Mining of SNPs in 5D genome sequence of grain weight gene and development and application of KASP molecular markers

Abstract

The application discloses mining of a wheat kernel weight gene 5D genome sequence SNP and development and application of a KASP molecular marker. The application provides a method for identifying or assisting in identifying a wheat kernel trait, and comprises the following steps: detecting whether the genotype of a SNP226 site in the genomic DNA of a wheat to be detected is an AC genotype, a GG genotype or a CG genotype; the kernel trait of a CC genotype wheat is better than that of a GG genotype wheat. The application has a good application prospect in molecular marker assisted selection and molecular design breeding for improving the wheat kernel weight.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to the mining of SNPs in the 5D genome sequence of wheat grain weight gene and the development and application of KASP molecular markers. Background Technology

[0002] Wheat is a widely cultivated grass species worldwide, with approximately 40% of the world's population relying on it as a staple food. Therefore, utilizing molecular biology techniques to identify genes related to thousand-grain weight, studying their biological functions and regulatory mechanisms, and developing functional molecular markers based on these markers will provide important reference gene resources for marker-assisted breeding of wheat. This has significant scientific and practical value in accelerating wheat breeding in my country and increasing wheat yield.

[0003] Thousand-grain weight is one of the three major factors affecting wheat yield, possessing over 80% stable heritability. Therefore, in production and breeding practices, thousand-grain weight is often used as an indicator of grain size, mainly composed of grain shape traits such as grain length, width, and thickness, and is significantly positively correlated with yield. Currently, several grain weight-related genes have been cloned in rice, a model plant of the Poaceae family. These genes are mostly involved in cell expansion and division, primarily functioning through various physiological and biochemical pathways, including ubiquitination of proteases, signaling pathways involving G proteins, and hormone regulation. However, in the field of wheat grain weight research, due to the large and complex genome structure of wheat, although numerous grain weight-related QTLs have been discovered, examples of directly isolating individual wheat grain weight genes using map-based cloning methods are still rare. On the other hand, in recent years, comparative genomics, developed based on the good collinearity of the genomes of Poaceae crops, has provided a theoretical basis for cloning important wheat genes. Reported wheat grain shape / grain weight genes isolated using this method include: ubiquitin degradation pathway... TaGW2 Genes, ubiquitin pathway DA1 Genes, key genes in the wheat starch synthesis pathway TaSus2 , OsGS5 Homologous genes in wheat TaGS-D1 and TaGS5 Genes, etc. Summary of the Invention

[0004] The purpose of this invention is to provide the mining of SNPs in the 5D genome sequence of wheat grain weight gene and the development and application of KASP molecular markers.

[0005] This invention provides a method for identifying or assisting in the identification of wheat grain traits, comprising the following steps:

[0006] Using the genomic DNA of the wheat to be tested as a template, KASP amplification was performed using a specific primer set to obtain genotyping results, which were classified as CC genotype, GG genotype, or CG genotype.

[0007] The grain traits of CC genotype wheat are superior to those of GG genotype wheat.

[0008] The present invention also provides a method for identifying or assisting in the identification of wheat grain traits, comprising the following steps: detecting whether the genotype based on the SNP226 site in the genomic DNA of the wheat to be tested is CC, GG, or CG; the grain traits of CC genotype wheat are superior to those of GG genotype wheat; the SNP226 site is the 31st nucleotide in sequence 6 of the sequence listing, and is C or G.

[0009] This invention also protects specific primer sets.

[0010] This invention also protects the use of specific primer sets in identifying or assisting in the identification of wheat grain traits.

[0011] This invention also protects the use of specific primer sets in the preparation of kits for identifying or assisting in the identification of wheat grain traits.

[0012] The present invention also protects a kit for identifying or assisting in the identification of wheat grain traits, including a specific primer set.

[0013] This invention also protects the application of any of the methods described above in wheat breeding. The breeding objective of the wheat breeding is to select wheat with different grain traits. The breeding objective of the wheat breeding is to select wheat with superior grain traits.

[0014] This invention also protects the application of specific primer sets in wheat breeding. The breeding objective of the wheat breeding is to select wheat varieties with different grain traits. The breeding objective of the wheat breeding is to select wheat varieties with superior grain traits.

[0015] This invention also protects the application of the above-described reagent kit in wheat breeding. The breeding objective of the wheat breeding is to select wheat with different grain traits. The breeding objective of the wheat breeding is to select wheat with superior grain traits.

[0016] Each of the above-described specific primer sets consists of primer 226F1, primer 226F2, and primer 226C; primer 226F1 is a single-stranded DNA molecule as shown in sequence 3 of the sequence listing; primer 226F2 is a single-stranded DNA molecule as shown in sequence 4 of the sequence listing; and primer 226C is a single-stranded DNA molecule as shown in sequence 5 of the sequence listing.

[0017] The above-mentioned grain traits are grain weight and / or grain length and / or grain width and / or grain thickness.

[0018] Superior grain traits are manifested in: high grain weight and / or long grain length and / or wide grain width and / or thick grain.

[0019] The particle weight can specifically be the weight of 1,000 particles.

[0020] KASP: Kompetitive Allele Specific PCR.

[0021] The KASP amplification reaction system can be as follows (5µL): 2.4µL template DNA (total DNA content is 50ng), 0.04µL MgCl2 aqueous solution, 2.4µL 2×Master Mix, 0.06µL KASP primer set, and 0.1µL ddH2O. In the PCR reaction system, the final concentration of magnesium ions is 0.2mM, the final concentration of primers 226F1 and 226F2 is 12µM, and the final concentration of primer 226C is 30µM.

[0022] The reaction conditions for KASP amplification can be: 94℃ for 15 min; 95℃ for 20 s, annealing for 20 s (the annealing temperature of the first cycle is 65℃, and the annealing temperature of each cycle is reduced by 1℃ compared to the previous cycle), 10 cycles; 95℃ for 20 s, 57℃ for 20 s, 30 cycles.

[0023] KASP amplification was performed on an ABI QuantStudio 7 instrument, which automatically output genotyping results.

[0024] This invention identifies a SNP variant site on wheat chromosome 5D. Marker / trait association analysis in Chinese wheat microcore germplasm revealed that this SNP is associated with wheat grain traits. Furthermore, this superior allelic variant has been subject to strong selection during wheat breeding in my country. Based on this SNP, the inventors further developed a KASP primer set. The method provided by this invention utilizes KASP amplification for genotyping, which is then used to assist in the identification of wheat grain traits. It offers advantages such as rapid, convenient, and accurate detection. This invention shows promising application prospects in marker-assisted selection and molecular design breeding for improving wheat grain weight. Attached Figure Description

[0025] Figure 1 This is an exemplary sequencing result of SNP226 and its surrounding nucleotides in a portion of wheat material from Example 1.

[0026] Figure 2 The results of SNP226 typing of some wheat materials in Example 2 are shown.

[0027] Figure 3The changes in thousand-grain weight and allele frequency of wheat varieties bred in different years. Detailed Implementation

[0028] The present invention will be further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present invention in any way. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Unless otherwise specified, the materials, reagents, etc. used in the following embodiments are all commercially available. Unless otherwise specified, the quantitative experiments in the following embodiments are all set up with three replicate experiments, and each replicate experiment has more than five replicate treatments, and the results are averaged.

[0029] Example 1: Discovery of SNP sites and development of detection markers

[0030] I. Discovery of SNP loci associated with wheat grain weight trait

[0031] 1. Wheat materials used in the test

[0032] Thirty-four wheat accessions (numbered C1-34, see Table 1 for details, all of which are common wheat varieties in this field) distributed in different wheat-growing areas of my country and with significant differences in grain traits were selected as materials for the discovery of polymorphic sites.

[0033] 2. Sequence alignment and phenotypic statistics

[0034] Genomic DNA was extracted from 34 wheat samples and then amplified using specific primer pairs (composed of primer F1 and primer R1, designed to target a specific target sequence obtained by the inventors through extensive sequence amplification and alignment in preliminary experiments).

[0035] F1 (Sequence 1 of the sequence list): 5'-ACTCAAGGAGCAAGTTGTCAGA-3';

[0036] R1 (Sequence 2 of the sequence list): 5'-CAACATTAACTCCAACGATC-3'.

[0037] The amplified products were subjected to agarose gel electrophoresis, and the amplified fragments were then recovered and sequenced. Sequence assembly was performed using Seqman in DNAStar, and sequence alignment was performed using MegAlign. The results revealed one SNP variant site (the SNP variant site and its surrounding nucleotides are shown in [link to SNP analysis]). Figure 1The sample was named SNP226. The polymorphic form of SNP226 is either G or C. SNP226 should exist in three genotypes in different varieties: GG (homozygous), CC (homozygous), or CG (heterozygous). Since all 34 sequenced wheat materials were cultivated varieties, the genotypes based on the above SNPs were all homozygous; no heterozygous genotypes were detected.

[0038] Furthermore, the thousand-grain weight of 34 wheat samples was statistically analyzed (the average value was taken from three consecutive years).

[0039] The thousand-grain weight and SNP226-based genotypes of the 34 wheat materials are shown in Table 1.

[0040] The average thousand-grain weight of CC genotype wheat was 45.45 g, while that of GG genotype wheat was 33.80 g. The thousand-grain weight of CC genotype wheat was significantly higher than that of GG genotype wheat. P <0.01).

[0041] Table 1. Thousand-grain weight and SNP226-based genotypes of 34 wheat materials

[0042]

[0043] II. Development of KASP Tags

[0044] KASP primer sets were designed based on the SNP sites discovered in step one.

[0045] The KASP primer set consists of the following primers: 226F1, 226F2, and 226C.

[0046] Primer 226F1: GAAGGTGACCAAGTTCATGCT CAAATCTTCTGAAGTGTAGTGTGCCATGGAC;

[0047] Primer 226F2: GAAGGTCGGAGTCAACGGATT CAAATCTTCTGAAGTGTAGTGTGCCATGGAG;

[0048] Primer 226C: CCAGAAACAGCGCCAGCCATCGGTGATAC.

[0049] Primer 226F1 is shown in Sequence 3 of the sequence listing. Primer 226F2 is shown in Sequence 4 of the sequence listing. Primer 226C is shown in Sequence 5 of the sequence listing. Exemplary target sequences for the KASP primer set are shown in Sequence 6 of the sequence listing.

[0050] Sequence 6, S is C or G

[0051] CAAATCTTCTGAAGTGTAGTGTGCCATGGA SAACAGGACAAGTCCCGAAAGAATTGTAATCTACA GTAT CACCGATGGCTGGCGCTGTTTCTGG

[0052] III. Detection of wheat SNP226-based genotypes using KASP primer sets

[0053] The following steps were performed on each of the tested wheat materials in Step 1:

[0054] 1. Extract genomic DNA from the tested wheat materials.

[0055] 2. Using genomic DNA as a template, KASP amplification was performed using the KASP primer set from step two. KASP amplification was run on an ABI QuantStudio 7 instrument, which automatically output the genotyping results. The genotyping results were based on SNP226 and were classified as GG, CC, or CG genotypes.

[0056] The KASP amplification reaction system (5µL) consists of: 2.4µL template DNA (total DNA content 50ng), 0.04µL MgCl2 aqueous solution, 2.4µL 2×Master Mix, 0.06µL KASP primer set, and 0.1µL ddH2O. In the PCR reaction system, the final concentration of magnesium ions is 0.2mM, the final concentrations of primers 226F1 and 226F2 are both 12µM, and the final concentration of primer 226C is 30µM. The full name of the 2×Master Mix is ​​"KASP V4.0 2×Master Mix 96 / 384 (Low Rox)," manufactured by Beijing LGC Company, with product catalog number KBS-1016-017.

[0057] KASP amplification reaction program: 94℃ for 15 min; 95℃ for 20 s, annealing for 20 s (the annealing temperature of the first cycle is 65℃, and the annealing temperature of each cycle is reduced by 1℃ from the previous cycle), 10 cycles; 95℃ for 20 s, 57℃ for 20 s, 30 cycles.

[0058] The genotype test results are the same as those in Table 1.

[0059] Example 2: Functional Verification of SNP226

[0060] The tested wheat materials consisted of more than 200 wheat materials, all of which belong to the wheat microcore germplasm in my country.

[0061] The SNP226-based genotype of the tested wheat was detected according to step three of Example 1. Results are shown below. Figure 2 .

[0062] The tested wheat was planted and cultivated in parallel, specifically in Luoyang, Henan Province in 2002 and 2005, and in Shunyi, Beijing Province in 2010. At maturity, the grain phenotypes of the tested wheat were statistically analyzed (at least three replicates were set for each sample, and the results were averaged), specifically thousand-grain weight (TKW), grain length (GL), grain width (GW), and grain thickness (GT).

[0063] The statistical results of the grain phenotypes of the tested wheat are shown in Table 2 (Luoyang, Henan, 2002). For wheat with the SNP226 genotype CC, the average thousand-grain weight was 40.1 g (19 wheat varieties were used for the statistics), the average grain length was 0.67 mm (19 wheat varieties were used for the statistics), the average grain width was 0.32 mm (23 wheat varieties were used for the statistics), and the average grain thickness was 0.28 mm (23 wheat varieties were used for the statistics). For wheat with the SNP226 genotype GG, the average thousand-grain weight was 36.2 g (160 wheat varieties were used for the statistics), the average grain length was 0.63 mm (203 wheat varieties were used for the statistics), the average grain width was 0.30 mm (198 wheat varieties were used for the statistics), and the average grain thickness was 0.27 mm (211 wheat varieties were used for the statistics).

[0064] Table 2

[0065]

[0066] The statistical results of the grain phenotypes of the tested wheat are shown in Table 3 (Luoyang, Henan, 2005). For wheat with the SNP226 genotype CC, the average thousand-grain weight was 38.7 g (18 wheat varieties were used for the statistics), the average grain length was 0.67 mm (23 wheat varieties were used for the statistics), the average grain width was 0.32 mm (22 wheat varieties were used for the statistics), and the average grain thickness was 0.29 mm (25 wheat varieties were used for the statistics). For wheat with the SNP226 genotype GG, the average thousand-grain weight was 33.1 g (197 wheat varieties were used for the statistics), the average grain length was 0.64 mm (192 wheat varieties were used for the statistics), the average grain width was 0.30 mm (193 wheat varieties were used for the statistics), and the average grain thickness was 0.28 mm (196 wheat varieties were used for the statistics).

[0067] Table 3

[0068]

[0069] The statistical results of the grain phenotypes of the tested wheat are shown in Table 4 (Shunyi District, Beijing, 2010). For wheat with the SNP226 genotype CC, the average thousand-grain weight was 37.9 g (22 wheat varieties were used for the statistics), the average grain length was 0.69 mm (24 wheat varieties were used for the statistics), the average grain width was 0.32 mm (24 wheat varieties were used for the statistics), and the average grain thickness was 0.30 mm (24 wheat varieties were used for the statistics). For wheat with the SNP226 genotype GG, the average thousand-grain weight was 34.2 g (206 wheat varieties were used for the statistics), the average grain length was 0.66 mm (197 wheat varieties were used for the statistics), the average grain width was 0.30 mm (207 wheat varieties were used for the statistics), and the average grain thickness was 0.29 mm (202 wheat varieties were used for the statistics).

[0070] Table 4

[0071]

[0072] The results showed that, based on the SNP226 genotype, the CC genotype wheat had higher thousand-grain weight, grain length, grain width, and grain thickness than the GG genotype wheat, with significant differences in thousand-grain weight, grain length, and grain width (see Table 5). This indicates that the C allele is the dominant allele compared to the G allele.

[0073] Table 5 Association analysis of SNP allelic variation and grain-related traits

[0074]

[0075] Note: 2002LY represents Luoyang (2002); 2005LY represents Luoyang (2005); 2010SY represents Shunyi (2010). P <0.05, P <0.01.

[0076] In addition, analysis of the trends in the thousand-grain weight and the frequency of allelic variation of varieties bred in different years revealed that ( Figure 3 Over time, the thousand-grain weight of wheat varieties bred in my country has shown an increasing trend. Consistent with this trend, superior alleles have also increased. C The frequency of this allelic variation also shows an increasing trend across varieties from different eras, indicating that modern breeding has exerted a strong selective effect on this allelic variation, which is significantly correlated with grain weight. Therefore, this marker can serve as a functional marker for improving wheat grain weight and for marker-assisted breeding of high-yield wheat.

[0077] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A method for identifying or assisting in the identification of wheat grain traits, comprising the following steps: Using the genomic DNA of the wheat to be tested as a template, KASP amplification was performed using a specific primer set to obtain genotyping results, which were classified as CC genotype, GG genotype, or CG genotype. The grain traits of CC genotype wheat are superior to those of GG genotype wheat. The grain characteristics are thousand-grain weight and / or grain length and / or grain width; The superior grain traits are manifested as: high thousand-grain weight and / or long grain length and / or wide grain width; The specific primer set consists of primers 226F1, 226F2, and 226C; primer 226F1 is a single-stranded DNA molecule as shown in sequence 3 of the sequence listing; primer 226F2 is a single-stranded DNA molecule as shown in sequence 4 of the sequence listing; and primer 226C is a single-stranded DNA molecule as shown in sequence 5 of the sequence listing.

2. A method for identifying or assisting in the identification of wheat grain traits, comprising the following steps: detecting whether the genotype of the wheat genomic DNA based on the SNP226 site is CC, GG, or CG; the grain traits of CC genotype wheat are superior to those of GG genotype wheat; the SNP226 site is the 31st nucleotide in sequence 6 of the sequence listing; the grain trait is thousand-grain weight and / or grain length and / or grain width; the superiority of the grain trait is manifested as: high thousand-grain weight and / or long grain length and / or wide grain width.

3. A specific primer set consisting of primer 226F1, primer 226F2, and primer 226C; primer 226F1 is a single-stranded DNA molecule as shown in sequence 3 of the sequence listing; primer 226F2 is a single-stranded DNA molecule as shown in sequence 4 of the sequence listing; and primer 226C is a single-stranded DNA molecule as shown in sequence 5 of the sequence listing.

4. A kit for identifying or assisting in the identification of wheat grain traits, comprising the specific primer set as described in claim 3; wherein the grain trait is thousand-grain weight and / or grain length and / or grain width.

Images