Kit for Mild Detection of 5-Hydroxymethylcytosine and Detection Method Thereof

By performing specific modification and transformation reactions on 5hmC, combined with probe ligation and LAMP amplification technology, high-sensitivity 5hmC detection without bisulfite treatment was achieved, solving the problems of high detection difficulty and low sample volume in the prior art.

CN115961003BActive Publication Date: 2025-06-17XIAN MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211440540.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-17
Publication Date
2025-06-17
Estimated Expiration
2042-11-17

AI Technical Summary

Technical Problem

The prior art is difficult to achieve simple, rapid and gentle detection of 5-hydroxymethylcytosine (5hmC) at a specific site, especially in the case of small samples and high background interference.

Method used

By modifying 5hmC to 5gmc, deaminase and conversion reactions were performed using APOBEC deaminase and pyridineborane, combining ligation reactions between probes A and probe B and cyclic synthesis enzyme chain reaction (LAMP) amplification, high sensitivity detection without bisulfite treatment was achieved.

Benefits of technology

It realizes efficient and specific detection of 5hmC as low as 200aM, and is suitable for small samples, avoids DNA loss and high temperature and high alkali treatment, and simplifies the operation process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115961003B_ABST
    Figure CN115961003B_ABST
Patent Text Reader

Abstract

The present invention relates to a kit for gently detecting 5hmC and a detection method thereof. The kit includes: a blocking reaction solution, an APOBEC deamination conversion solution, a pyridine borane conversion solution, a ligation reaction solution, and an amplification reaction solution; the ligation reaction solution includes probe A and probe B. First, the present invention uses glucosyltransferase to modify uridine diphosphate-glucose (UDP-Glu) on the hydroxyl group of 5hmC to form 5gmc, protecting 5hmC from being affected by subsequent reactions. Then, APOBEC is used to deaminate C and 5mC into uracil (U), and 5fC and 5caC are converted into dihydrouracil (DHU) by pyridine borane. U and DHU are complementary base-paired with A base, while 5gmc is still paired with G, so that 5hmC forms a single-base difference from other bases. The high-sensitivity detection of 5hmC is carried out by loop-mediated isothermal amplification (LAMP) based on ligation. The detection method of the present invention is gentle and efficient, can detect 5hmC as low as 2 fM, and the specificity reaches 1%.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a kit for mildly detecting 5-hydroxymethylcytosine and a detection method thereof. Background Art

[0002] DNA methylation, as the most widely studied epigenetic modification, has various physiological and pathological functions and is extremely important for the development of mammals. With the discovery of 5-hydroxymethylcytosine (5hmC) and TET enzymes, demethylation has become the focus of scientific research. TET family proteins can oxidize the hydrogen on the methyl group of 5-methylcytosine (5mC) to a hydroxyl group to form 5hmC, and 5hmC can be further oxidized to 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC), and the epigenetic modification is removed under the action of TDG and base repair. 5hmC is not only an intermediate in the active demethylation process, but also has its own characteristics and functions. Most 5hmC is a stable DNA modification, with a high degree of tissue specificity, and is enriched in embryonic stem cells and brain tissues. It is worth noting that compared with normal tissues, the level of 5hmC is significantly reduced in human cancers and is considered an epigenetic biomarker for cancer diagnosis. In addition, 5hmC not only plays an important role in neural development and diseases, but also participates in the regulation of chromatin structure and gene expression. There are significant differences in the content of 5hmC in neurodegenerative diseases compared with healthy controls. However, due to method limitations, the mechanism of action and biological functions of 5hmC in cancers and neurodegenerative diseases are still unclear. Given the significance of 5hmC in the epigenetic regulation mechanism and early diagnosis of various diseases including cancer, there is an urgent need to develop simple, rapid, and mild detection methods for application in the early diagnosis of diseases and in-depth mechanism research.

[0003] High performance liquid chromatography (HPLC) and mass spectrometry (MS) methods are widely used to determine the genome-wide percentage content of 5hmC in cytosine residues. However, these methods can only detect the total content of 5hmC in genomic DNA and cannot provide any sequence information or site distribution of 5hmC. Affinity enrichment or chemical labeling-assisted sequencing strategies can approximately locate 5hmC in genomic DNA. However, these enriched fragments usually contain hundreds to thousands of bases and cannot give the accurate position of 5hmC in the DNA fragment. Since both 5mC and 5hmC are resistant to deamination by bisulfite, the classical bisulfite method cannot distinguish between the two. Therefore, oxidative bisulfite sequencing (oxBS-seq) and tet-assisted bisulfite sequencing (TAB-seq) have been developed on this basis to determine the position and relative abundance of each 5hmC site. However, the bisulfite treatment in these methods requires high heat and high alkali conditions, which can cause DNA sequence breaks and is not suitable for the detection of small amounts of samples. Recently, nanopore technologies that can directly distinguish 5hmC, C, and 5mC with chemical pretreatment and selective labeling have been developed. Single-molecule detection can be achieved without amplifying the target sequence, and protein nanopore sequencing has also been developed as the third-generation sequencing technology. However, quantitative analysis of this method is still a huge challenge. These methods can accurately locate the sites of 5hmC at single-base resolution. However, for the detection of 5hmC at a few known sites with important physiological and pathological functions, extremely high sequencing depth is required. The sequencing technology has high requirements for instruments and data analysis and is not suitable for application in ordinary laboratories and clinical research. Therefore, it is of great significance to simply and quickly quantitatively analyze 5hmC at specific known sites in genomic DNA without bisulfite treatment to further reveal its biological functions and disease diagnosis.

[0004] In recent years, the methods of PCR assisted by boric acid modification, ligation rolling circle assisted by glucose modification, and ligation rolling circle assisted by oxidative bisulfite have all failed to achieve simple and rapid detection of 5hmC at specific sites. We have also reported HpaII-assisted ligation-polymerase chain reaction (PCR), which has high sensitivity and specificity, still requires bisulfite treatment, and is complex and time-consuming to operate. How to accurately quantify 5hmC at specific sites simply, quickly, and with low damage under the background interference of a large amount of C and 5mC is still a huge challenge.

[0005] In view of this, this patent is applied for. Summary of the Invention

[0006] To solve the problems existing in the prior art, the present invention provides a kit for mild detection of 5-hydroxymethylcytosine and its detection method. The detection method of the present invention is mild and efficient, can detect 5hmC as low as 200 aM, and the specificity reaches 1%.

[0007] The object of the present invention is to provide a kit for mild detection of 5hmC.

[0008] Another object of the present invention is to provide a method for detecting 5hmC without bisulfite treatment using the above kit.

[0009] The kit for mild detection of 5hmC according to the specific embodiments of the present invention, the kit includes: a blocking reaction solution, an APOBEC deamination conversion solution, a pyridine borane conversion solution, a ligation reaction solution, and an amplification reaction solution; the ligation reaction solution includes probe A and probe B; the sequence of probe A is shown in SEQ ID NO:1; the sequence of probe B is shown in SEQ ID NO:2.

[0010] Further, the blocking reaction solution includes cutsmart buffer, UDP-Glu, and T4-βGT, deionized water; preferably, the blocking reaction solution includes 1 μL of 10× cutsmart buffer, 1 μL of 50×UDP-Glu, 1 μL of 10 U T4-βGT, and 2 μL of deionized water, with a total volume of 5 μL; the 1× cutsmart buffer includes 5 mM potassium acetate, 2 mM tris-acetate, 1 mM magnesium acetate, and 10 μg / ml BSA, with a pH of 7.9.

[0011] Further, the APOBEC deamination conversion solution includes APOBEC deamination buffer and bovine serum albumin; preferably, the APOBEC deamination conversion solution includes 0.2 μL of APOBEC deaminase, 1 μL of 10× APOBEC deamination buffer, and 0.1 μL of bovine serum albumin, with a total volume of 1.3 μL.

[0012] Further, the pyridine borane conversion solution includes sodium acetate solution and pyridine borane; preferably, the pyridine borane conversion solution includes 1 μL of 600 mM sodium acetate solution with a pH of 4.3 and 0.1 μL of 1 M pyridine borane, with a total volume of 1.1 μL.

[0013] Further, the ligation reaction solution includes probe A, probe B, Amp ligase, Amp ligase buffer solution, and deionized water; preferably, the ligation reaction solution includes 1 μL of 20 nM probe A, 1 μL of 20 nM probe B, 0.2 μL of 5 U Amp ligase, 1 μL of 10× Amp ligase buffer solution, and 5.8 μL of deionized water. The 10× Amp ligase buffer solution includes 200 mM Tris-HCl, 250 mM KCl, 100 mM MgCl2, 5 mM NAD, and 1% Triton X-100, with a pH of 8.3 and a total volume of 9 μL.

[0014] Furthermore, the LAMP reaction mixture includes an upstream primer FIP, a downstream primer BIP, dNTP, Bst DNA polymerase, ThermoPol reaction buffer solution, betaine, SYBR Green I, and deionized water; preferably, the LAMP reaction mixture includes 0.5 μL of 10 mM upstream primer FIP, 0.5 μL of 10 mM downstream primer BIP, 0.8 μL of 2.5 mM dNTP, 0.5 μL of 8 U Bst DNA polymerase (large fragment), 1 μL of 10× ThermoPol reaction buffer solution, 2 μL of 5 M betaine, 0.2 μL of 50× SYBR Green I, and 2.5 μL of deionized water, with a total volume of 8 μL.

[0015] The method for quantitatively detecting 5hmC in a genome according to the specific embodiments of the present invention includes the following steps:

[0016] (1) Blocking 5hmC: Prepare a blocking reaction solution and a DNA template, place the blocking reaction solution into the sample to be tested, and perform a blocking reaction;

[0017] (2) Deamination conversion: After the blocking reaction in step (1) ends, quickly transfer the reaction to a PCR tube rack for cooling; add the APOBEC deamination conversion solution to the blocking reaction system to perform a deamination reaction;

[0018] (3) Pyridine borane conversion: Add the pyridine borane conversion solution to the reaction solution after deamination conversion in step (2), place it in a thermostatic mixer for reaction, and after the reaction ends, purify the DNA using a UNlQ-10 column universal DNA purification kit;

[0019] (4) Ligation reaction: Add the DNA sample purified in step (3) to the ligation reaction mixture, add the target sequence and mix well, heat to denature the dsDNA, and at an appropriate temperature, ligate probe A and probe B using the target sequence as a template under the catalysis of a ligase;

[0020] (5) LMAP amplification reaction: Take the ligation product in step (4) and add it to the LAMP reaction mixture. After mixing the LAMP reaction mixture, immediately transfer it to a StepOne Real-Time PCR system for a constant temperature reaction, and detect the real-time fluorescence intensity every 1 minute.

[0021] Further, in step (1), 5 μL of the blocking reaction solution is placed into 2 μL of the sample to be tested for blocking reaction; the reaction conditions are incubation at 37 °C for 2 hours; in step (2), 1.3 μL of the deamination solution is added for deamination reaction, and the reaction conditions are: the temperature is gradually increased from 4 °C to 50 °C within 2 hours for incubation, and 50 °C is maintained for 10 minutes; in step (3), 1.1 μL of the pyridine conversion solution is added, and the reaction conditions are: the constant temperature mixer is set at a rotation speed of 850 rpm and incubated at 37 °C for 16 hours; in step (4), 1 μL of the product after the reaction is added to 9 μL of the ligation reaction for ligation reaction, and the ligation conditions are: heating at 90 °C for 3 minutes to denature dsDNA at high temperature, and then reacting at 45 °C for 15 minutes. In step (5), 2 μL of the ligation product is added to 8 μL of the LAMP reaction mixture, and the amplification reaction conditions are: reacting at 58 °C for 100 minutes.

[0022] In the present invention, we first use glucosyltransferase to modify UDP-Glu on the hydroxyl group of 5hmC to form 5gmc, blocking 5hmC so as not to be affected by subsequent reactions. Then, we use APOBEC deaminase to deaminate C and 5mC to convert them into uracil (U), and then convert 5fC and 5caC into dihydrouracil (DHU) through pyridine borane. U and DHU are complementary to base A in pairing, while 5gmc is still paired with G, so that 5hmC forms a single-base difference with other bases. The whole process does not require bisulfite treatment, reducing the loss of DNA during the treatment process. Taking the 35096044 site of the low-density lipoprotein receptor-related protein gene as the target sequence, five double-stranded DNA template sequences are synthesized, and C, 5mC, 5hmC, 5fC, and 5caC bases are synthesized at this site respectively, and are named C sequence, 5mC sequence, 5hmC sequence, 5fC sequence, and 5caC sequence respectively. Two stem-loop structure probes for specifically detecting the target sequence are designed and named probe A and probe B respectively. As Figure 6 shown, a part of the sequences of probe A and probe B can form a stem-loop structure, which contains sequences that can hybridize complementarily with the upstream inner primer FIP and the downstream primer BIP. The 5' end of probe A has 19 bases complementary to the target sequence, and a phosphate group is modified at the 5' end. The 3' end of probe B has 16 bases complementary to the target sequence, and a G base is designed at the end, which is complementary to the converted 5gmc and mismatched with C and other modifications. Since the ligase has high specificity and has no ligation activity at the mismatched bases, only the 5gmc sequence can connect probe A and probe B into a sequence through the action of the ligase, and highly sensitive detection of 5hmC is achieved through highly efficient loop-mediated isothermal exponential amplification. In this paper, bisulfite-free treatment is used to distinguish single bases of the modified bases in the target sequence, and ligation-based LAMP is used to achieve highly sensitive detection, which is applicable to the detection of 5hmC in a small amount of samples.

[0023] Furthermore, the method for quantitatively detecting 5hmC in the genome includes the following steps:

[0024] (1) Blocking 5hmC: Prepare a blocking reaction solution and a DNA template. Add 5 μL of the blocking reaction solution to 2 μL of the sample to be tested, and incubate at 37 °C for 2 hours;

[0025] (2) Deamination conversion: After the blocking reaction in step (1) is completed, add a deamination reaction solution to the reaction system. Denature the sample to be tested at 95 °C for 5 minutes, and then transfer it to a PCR tube rack pre-incubated at -20 °C to cool for 10 minutes; Prepare an APOBEC deamination conversion solution, and add the APOBEC deamination conversion solution to the blocking reaction system. The deamination reaction conditions are: incubate with a temperature gradient from 4 °C to 50 °C within 2 hours, and continue to incubate at 50 °C for 10 minutes;

[0026] (3) Pyridine borane conversion: Prepare a pyridine borane conversion solution, add it to the reaction solution after deamination conversion in step (2), place it in a thermostatic mixer, set the rotation speed to 850 rpm, and the reaction conditions are: incubate at 37 °C for 16 hours. After the reaction is completed, purify the DNA using the UNlQ-10 column universal DNA purification kit;

[0027] (4) Ligation reaction: Prepare a ligation reaction mixture, add the purified product in step (3) to the ligation reaction mixture, add the target sequence and mix well. Heat at 90 °C for 3 minutes to denature dsDNA at high temperature, and then react at 45 °C for 15 minutes. Using the target sequence as a template, ligate probe A and probe B under the catalysis of ligase;

[0028] (5) LAMP amplification reaction: Prepare a LAMP amplification reaction mixture, take 2 μL of the ligation product in step (4) and add it to 8 μL of the LAMP reaction mixture; After mixing the LAMP reaction mixture, immediately transfer it to a StepOne Real-Time PCR system for isothermal reaction. Set the LAMP reaction temperature to 58 °C, and detect the real-time fluorescence intensity once every 1 minute for 100 minutes.

[0029] The nucleic acid sequences used in the present invention are shown in Table 1 below:

[0030] Table 1 Nucleic acid sequences in the present invention

[0031] Name Sequence (5'-3') ODN-C CCAGGTCCCACAGATCTATCACCCGGGGCTCTTCAAACTCTGCAGG ODN-5mC CCAGGTCCCACAGATCTATCACC5mCGGGGCTCTTCAAACTCTGCAGG ODN-5hmC CCAGGTCCCACAGATCTATCACC5hmCGGGGCTCTTCAAACTCTGCAGG ODN-5fC CCAGGTCCCACAGATCTATCACC5fCGGGGCTCTTCAAACTCTGCAGG ODN-5caC CCAGGTCCCACAGATCTATCACC5caCGGGGCTCTTCAAACTCTGCAGG Complementary sequence of C CCTGCAGAGTTTGAAGAGCCCCGGGTGATAGATCTGTGGGACCTGG Probe A phosphate-AATAATAAATCTATAAAACTTTTGTCTGGCAGTGTGTTTCTATATCGGTCCTCTCTCCTCCTTTCACACTGCCAGAC Probe B GCCTACTACTTCGTTTCTTGCCTTTGCTCTCTACTGACTTTTCGAAGTAGTAGGCTTTTAATTTAAAAAACCCCG FIP GTCTGGCAGTGTGAAAGGAGGAGAGAGGACCGATATAG BIP GCCTACTACTTCGTTTCTTGCCTTTGCTCTCTACTGAC

[0032] Compared with the prior art, the beneficial effects of the present invention are:

[0033] (1) First, apply glucosyltransferase to modify UDP-Glu on the hydroxyl group of 5hmC to form 5gmc, protecting 5hmC from the subsequent reactions. Then, apply APOBEC to deaminate C and 5mC into uracil (U), and convert 5fC and 5caC into dihydrouracil (DHU) through pyridine borane. U and DHU pair with A base complementarily, while 5gmc still pairs with G, thus forming a single-base difference between 5hmC and other bases.

[0034] (2) Since the ligase has high specificity, only the 5gmc sequence can connect probe A and probe B into a sequence through the action of the ligase, triggering LAMP exponential amplification. Detect 5hmC at specific loci by the ligase-LAMP method. The detection method of the present invention is mild and efficient, capable of detecting 5hmC as low as 200 aM, with a specificity of up to 1%.

[0035] (3) Since the kit of the present invention does not require sodium bisulfite treatment, it avoids DNA degradation and is applicable to DNA samples with low content. Due to the high specificity of the method for 5hmC, interference from target C or target 5mC with high content in the sample can be avoided. Due to the high sensitivity of the method in detecting 5hmC, interference from 5fC and 5caC with low content can also be excluded, ultimately realizing simple, rapid, and mild detection of 5hmC in a small amount of sample. Description of the Drawings

[0036] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0037] Figure 1 Showing the structure of probe A;

[0038] Figure 2 Showing the structure of probe B;

[0039] Figure 3 The results of detecting a mixed sample by the method in Example 2; the real-time fluorescence curves generated by different concentrations of the target sequence 5hmC. From right to left, the concentrations of the target sequence 5hmC are blank, 2 fM, 20 fM, 200 fM, 2 pM, and 20 pM in turn;

[0040] Figure 4 The linear relationship between the logarithm of the concentration of the target sequence 5hmC and the POI;

[0041] Figure 5Real-time fluorescence curves of sequences C, 5mC, 5hmC, 5fC, and 5caC with a concentration of 200 fM;

[0042] Figure 6 Show the implementation process and principle of the present invention. Detailed implementation manners

[0043] To make the objectives, technical solutions, and advantages of the present invention clearer, the technical solutions of the present invention will be described in detail below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. All other implementation manners obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts fall within the scope protected by the present invention.

[0044] In some more specific embodiments, the kit for detecting 5hmC includes: a blocking reaction solution, an APOBEC deamination conversion solution, a pyridine borane conversion solution, a ligation reaction solution, and a LAMP reaction mixture; the ligation reaction solution includes probe A and probe B; the sequence of probe A is shown as SEQ ID NO:1; the sequence of probe B is shown as SEQ ID NO:2.

[0045] SEQ ID NO:1:

[0046] 5'-phosphate-AATAATAAATCTATAAAACTTTTGTCTGGCAGTGTGTTTCTATATCGGTCCTCTCTCCTCCTTTCACACTGCCAGAC-3';

[0047] SEQ ID NO:2:

[0048] 5'-GCCTACTACTTCGTTTCTTGCCTTTGCTCTCTACTGACTTTTCGAAGTAGTAGGCTTTTAATTTAAAAAACCCCG-3'.

[0049] The blocking reaction solution in the kit includes 1 μL of 10×cutsmart buffer, 1 μL of 50×UDP-Glu, 1 μL of 10 U T4-βGT, and 2 μL of deionized water, with a total volume of 5 μL.

[0050] The APOBEC deamination conversion solution includes 0.2 μL of APOBEC deaminase, 1 μL of 10×APOBEC deamination buffer, and 0.1 μL of bovine serum albumin, with a total volume of 1.3 μL.

[0051] The pyridine borane conversion solution includes 1 μL of 600 mM sodium acetate solution with pH = 4.3 and 0.1 μL of 1 M pyridine borane, with a total volume of 1.1 μL.

[0052] The ligation reaction solution includes 1 μL of 20 nM probe A, 1 μL of 20 nM probe B, 0.2 μL of 5 U Amp ligase, 1 μL of 10× Amp ligase buffer solution, and 5.8 μL of deionized water, with a total volume of 9 μL.

[0053] The kit further includes a LAMP reaction mixture, which includes 0.5 μL of 10 mM upstream primer, 0.5 μL of 10 mM downstream primer, 0.8 μL of 2.5 mM dNTP, 0.5 μL of 8 U Bst DNA polymerase, 1 μL of 10× ThermoPol reaction buffer solution, 2 μL of 5 M betaine, 0.2 μL of 50× SYBR Green I, and 2.5 μL of deionized water, with a total volume of 8 μL.

[0054] The sequence of FIP is shown as SEQ ID NO:3:

[0055] 5'-GTCTGGCAGTGTGAAAGGAGGAGAGAGGACCGATATAG-3';

[0056] The sequence of BIP is shown as SEQ ID NO:4:

[0057] 5'-GCCTACTACTTCGTTTCTTGCCTTTGCTCTCTACTGAC-3';

[0058] A method for quantitatively detecting 5hmC in a genome includes the following steps:

[0059] (1) Blocking 5hmC: Prepare a blocking reaction solution and a DNA template, put the blocking reaction solution into the sample to be detected, and carry out a blocking reaction;

[0060] (2) Deamination conversion: After the blocking reaction in step (1) ends, quickly transfer the reaction to a PCR tube rack for cooling; add the APOBEC deamination conversion solution to the blocking reaction system to carry out a deamination reaction;

[0061] (3) Pyridine borane conversion: Add the pyridine borane conversion solution to the reaction solution after deamination conversion in step (2), put it into a thermostatic mixer for reaction, and after the reaction ends, purify the DNA using the UNlQ-10 column universal DNA purification kit;

[0062] (4) Ligation reaction: Add the purified product after the reaction in step (3) to the ligation reaction mixture. Mix well and heat to denature the dsDNA, and then perform the ligation reaction. Using the target sequence as a template, ligate probe A and probe B under the catalysis of ligase.

[0063] (5) LAMP reaction: Take the ligation product after the reaction in step (4) and add it to the LAMP reaction mixture. After mixing the LAMP reaction mixture evenly, immediately transfer it to the StepOne Real-Time PCR system for isothermal reaction, and detect the real-time fluorescence intensity once every 1 minute.

[0064] Further, the method for quantitatively detecting 5hmC in the genome using the described kit includes the following steps:

[0065] (1) Blocking 5hmC: Prepare the blocking reaction solution and the DNA sample to be tested. Mix 5 μL of the blocking reaction solution with 2 μL of the DNA sample to be tested in a 200 μL PCR tube and perform the blocking reaction.

[0066] (2) Deamination conversion: After the blocking reaction in step (1) ends, quickly transfer the PCR tube to the PCR tube rack to cool. Add 1.3 μL of the APOBEC deaminase conversion solution to the 7 μL blocking reaction system for deamination reaction.

[0067] (3) Pyridine borane conversion: Add 1.1 μL of the pyridine borane conversion solution to the reaction solution after deamination conversion in step (2), place it in a thermostatic mixer for reaction, and after the reaction ends, purify the DNA using the UNlQ-10 column general DNA purification kit.

[0068] (4) Ligation reaction: Add 1 μL of the DNA sample purified in step (3) to 9 μL of the ligation reaction mixture, heat to denature the dsDNA, and at an appropriate temperature, ligate probe A and probe B using the target sequence as a template under the catalysis of ligase.

[0069] (5) LAMP amplification reaction: Take 2 μL of the ligation product in step (4) and add it to 8 μL of the LAMP reaction mixture. After mixing the LAMP reaction mixture evenly, immediately transfer it to the StepOne Real-Time PCR system for isothermal reaction, and detect the real-time fluorescence intensity once every 1 minute.

[0070] Further, in step (1), the closed reaction conditions are: incubation at 37 °C for 2 hours; in step (2), the deamination conditions are: the temperature is gradually increased from 4 °C to 50 °C within 2 hours for incubation, and 50 °C is maintained for 10 minutes; in step (3), the reaction conditions are: the constant temperature mixer is set at a rotation speed of 850 rpm and incubated at 37 °C for 16 hours; in step (4), the ligation conditions are: heating at 90 °C for 3 minutes to denature dsDNA at high temperature, and then reacting at 45 °C for 15 minutes. In step (5), the LAMP amplification reaction conditions are: reaction at 58 °C for 100 minutes.

[0071] First, the present invention uses glucosyltransferase to modify UDP-Glu on the hydroxyl group of 5hmC to form 5gmc, protecting 5hmC from being affected by subsequent reactions. Then, APOBEC is used to deaminate C and 5mC to convert them into uracil (U), and 5fC and 5caC are converted into dihydrouracil (DHU) by pyridine borane. U and DHU are complementary to base A, while 5gmc is still paired with G, so that 5hmC forms a single-base difference with other bases.

[0072] The sequence of ODN-C is shown in SEQ ID NO:5:

[0073] 5'-CCAGGTCCCACAGATCTATCACCCGGGGCTCTTCAAACTCTGCAGG-3'

[0074] The sequence of ODN-5mC is shown in SEQ ID NO:6:

[0075] 5'-CCAGGTCCCACAGATCTATCACC m CGGGGCTCTTCAAACTCTGCAGG-3'

[0076] The sequence of ODN-5hmC is shown in SEQ ID NO:7:

[0077] 5'-CCAGGTCCCACAGATCTATCACC hm CGGGGCTCTTCAAACTCTGCAGG-3'

[0078] The sequence of ODN-5fC is shown in SEQ ID NO:8:

[0079] 5'- CCAGGTCCCACAGATCTATCACC f CGGGGCTCTTCAAACTCTGCAGG-3'

[0080] The sequence of ODN-5caC is shown in SEQ ID NO:9:

[0081] 5'-CCAGGTCCCACAGATCTATCACC ca CGGGGCTCTTCAAACTCTGCAGG-3'

[0082] The following are more specific examples:

[0083] Example 1

[0084] This example provides a kit for detecting 5hmC, which includes: a blocking reaction solution, an APOBEC deamination conversion solution, a pyridine borane conversion solution, a ligation reaction solution, and a LAMP reaction mixture; the ligation reaction solution includes probe A and probe B; the sequence of probe A is as shown in SEQ ID NO:1; the sequence of probe B is as shown in SEQ ID NO:2; the blocking reaction solution includes 1 μL of 10× cutsmart buffer, 1 μL of 50× UDP-Glu, 1 μL of 10 U T4-βGT, and 2 μL of deionized water; the cutsmart buffer includes 5 mM potassium acetate, 2 mM tris-acetate, 1 mM magnesium acetate, and 10 μg / ml BSA, and the pH is adjusted to 7.9; the APOBEC deamination conversion solution includes 0.2 μL of APOBEC deaminase, 1 μL of 10× APOBEC deamination buffer, and 0.1 μL of bovine serum albumin. The pyridine borane conversion solution includes 1 μL of a 600 mM sodium acetate solution with a pH of 4.3 and 0.1 μL of 1 M pyridine borane; the ligation reaction solution includes 1 μL of 20 nM probe A, 1 μL of 20 nM probe B, 0.2 μL of 5 U Amp ligase, 1 μL of 10× Amp ligase buffer solution, and 5.8 μL of deionized water. The LAMP reaction mixture includes 0.5 μL of 10 mM upstream primer FIP, 0.5 μL of 10 mM downstream primer BIP, 0.8 μL of 2.5 mM dNTP, 0.5 μL of 8 U Bst DNA polymerase (large fragment), 1 μL of 10× ThermoPol reaction buffer solution, 2 μL of 5 M betaine, 0.2 μL of 50× SYBR Green I, and 2.5 μL of deionized water.

[0085] Example 2

[0086] A method for quantitatively detecting 5hmC in a genome, comprising the following steps:

[0087] (1)Blocking 5hmC: Prepare 5 μL of blocking reaction solution. The reaction solution contains 0.5 μL of 10× CutSmart buffer (5 mM potassium acetate, 2 mM Tris-acetate, 1 mM magnesium acetate, 10 μg / ml BSA, pH 7.9), 1 μL of 50× UDP-Glu (NEB), 1 μL of 10 U T4-βGT (NEB), 2 μL of deionized water, and 2 μL of DNA template. The reaction condition is to incubate at 37 °C for 2 hours.

[0088] (2)APOBEC deamination: After the blocking reaction is completed, the sample is denatured at 95 °C for 5 minutes, and then the reaction is quickly transferred to a PCR tube rack pre-incubated at -20 °C to cool. Prepare 1.3 μL of deamination reaction solution. The reaction solution contains 1 μL of 10X APOBEC reaction buffer, 0.1 μL of bovine serum albumin (BSA), and 0.2 μL of APOBEC. Add all the deamination solution to the blocking reaction system, and the final volume is 8.3 μL. The deamination reaction conditions are: incubate with a temperature gradient from 4 °C to 50 °C within 2 hours and then continue to incubate at 50 °C for 10 minutes.

[0089] (3)Pyridine borane conversion: Add 1 μL of 600 mM NaAc (pH = 4.3) and 0.1 μL of 1 M pyridine borane (Aladdin) to the above reaction solution, and the final volume is 9.4 μL. Place it in a thermostatic mixer (Eppendorf) and set the rotation speed to 850 r.p.m. The reaction condition is to incubate at 37 °C for 16 hours. After the reaction is completed, purify the DNA using the UNlQ-10 column universal DNA purification kit.

[0090] (4)Ligation reaction: Add 1 μL of the product after the above reaction to 9 μL of the ligation reaction mixture. The mixture contains 2 nM of probe A, 2 nM of probe B, 0.02 U of Amp ligase, and 1× Amp ligase buffer. After adding the target sequence, mix well, heat at 90 °C for 3 minutes to denature dsDNA at high temperature, and then react at 45 °C for 15 minutes to ligate probe A (such as Figure 1 )and probe B (such as Figure 2 )using the target sequence as a template under the catalysis of ligase. Amp ligase is a heat-resistant ligase, and its activity is not affected by the reaction temperature.

[0091] (5) LMAP reaction: Add 2 μL of the ligation product after the above reaction to 8 μL of the LAMP reaction mixture. The LAMP mixture contains 0.4 μM of FIP, 0.4 μM of BIP, 200 μM of dNTP, 4 U of Bst DNA polymerase, 1× ThermoPol reaction buffer solution, 1 M of betaine and 0.4× SYBR Green I. After the LAMP reaction mixture is mixed evenly, immediately transfer it to the StepOne Real-Time PCR system for isothermal reaction. The LAMP reaction temperature is set at 58 °C, the real-time fluorescence intensity is detected every 1 minute, and the reaction time is 100 minutes.

[0092] Figure 3 Results of detecting the mixed samples using the method in Example 2; Real-time fluorescence curves generated by different concentrations of the target sequence 5hmC. From right to left, the concentrations of the target sequence 5hmC are blank, 2 fM, 20 fM, 200 fM, 2 pM, 20 pM; As Figure 3 shown, as the 5hmC concentration increases from 2 fM to 20 pM, the POI value of the real-time fluorescence curve corresponding to the real-time fluorescence curve gradually decreases. The ligation LAMP method can detect the target sequence 5hmC as low as 2 fM. Under isothermal conditions, the detection concentration range can span 5 orders of magnitude. When the POI value is plotted against the logarithm of the 5hmC concentration, a good linear relationship can be obtained within the concentration range of 2 fM to 20 pM.

[0093] Figure 4 is the linear relationship between the logarithm of the 5hmC concentration and the POI. The linear regression equation is POI = 6.19 lgC5hmC + 22.03, and the correlation coefficient R is 0.996. For 5hmC and other modifications with highly similar structures and likely to appear at the same locus, the specificity of the method is extremely important. To evaluate the specificity of the method, under the same conditions, sequences C, 5mC, 5hmC, 5fC, and 5caC at 200 fM were detected. The results are as Figure 5 shown as the real-time fluorescence curves of sequences C, 5mC, 5hmC, 5fC, and 5caC at 200 fM; From Figure 5 it can be seen that the real-time fluorescence curve of the target sequence 5hmC can be clearly distinguished from other base sequences. Substituting the POI value into the linear equation, the concentration of the 200 fM interfering sequence can be obtained. Setting the signal of 5hmC as 100%, the detection of other interfering sequences is less than 1%, and the specificity of detecting 5hmC is 1%. Therefore, these results clearly show that the method has high specificity.

[0094] The method for quantitatively detecting 5hmC in the genome applies a mild transformation-assisted ligation LAMP reaction. Figure 6 shows the implementation process and principle of the present invention.

[0095] The above are only specific embodiments of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention can easily think of changes or substitutions, which should all be covered within the protection scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims described above.

Claims

1. A kit for detecting 5hmC, characterized in that, The kit includes: a blocking reaction solution, an APOBEC deamination conversion solution, a pyridine borane conversion solution, a ligation reaction solution, and a LAMP reaction mixture; the ligation reaction solution includes probe A and probe B; the sequence of probe A is shown in SEQ ID NO:1; the sequence of probe B is shown in SEQ ID NO:2; In the kit, the blocking reaction solution includes 1 μL of 10×cutsmart buffer, 1 μL of 50×UDP-Glu, 1 μL of 10 U phage β-glucosyltransferase, and 2 μL of deionized water, with a total volume of 5 μL; The APOBEC deamination conversion solution includes 0.2 μL of APOBEC deaminase, 1 μL of 10×APOBEC deamination buffer, and 0.1 μL of bovine serum albumin, with a total volume of 1.3 μL; The pyridine borane conversion solution includes 1 μL of 600 mM sodium acetate solution with pH = 4.3 and 0.1 μL of 1 M pyridine borane, with a total volume of 1.1 μL; The ligation reaction solution includes 1 μL of 20 nM probe A, 1 μL of 20 nM probe B, 0.2 μL of 5 U Amp ligase, 1 μL of 10×Amp ligase buffer solution, and 5.8 μL of deionized water, with a total volume of 9 μL.

2. The kit according to claim 1, characterized in that, The LAMP reaction mixture includes 0.5 μL of 10 mM upstream primer, 0.5 μL of 10 mM downstream primer, 0.8 μL of 2.5 mM dNTP, 0.5 μL of 8 U Bst DNA polymerase, 1 μL of 10×ThermoPol reaction buffer solution, 2 μL of 5 M betaine, 0.2 μL of 50×SYBR Green I, and 2.5 μL of deionized water, with a total volume of 8 μL.

3. A method for quantitatively detecting 5hmC in a genome using the kit according to any one of claims 1-2, the method being for non-disease diagnosis and treatment purposes, characterized in that, It includes the following steps: (1) Blocking 5hmC: Prepare the blocking reaction solution and the DNA sample to be tested, mix 5 μL of the blocking reaction solution with 2 μL of the DNA sample to be tested in a 200 μL PCR tube, and carry out the blocking reaction; (2) Deamination conversion: After the blocking reaction in step (1) ends, quickly transfer the PCR tube to a PCR tube rack for cooling; add 1.3 μL of the APOBEC deamination conversion solution to the blocking reaction system to carry out the deamination reaction; (3) Pyridine borane conversion: Add 1.1 μL of the pyridine borane conversion solution to the reaction solution after deamination conversion in step (2), place it in a thermostatic mixer for reaction, and after the reaction ends, purify the DNA using the UNlQ-10 column universal DNA purification kit; (4) Ligation reaction: Add the purified DNA sample in step (3) to the ligation reaction solution, heat to denature the dsDNA, and ligate probe A and probe B using the target sequence as a template under the catalysis of ligase at an appropriate temperature; (5) LAMP amplification reaction: Take 2 μL of the ligation product in step (4) and add it to 8 μL of the LAMP reaction mixture; after the LAMP reaction mixture is mixed evenly, immediately transfer it to a StepOne Real-Time PCR system for a constant temperature reaction, and detect the real-time fluorescence intensity once every 1 minute.

4. The method for quantitatively detecting 5hmC in a genome according to claim 3, characterized in that, In step (1), the reaction conditions are: incubate at 37 °C for 2 hours; in step (2), the reaction conditions are: increase the temperature from 4 °C to 50 °C gradiently within 2 hours for incubation, and maintain at 50 °C for 10 minutes; in step (3), the reaction conditions are: set the rotation speed of the constant temperature mixer at 850 rpm and incubate at 37 °C for 16 hours; in step (4), the reaction conditions are: heat at 90 °C for 3 minutes to denature dsDNA at high temperature, and then react at 45 °C for 15 minutes; in step (5), the reaction conditions are: react at 58 °C for 100 minutes.