Primers, probes, kits for detecting Pantoea ananas using the LFD-RPA technique and their applications

Abstract

The present invention discloses primers, probes, kits and their applications for detecting Pantoea ananas using the LFD-RPA technology, belonging to the field of biotechnology. The primers are designed based on the gene sequence of a hypothetical protein of Pantoea ananas; the upstream primer Pa-F sequence of the primers is as shown in SEQ ID No: 1, the downstream primer Pa-R sequence of the primers is as shown in SEQ ID No: 2, and the probe Pa-Probe sequence is as shown in SEQ ID No: 3. The LFD-RPA detection is carried out using the grinding liquid of the sample to be tested, and it is determined whether the sample to be tested contains Pantoea ananas according to the bands on the LFD test strip. This technology gets rid of the dependence on professional instruments and professional technical personnel in traditional molecular detection and realizes the rapid detection of Pantoea ananas.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to primers, probes, kits for rapidly detecting Pantoea ananas by using loop-mediated isothermal amplification combined with lateral flow dipstick (LFD-RPA) technology, and their applications. Background Art

[0002] Pantoea ananas ( Pantoea ananatis ) is an important group of plant pathogenic bacteria, which can cause symptoms such as withering, rot, leaf spot, and apical shoot death in plants. Pantoea ananas can cause bacterial diseases in many major crops and cash crops such as rice, onion, sweet cherry, melon, tea tree, pineapple, and sugarcane, and cause serious harm.

[0003] Traditional detection of bacterial diseases is relatively slow and requires high-precision instrument equipment such as PCR machines. It is mainly applicable to laboratory detection and cannot meet the need for rapid detection, thus limiting its application. Recombinase polymerase isothermal amplification technology (RPA) is a technology that uses recombinase polymerase for isothermal amplification. This technology can not only get rid of the need for high-value instruments, but also has a short reaction time. By combining with fluorescence group labeling, RPA technology can be combined with lateral flow dipsticks (LFD) to achieve visual detection of amplification products. It does not require complex instrument equipment and is suitable for on-site rapid detection, and can achieve highly specific and highly sensitive visual rapid detection of pathogens, with extremely broad application prospects. Currently, there is no report on detecting Pantoea ananas by using LFD-RPA technology. Summary of the Invention

[0004] Problems to be Solved

[0005] The technical problem to be solved by the present invention is how to conveniently, rapidly, and sensitively detect Pantoea ananas, get rid of the dependence on professional instruments and professional technical personnel in traditional molecular detection, achieve rapid detection of Pantoea ananas, and make up for the deficiencies of the existing technology.

[0006] Technical Solution

[0007] To solve the above problems, the present invention adopts the following technical solutions.

[0008] A primer and a probe for detecting Pantoea ananas by using LFD-RPA technology, wherein the primer is designed based on the gene sequence of a hypothetical protein of Pantoea ananas;

[0009] The upstream primer Pa-F sequence of the primer is as shown in SEQ ID No:1,

[0010] The downstream primer Pa-R sequence of the described primer is shown in SEQ ID No: 2,

[0011] The probe Pa-Probe sequence is shown in SEQ ID No: 3.

[0012] The primers and probes for detecting Pantoea ananas using the LFD-RPA technique as described above, the 5' end of the downstream primer Pa-R of the described primer is labeled with biotin.

[0013] The primers and probes for detecting Pantoea ananas using the LFD-RPA technique as described above, the 5' end of the probe Pa-Probe is labeled with a FITC group, THF is labeled between the 33rd and 34th bases from the 5' end, and its 3' end is labeled with a PHO group.

[0014] A kit containing the primers and probes as described above.

[0015] For the kit as described above, the kit further includes an LFD test strip.

[0016] The application of the described primers and probes in the detection of Pantoea ananas.

[0017] The application of the described primers and probes in the preparation of products for detecting Pantoea ananas.

[0018] The application of the described kit in the detection of Pantoea ananas.

[0019] The application of the kit as described above in the detection of Pantoea ananas, the method of application includes the following steps:

[0020] Perform LFD-RPA detection using the grinding liquid of the sample to be tested; determine whether the sample to be tested contains Pantoea ananas according to the bands on the LFD test strip.

[0021] The application of the kit as described above in the detection of Pantoea ananas, the method for determining whether the sample to be tested contains Pantoea ananas according to the bands on the LFD test strip is: if one blue band appears in the quality control area and one red band appears in the detection area on the LFD test strip, the result is positive, indicating that the sample to be tested contains Pantoea ananas; if only one blue band appears, in the quality control area, the result is negative, indicating that the sample to be tested does not contain Pantoea ananas.

[0022] It should be noted that in the above method, the reaction system for the LFD-RPA detection is as follows: Add 29.5 μL of buffer, 14.2 μL of ultrapure water, 1 μL of 10 μM primer Pa-F, 1.5 μL of 10 μM primer Pa-R, 0.3 μL of 10 μM probe Pa-Probe, 1 μL of DNA template, and 2.5 μL of magnesium acetate to the RPA lyophilized enzyme.

[0023] Furthermore, the method performs isothermal amplification at 39°C for 18 min in the LFD-RPA detection system, dilutes the amplification product 20 times, places the lateral flow chromatography test strip in the dilution, and observes after standing at room temperature for 1 min.

[0024] Beneficial effects

[0025] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0026] Pantoea ananas can cause bacterial diseases in many major crops and cash crops such as rice, onion, sweet cherry, melon, tea tree, pineapple, and sugarcane, and cause serious harm. Rapid and simple detection is of great significance for preventing the outbreak of diseases caused by this pathogen. The key to establishing a sensitive and efficient optimal LFD-RPA system is to design primers and probes with high amplification efficiency and strong specificity. Due to the special nature of its technical principle, PCR primers are often not suitable for LFD-RPA. Therefore, based on the gene sequence of a hypothetical protein of Pantoea ananas, the present invention designs specific amplification primers Pa-F, primer Pa-R, and probe Pa-Probe, and establishes a detection method for Pantoea ananas based on LFD-RPA. The detection sensitivity of this method for the DNA of this pathogen can reach 100 fg / μL, and it has good specificity and no cross-reaction with other related species and pathogenic bacteria of other genera, indicating that the detection method provided by the present invention is simple, rapid, sensitive, and specific, and can specifically detect the tested Pantoea ananas from different plant pathogenic bacteria. Using the primers and probes of the present invention for LFD-RPA detection, the amplification time is short, the efficiency is high, and the requirements for equipment are low. It can get rid of the limitations of traditional molecular detection on expensive instruments and strict reaction conditions, quickly and efficiently identify Pantoea ananas, and the detection results can be observed with the naked eye, which is suitable for rapid detection in basic simple laboratories and has high application value in the early diagnosis, field diagnosis, and auxiliary identification of Pantoea ananas. Description of the drawings

[0027] Figure 1 For specific detection results; in the figure, 1: Pantoea ananatis ; 2 - 16: Pantoea agglomerans , Pantoea stewartii , Pantoea eucrina , X. axonopodis pv.citri , X. oryzae pv. oryzae , X. oryzae pv. oryzicola , X. campestris pv. campestris , Xanthomonas arboricola pv. pruni , Acidovorax avenae , Pectobacterium carotovorum subsp. carotovorum , Pseudomonas syringae pv. actinidiae , Ralstonia solanacearum , Enterobacteriaceae roggenkampii , Dickeya zeae , Burkholderia gladioli ; In the figure: 17: Negative control (clear water).

[0028] Figure 2 are the sensitivity detection results; from left to right, the DNA template concentrations are 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, and 10 fg / μL in sequence.

[0029] Figure 3 are the LFD-RPA detection sample results; from left to right, the samples are Pantoea ananas DNA, sterile water ground solution of Pantoea ananas disease sample, sterile water ground solution of Xanthomonas oryzae pv. oryzae disease sample, sterile water ground solution of Xanthomonas oryzae pv. oryzicola disease sample, and sterile water ground solution of healthy rice. Specific Embodiments

[0030] The present invention will be further described below in conjunction with specific embodiments.

[0031] Example 1 LFD-RPA Detection Method

[0032] 1. Design of Primers and Probes

[0033] According to the gene sequence of a hypothetical protein in Pantoea ananas, specific amplification primers Pa-F, Pa-R, and probe Pa-Probe were designed. The nucleotide sequence of primer Pa-F of the present invention is shown in SEQ ID No.1, the nucleotide sequence of primer Pa-R is shown in SEQ ID No.2, and the nucleotide sequence of probe Pa-Probe is shown in SEQ ID No.3. The specific sequences are shown in Table 1. The primer sequences of LFD-RPA and ordinary RPA are the same, except that the 5' end of the reverse primer of LFD-RPA is labeled with a biotin, the 5' end of the probe Pa-Probe is labeled with a fluorescein FITC group, THF is labeled between the 33rd and 34th bases from the 5' end, and the 3' end is labeled with a PHO group.

[0034] Table 1 Primer and Probe Sequence Information for LFD-RPA Amplification

[0035] Primer Name Sequence (5'-3') Pa-F TCGATGTGGTCTGGATGAATAATGCGCTGC Pa-R GCAAACCACACCCAGCTACCATGACGGATG Pa-Probe CAGGAACTGTTGTTATTCAGTCTTGCCGCACTGTTTTTTATTGCCGCC

[0036] 2. LFD-RPA Detection System and Method

[0037] Using the genomic DNA of Pantoea ananas as a template, add 29.5 μL of buffer, 14.2 μL of ultrapure water, 1 μL of 10 μM primer Pa-F, 1.5 μL of 10 μM primer Pa-R, 0.3 μL of 10 μM probe Pa-Probe, 1 μL of DNA template, and 2.5 μL of magnesium acetate to the RPA lyophilized enzyme, perform isothermal amplification at 39°C for 18 min, dilute the amplification product 20-fold, and place the lateral flow chromatography test strip in the dilution solution. Observe after standing at room temperature for 1 min. Determine whether the sample to be tested contains Pantoea ananas according to the bands on the LFD test strip. If one blue band appears in the control region and one red band appears in the test region on the LFD test strip, the result is positive, indicating that the sample to be tested contains Pantoea ananas; if only one blue band appears, in the control region, the result is negative, indicating that the sample to be tested does not contain Pantoea ananas.

[0038] Example 2 Analysis of LFD-RPA Detection Performance

[0039] 1. Specificity Analysis

[0040] Verify the specificity of the primers with related species of Pantoea and other common pathogenic bacteria; use the specific primers designed in the present invention to perform LFD-RPA reactions on the genomic DNA of all the tested strains in Table 2 to verify the specificity, and replace the template DNA with an equal amount of water as a negative control (CK).

[0041] In this study, the amplification primers designed based on the hypothetical protein gene sequence of Pantoea ananas had good specificity and no cross-reaction with other related species and pathogenic bacteria of other genera. The results were as Figure 1 shown. The results of the LFD lateral flow chromatography test strip showed that only Pantoea ananas was positive, and the DNA detection results of the other pathogenic bacteria were all negative. The detection results can be observed with the naked eye, without the aid of any instrument, and the operation is simple and the reaction is rapid. The advantages of LFD-RPA are well reflected in grass-roots inspection and quarantine.

[0042] Table 2 Strains Used to Screen Primer Specificity in This Example

[0043]

[0044] Note: + indicates the presence of a specific test band; - indicates the absence of a test band.

[0045] 2. Sensitivity analysis

[0046] To evaluate the detection efficiency of the primer-probe combinations designed in this study, sensitivity analysis of the LFD-RPA technique was performed using DNA of Pantoea ananas at serial dilution concentrations of 1 ng / μl, 100 pg / μl, 10 pg / μl, 1 pg / μl, 100 fg / μl, and 10 fg / μl. The results are as Figure 2 shown. This LFD-RPA technique system has high detection sensitivity, up to 100 fg / μl.

[0047] Example 3 LFD-RPA detection of disease samples

[0048] Disease samples of a new bacterial disease of rice caused by Pantoea ananas induced by artificial inoculation, bacterial blight disease samples of rice, and bacterial leaf streak disease samples of rice were ground in sterile water. Using the grinding liquid as a template, LFD-RPA detection was performed using the primer and probe compositions designed in the present invention according to the system and method described in Example 1. The detection results are as Figure 3 shown. As can be seen from Figure 3 this, the detection results of rice disease samples caused by Pantoea ananas were positive, and the detection results of bacterial blight disease samples of rice, bacterial leaf streak disease samples of rice, and sterile water grinding liquid of healthy rice were negative, indicating that the LFD-RPA detection technology system established in this study can be successfully applied to the detection and analysis of Pantoea ananas in rice disease samples, and the sterile water grinding liquid can be directly used as a detection sample, greatly simplifying the experimental operation process and being more suitable for field grass-roots detection applications.

[0049] The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved.

[0050] In summary, according to the principle of the present invention, this application intends to cover any modifications, uses, or improvements to the present invention, including those that depart from the scope disclosed in this application and are made using conventional techniques known in the art. Some basic features can be applied according to the scope of the following appended claims.

Claims

1. A primer set and probe for detecting Pantoea ananas using the LFD-RPA technique, characterized in that: The described primer set is designed based on the gene sequence of a hypothetical protein of Pantoea ananas; the primer set consists of an upstream primer and a downstream primer; the sequence of the upstream primer Pa-F is as shown in SEQ ID No:1, the sequence of the downstream primer Pa-R is as shown in SEQ ID No:2, and the sequence of the probe Pa-Probe is as shown in SEQ ID No:3; the 5'-end of the downstream primer Pa-R is labeled with biotin; the 5'-end of the probe Pa-Probe is labeled with a fluorescein isothiocyanate (FITC) group, and tetrahydrofuran (THF) is labeled between the 33rd and 34th bases from the 5'-end, and the 3'-end is labeled with a phosphate group (PHO).

2. A kit containing the primer set and probe according to claim 1.

3. The kit according to claim 2, characterized in that: The described kit further includes an LFD test strip.

4. The application of the primer set and probe according to claim 1 in the detection of Pantoea ananas for non-disease diagnosis purposes.

5. The application of the primer set and probe according to claim 1 in the preparation of a product for detecting Pantoea ananas.

6. The application of the kit according to claim 2 in the detection of Pantoea ananas for non-disease diagnosis purposes.

7. The application of the kit according to claim 6 in the detection of Pantoea ananas for non-disease diagnosis purposes, characterized in that The method of its application includes the following steps: performing LFD-RPA detection using the grinding liquid of the sample to be tested; determining whether the sample to be tested contains Pantoea ananas according to the bands on the LFD test strip.

8. The application of the kit according to claim 7 in the detection of Pantoea ananas for non-disease diagnosis purposes, characterized in that The method for determining whether the sample to be tested contains Pantoea ananas according to the bands on the LFD test strip is as follows: if one blue band appears in the control region and one red band appears in the test region on the LFD test strip, the result is positive, indicating that the sample to be tested contains Pantoea ananas; if only one blue band appears in the control region on the LFD test strip, the result is negative, indicating that the sample to be tested does not contain Pantoea ananas.

Images