example 4 Detection of the activity of rPoIFN-α-linker-PoIL-2 protein in inhibiting the proliferation of different viruses on different cells

[0069] The cytopathic effect inhibition method was used to determine the activity of rPoIFN-α-linker-PoIL-2 soluble protein in inhibiting the proliferation of different viruses on different cell lines such as PK-15 / VSV, WISH / VSV, PK-15 / PRV, PK-15 / SVA, and Vero / PEDV. After culturing the cells to a monolayer in a 96-well cell culture plate, add 100 μL of 2-fold serial dilution of rPoIFN-α-linker-PoIL-2 protein to each well and culture it in a 37 °C, 5% CO 2 incubator for 24 h. Then add 100 μL of 100 TCID 50 virus to the cells respectively. At the same time, set up normal cell control groups and virus control groups, and compare them with inclusion body proteins (ZAMOISKII E A. Evaluation of Reed-Muench method in determination of activity of biological preparations. [J]. Zhurnal mikrobiologii, epidemiologii i immunobiologii, 1956, 27(1).).

[0070] The antiviral proliferation activity of rPoIFN-α-linker-PoIL-2 on different cell lines such as PK-15 / VSV, WISH / VSV, PK-15 / PRV, PK-15 / SVA, and Vero / PEDV was calculated by the Reed-Muench method, and the results are shown in Table 1. The rPoIFN-α-linker-PoIL-2 protein had high antiviral proliferation activity in animal cells from different sources, and the titer of the recombinant soluble protein was higher than that of the inclusion body protein. The specific results are as follows:

[0071] The detection results of the antiviral proliferation activity of rPoIFN-α-linker-PoIL-2 protein on PK-15 cells against VSV showed that the logarithm of the interferon dilution factor that inhibited 50% of the cytopathic effect, log 2 X was 11.5. Calculating X = 2896, that is, the titer of the rPoIFN-α-linker-PoIL-2 protein was 2.9×10 4 IU·mL -1 (1.8×10 5 IU·mg -1 ). The titer of the inclusion body protein was 5.1×10 3 IU·mL -1 (1.7×10 4 IU·mg -1 ). There was no CPE in the cell control group, and CPE appeared in all cells of the virus control group. This indicates that the antiviral proliferation activity of the rPoIFN-α-linker-PoIL-2 soluble protein on PK-15 cells against VSV was higher than that of the inclusion body protein.

[0072] The detection results of the antiviral proliferation activity of rPoIFN-α-linker-PoIL-2 protein on PK-15 cells against PRV showed that the logarithm of the interferon dilution factor that inhibited 50% of the cytopathic effect, log 2 X was 9. Calculating X = 512, that is, the titer of the rPoIFN-α-linker-PoIL-2 protein was 3.6×10 4 IU·mL -1 (2.2×10 4 IU·mg -1 ). The titer of the inclusion body protein was 6.4×10 2 IU·mL -1 (2.1×10 3 IU·mg -1 ). There was no CPE in the cell control group, and CPE appeared in all cells of the virus control group. This indicates that the antiviral proliferation activity of the rPoIFN-α-linker-PoIL-2 soluble protein on PK-15 cells against PRV was higher than that of the inclusion body protein.

[0073] The detection results of the inhibitory effect of rPoIFN-α-linker-PoIL-2 protein on SVA proliferation activity on PK-15 cells showed that the logarithm of the interferon dilution factor for inhibiting 50% of the cytopathic effect, log2X, was 11. Calculating X = 2048, that is, the titer of rPoIFN-α-linker-PoIL-2 protein was 2.0×10 4 IU·mL -1 (1.3×10 5 IU·mg -1 ). The titer of the inclusion body protein was 3.6×10 3 IU·mL -1 (1.2×10 4 IU·mg -1 ). There was no CPE in the cell control group, and CPE appeared in all cells in the virus control group. This indicates that the inhibitory effect of rPoIFN-α-linker-PoIL-2 soluble protein on SVA proliferation activity on PK-15 cells is higher than that of the inclusion body protein.

[0074] The detection results of the inhibitory effect of rPoIFN-α-linker-PoIL-2 protein on VSV proliferation activity on WISH cells showed that the logarithm of the interferon dilution factor for inhibiting 50% of the cytopathic effect, log2X, was 10. Calculating X = 1024, that is, the titer of rPoIFN-α-linker-PoIL-2 protein was 4.1×10 4 IU·mL -1 (2.5×10 5 IU·mg -1 ). The titer of the inclusion body protein was 1.3×10 3 IU·mL -1 (4.2×10 3 IU·mg -1 ). There was no CPE in the cell control group, and CPE appeared in all cells in the virus control group. This indicates that the inhibitory effect of rPoIFN-α-linker-PoIL-2 soluble protein on VSV proliferation activity on WISH cells is higher than that of the inclusion body protein.

[0075] The detection results of the inhibitory effect of rPoIFN-α-linker-PoIL-2 protein on PEDV proliferation activity on Vero cells showed that the logarithm of the interferon dilution factor for inhibiting 50% of the cytopathic effect, log2X, was 8. Calculating X = 256, that is, the titer of rPoIFN-α-linker-PoIL-2 protein was 5.1×10 3 IU·mL -1 (3.2×10 4 IU·mg -1 ). The titer of the inclusion body protein was 6.4×102IU·mL-1 (2.1×10 3 IU·mg -1 ). There was no CPE in the cells of the cell control group, and CPE appeared in all the cells of the virus control group. This indicates that the inhibitory activity of the rPoIFN-α-linker-PoIL-2 soluble protein on PEDV proliferation on Vero cells is higher than that of the inclusion body protein.

[0076] Table 1 Detection results of the inhibitory activity of rPoIFN-α-linker-PoIL-2 protein on the proliferation of different viruses on different cells

[0077]

[0078] Example 5 rPoIFN-α-linker-PoIL-2 anti-PEDV infection test

[0079] Fifteen healthy and susceptible piglets were randomly divided into 3 experimental groups, namely 5 in the challenge control group, 5 in the blank control group, and 5 in the interferon prevention group. Two days before challenge, the pigs in the interferon prevention test group were intramuscularly injected with purified and endotoxin-removed rPoIFN-α-linker-PoIL-2 at a dose of 2 mL / head / day for 7 consecutive days. The challenge control group and the interferon prevention group were challenged orally at a dose of 2 mL / head, and the blank control group was orally administered DMEM solution synchronously. Within 10 days after challenge, the clinical symptoms of each pig were observed every day (criteria for disease onset: the experimental pigs showed watery diarrhea, yellow or gray, occasionally accompanied by symptoms such as vomiting and listlessness, and severe cases may die, and diarrhea is an indispensable condition for judging disease onset), and the disease incidence in each group was counted.

[0080] The test results showed ( Figure 8 ), 24 hours after challenge in the challenge control group, 1 / 5 pigs showed typical diarrhea symptoms of PEDV infection. 48 hours after challenge, 5 / 5 pigs showed typical diarrhea symptoms of PEDV infection, and 5 / 5 got sick. The sick pigs were accompanied by listlessness and decreased appetite. 1 / 5 pigs showed vomiting symptoms, and then gradually lost weight. 2 / 5 pigs died. During the 1-10-day observation period after challenge in the interferon prevention group, none of the 5 pigs in the PoIFN-α-linker-PoIL-2 prevention group (intramuscular injection) showed typical diarrhea symptoms of PEDV infection, and 5 / 5 were protected. All 5 pigs in the blank control group were normal during the entire observation period and did not show typical diarrhea symptoms of PEDV infection.

[0081] Interferon-α is a class of cytokines with broad-spectrum antiviral, antitumor, and immune activation functions in the same type of cells. IFN-α belongs to type I interferon, and its main functions are to inhibit virus replication activity, antitumor activity, and enhance the ability of NK cells to kill virus-infected cells, thereby inhibiting virus proliferation and diffusion and enhancing the level of cellular immune response in the body. As an important member of the immune factor network, IL-2 not only plays an important role in immune response and regulation but also has significant antiviral effects. Currently, recombinant human IFN-α and IL-2 preparations have been used as therapeutic drugs in the prevention and treatment of viral diseases, autoimmune diseases, tumors, and as vaccine immune adjuvants. In recent years, viral infectious diseases such as porcine pseudorabies and porcine epidemic diarrhea have caused serious harm to the pig industry, and there are currently no effective drugs to prevent and treat viral diseases. Since genetic engineering technology can create broad-spectrum antiviral preparations using cytokine genes, and it has no residues and no side effects and will not harm human health, it has become an ideal preparation to replace chemically synthesized antiviral drugs. Although many researchers have studied recombinant porcine IFN-α and interleukin-2, there are few studies on their combined application, and the expression products exist either in the form of inclusion bodies or with low expression levels. Although inclusion body proteins can obtain a certain amount of protein through denaturation and renaturation, it will cause a large amount of protein loss and lead to unstable biological activity of the protein.

[0082] Although there have been studies on the expression and purification of porcine interferon, most of these studies are at the laboratory research stage, only verifying the antiviral activity of porcine interferon at the cellular level, lacking data on antiviral infection in pigs. Without changing the original amino acid composition of interferon, the present invention performs soluble modification on the PoIFN-α-linker-PoIL-2 gene according to the codon preference of Escherichia coli. Through gene optimization, the usage rate of low codons is significantly reduced, avoiding the influence of rare codons on protein expression, improving the GC content of the gene, and enhancing the transcription and translation efficiency, thereby increasing the expression level of the recombinant protein. The finally obtained protein is confirmed to be a soluble protein by SDS-PAGE analysis, and the expression level accounts for more than 80% of the total bacterial protein. A large amount of protein can be directly purified from the supernatant after cell disruption through nickel column affinity chromatography, which is beneficial for large-scale production.

[0083] The pET-32a(+) used in the present invention is a high-efficiency prokaryotic expression vector, which contains a T7 promoter and a transcription termination signal. In addition to encoding 6 histidine residues, it also carries the E.coli TrxA gene. The TrxA gene encodes thioredoxin with 109 amino acids. After the foreign gene is inserted through the multiple cloning site and fused with the TrxA gene for expression, it can improve the stability of the expression product. And because the N-terminus of the expressed protein contains 6× histidine, it is easy to purify using an affinity chromatography column.

[0084] In order to maximize the expression of the target protein in the experimental environment, the present invention optimizes and analyzes the expression of the recombinant bacterium rPoIFN-α-linker-PoIL2-pET-32a / BL21 from three aspects: induction time, induction temperature, and IPTG concentration. IPTG is an active inducer of β-galactosidase activity. It is a highly effective inducer that is not metabolized by bacteria and is very stable. High concentrations of IPTG have certain cytotoxicity and will induce rapid protein expression to form inclusion bodies. The present invention finds that IPTG has a very high induction efficiency for rPoIFN-α-linker-PoIL-2, and a good induction effect can be achieved when the concentration is 0.2 mmol / L; at low temperatures, the growth of Escherichia coli is slow, which can reduce the protein expression rate, increase the correct folding of the protein, and promote protein solubility. The present invention finds that under the same induction conditions, the expression level of rPoIFN-α-linker-PoIL-2 protein in the supernatant is the highest when induced at 25 °C, and low temperature is beneficial to the soluble expression of the protein; at low temperatures, the growth rate of Escherichia coli slows down, and protein expression can be promoted by extending the induction time. The present invention finds that under the same induction conditions, the expression level of rPoIFN-α-linker-PoIL-2 protein reaches a peak at 9 h and then tends to be stable. Therefore, the optimal expression conditions for rPoIFN-α-linker-PoIL-2 protein are determined as: 0.2 mmol / L IPTG, induced at 25 °C for 9 h.

[0085] The present invention uses the cytopathic effect inhibition method to determine the activity of rPoIFN-α-linker-PoIL-2 protein in inhibiting the proliferation of different viruses on different cell lines. From the perspective of biological activity analysis, there is no significant difference in the titer of rPoIFN-α-linker-PoIL-2 protein in inhibiting the proliferation of VSV on PK-15 and WISH cell lines. Since PK-15 cells are homologous cells, PK-15 cells were selected to determine the activity of rPoIFN-α-linker-PoIL-2 protein in inhibiting the proliferation of VSV; the titer of rPoIFN-α-linker-PoIL-2 protein in inhibiting the proliferation of SVA on PK-15 cells is the same as that in inhibiting the proliferation of VSV. The activity of rPoIFN-α-linker-PoIL-2 protein is species-specific and has higher biological activity on homologous cells than on heterologous cells. In the present invention, the titer of rPoIFN-α-linker-PoIL-2 protein in inhibiting the proliferation of SVA and VSV on PK-15 cells is much higher than its inhibitory activity against PEDV on Vero cells; the inhibitory activity of rPoIFN-α-linker-PoIL-2 soluble protein against different viruses on different cell lines is higher than that of rPoIFN-α-linker-PoIL-2 inclusion body protein. The antiviral infection test results show that rPoIFN-α-linker-PoIL-2 soluble protein has a significant effect against PEDV virus and can protect piglets from PEDV attack, achieving 5 / 5 protection. This lays a foundation for the large-scale production and popularization of the recombinant porcine α-interferon / interleukin-2 preparation for pigs.

[0086] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A recombinant vector, characterized in that, the vector is a pET-32a vector containing the coding gene of recombinant porcine interferon-α / interleukin-2 fusion protein; the insertion position of the coding gene of the recombinant porcine interferon-α / interleukin-2 fusion protein is the multiple cloning site of the pET-32a vector, and the nucleotide sequence of the coding gene is as shown in SEQ ID NO.

1.

2. A recombinant bacterium, characterized in that, the recombinant bacterium contains the recombinant vector described in claim 1; the recombinant bacterium is Escherichia coli.

3. Use of the recombinant vector described in claim 1 or the recombinant bacterium described in claim 2 in the preparation of recombinant porcine interferon-α / interleukin-2 fusion protein.

4. A method for preparing recombinant porcine interferon-α / interleukin-2 fusion protein, characterized in that, the method comprises: culturing the recombinant bacterium described in claim 2 to express recombinant porcine interferon-α / interleukin-2 fusion protein.

5. The method according to claim 4, characterized in that, during the culturing process, IPTG is used to induce the expression of recombinant porcine interferon-α / interleukin-2 fusion protein, the concentration of IPTG used for induction is 0.2-1.0 mmol / L, and the temperature of induction is 20-30 °C.

6. The method according to claim 4 or 5, characterized in that, the method further comprises: collecting the culture broth and performing affinity chromatography to purify the recombinant porcine interferon-α / interleukin-2 fusion protein.

Images