Construction of gene editing system for SPR gene mutation of sepiapterin reductase deficiency model pig nuclear transfer donor cells and application thereof

By using CRISPR/Cas9 technology and dual gRNA editing in pig cells, a metoprolol reductase deficiency model pig with SPR gene mutation was prepared, which solved the problem of large differences between existing models and humans, and achieved efficient and stable gene editing and disease simulation, which is suitable for drug and treatment research.

CN115976017BActive Publication Date: 2026-06-19NANJING KGENE GENETIC ENG CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANJING KGENE GENETIC ENG CO LTD
Filing Date
2022-07-27
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

In the existing animal model production, silkworm and mouse models differ greatly from humans in terms of body size, organ size, physiology, and pathology, making it difficult to realistically simulate human physiological and pathological states. Furthermore, primates are small in size, difficult to reproduce, and costly, making them unsuitable as effective models for metoprolol reductase deficiency.

Method used

A model pig with metoprolol reductase deficiency mutated by SPR gene was prepared by using CRISPR/Cas9 technology combined with dual gRNA editing of pig cells. The pig cells were transfected by electroporation, and the optimized Cas9 protein and gRNA were used to achieve efficient gene editing and obtain stable gene-mutated single-cell clones. The model pigs were then cultured by somatic cell nuclear transfer technology.

Benefits of technology

The constructed pig model is more similar to humans, can efficiently simulate disease states, shorten the model production cycle, improve gene editing efficiency, and is suitable for drug screening, efficacy evaluation and gene therapy research, providing effective experimental data.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003766894480000141
    Figure BDA0003766894480000141
  • Figure BDA0003766894480000151
    Figure BDA0003766894480000151
  • Figure BDA0003766894480000161
    Figure BDA0003766894480000161
Patent Text Reader

Abstract

This invention discloses a gene editing system for constructing porcine nuclear transplantation donor cells for a metoprolol reductase deficiency model with SPR gene mutations and its applications. The invention provides a kit comprising SPR-gRNA1 (SEQ ID NO: 16), SPR-gRNA4 (SEQ ID NO: 17), and NCN protein. The invention also provides a method for preparing recombinant cells: co-transfecting porcine cells with SPR-gRNA1, SPR-gRNA4, and NCN protein to obtain recombinant cells. The recombinant cells are recombinant cells with a mutated SPR gene. The kit is used for: preparing recombinant cells; preparing porcine metoprolol reductase deficiency models; and preparing metoprolol reductase deficiency cell models, tissue models, or organ models. This invention has significant application value for the development of drugs for metoprolol reductase deficiency and for elucidating the pathogenesis of this disease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically to the field of gene editing technology, and more specifically relates to a gene editing system for constructing donor cells for porcine nuclear transplantation of SPR gene-mutated metoprolol reductase deficiency model cells and its application. Background Technology

[0002] Metoprolol reductase deficiency is an autosomal recessive genetic disorder that causes dopa-responsive dystonia (DRD), accounting for 3% of all DRD cases. Similar to classic DRD, metoprolol reductase deficiency is a monoamine neurotransmitter synthesis defect caused by abnormal synthesis of tetrahydrobiopterin (BH4). Because it is not accompanied by hyperphenylalaninemia, screening for metoprolol reductase deficiency in newborns is often ineffective. Metoprolol reductase deficiency is primarily caused by mutations in the SPR gene, which encodes mitogen reductase, the enzyme responsible for the final step in BH4 synthesis. BH4 is a cofactor in aromatic amino acid metabolism, controlling the levels of monoamine neurotransmitters in the body, which directly affects signal transduction between brain nerve cells.

[0003] Research into the pathogenesis and development of metoprolol reductase deficiency and the development of corresponding drugs both require animal models. Currently, the most commonly used animal models are silkworm and mouse models. However, silkworms and mice differ greatly from humans in terms of body size, organ size, physiology, and pathology, and cannot realistically simulate normal human physiological and pathological states. Pigs, as large animals, have body size and physiological functions similar to humans, are easy to breed and raise on a large scale, and have lower ethical and animal protection requirements, making them ideal animal models for human diseases.

[0004] Gene editing is a biotechnology that has seen significant development in recent years. It encompasses everything from homologous recombination-based gene editing to nuclease-based technologies such as ZFN, TALEN, and CRISPR / Cas9, with CRISPR / Cas9 currently being the most advanced. Gene editing technology is increasingly being applied to the creation of animal models. Summary of the Invention

[0005] The purpose of this invention is to provide a gene editing system for constructing porcine nuclear transplantation donor cells for a metoprolol reductase deficiency model with SPR gene mutations and its applications.

[0006] This invention provides a kit comprising SPR-gRNA1, SPR-gRNA4 and NCN protein.

[0007] The present invention also provides a kit comprising SPR-gRNA1, SPR-gRNA4 and PRONCN proteins.

[0008] The present invention also provides a kit comprising SPR-gRNA1, SPR-gRNA4 and a specific plasmid.

[0009] The kits described above also include porcine cells.

[0010] This invention provides the application of SPR-gRNA1, SPR-gRNA4 and NCN proteins in the preparation of kits.

[0011] This invention also provides the application of SPR-gRNA1, SPR-gRNA4 and PRONCN proteins in the preparation kit.

[0012] This invention also provides the application of SPR-gRNA1, SPR-gRNA4 and specific plasmids in the preparation kit.

[0013] The above-described kits are intended for use as follows (a), (b), or (c): (a) to prepare recombinant cells; (b) to prepare porcine model of metoprolol reductase deficiency; (c) to prepare a cell model, tissue model, or organ model of metoprolol reductase deficiency.

[0014] The present invention provides a method for preparing recombinant cells, comprising the following steps: co-transfecting porcine cells with SPR-gRNA1, SPR-gRNA4 and NCN proteins to obtain recombinant cells.

[0015] The co-transfection specifically employs an electroporation transfection method.

[0016] The specific parameter settings for electroporation transfection are: 1450V, 10ms, 3pulse.

[0017] The co-transfection can be specifically performed using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator.

[0018] The ratio of SPR-gRNA1, SPR-gRNA4 and NCN protein is as follows: 0.8-1.2 μg SPR-gRNA1 : 0.8-1.2 μg SPR-gRNA4 : 3-5 μg NCN protein.

[0019] The ratio of SPR-gRNA1, SPR-gRNA4 and NCN protein is as follows: 1 μg SPR-gRNA1 : 1 μg SPR-gRNA4 : 4 μg NCN protein.

[0020] The ratio of porcine cells, SPR-gRNA1, SPR-gRNA4, and NCN protein is as follows: 100,000 porcine cells: 0.8-1.2 μg SPR-gRNA1: 0.8-1.2 μg SPR-gRNA4: 3-5 μg NCN protein.

[0021] The ratio of porcine cells, SPR-gRNA1, SPR-gRNA4, and NCN protein was as follows: 100,000 porcine cells: 1 μg SPR-gRNA1: 1 μg SPR-gRNA4: 4 μg NCN protein.

[0022] The SPR-gRNA1 mentioned above is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 16.

[0023] Specifically, the SPR-gRNA1 is shown in SEQ ID NO: 16.

[0024] Specifically, the SPR-gRNA1 is shown in SEQ ID NO: 10.

[0025] The SPR-gRNA4 described above is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 17.

[0026] Specifically, the SPR-gRNA4 is shown in SEQ ID NO: 17.

[0027] Specifically, the SPR-gRNA4 is shown in SEQ ID NO: 13.

[0028] Any of the NCN proteins mentioned above is a Cas9 protein or a fusion protein containing a Cas9 protein.

[0029] Specifically, the NCN protein is shown in SEQ ID NO: 3.

[0030] The porcine cells mentioned above are porcine fibroblasts.

[0031] The porcine cells mentioned above are primary porcine fibroblasts.

[0032] The porcine cells mentioned above are primary porcine fibroblasts obtained from newborn pigs.

[0033] The method for preparing the NCN protein includes the following steps:

[0034] (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria;

[0035] (2) The recombinant bacteria were cultured in liquid culture medium at 30°C, then IPTG was added and induced at 25°C, and then the bacterial cells were collected.

[0036] (3) The collected bacterial cells were broken down to collect the crude protein solution;

[0037] (4) The His6-tagged fusion protein was purified from the crude protein solution by affinity chromatography;

[0038] (5) The His6-tagged fusion protein was digested with His6-tagged enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein.

[0039] The plasmid pKG-GE4 contains the fusion gene shown in nucleotides 5209-9852 of SEQ ID NO: 1.

[0040] The preparation method of the NCN protein specifically includes the following steps:

[0041] (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria.

[0042] (2) Inoculate the recombinant bacteria obtained in step (1) into liquid LB medium containing ampicillin and culture with shaking;

[0043] (3) Inoculate the bacterial culture obtained in step (2) into liquid LB medium and culture at 30°C with shaking at 230 rpm until OD. 600nm The value was 1.0, then IPTG was added to make the concentration in the system 0.5mM, and then the cells were cultured at 25℃ and 230rpm for 12 hours with shaking, and then the cells were collected by centrifugation.

[0044] (4) Take the bacterial cells obtained in step (3) and wash them with PBS buffer;

[0045] (5) Take the bacterial cells obtained in step (4), add crude extraction buffer and suspend the bacterial cells, then break the bacterial cells, then centrifuge and collect the supernatant, filter with a 0.22 μm pore size filter membrane and collect the filtrate;

[0046] (6) The His6-tagged fusion protein (the fusion protein shown in SEQ ID NO: 2) was purified from the filtrate obtained in step (5) by affinity chromatography;

[0047] (7) Take the column-passed solution collected in step (6), concentrate it using an ultrafiltration tube, and then dilute it with 25 mM Tris-HCl (pH 8.0);

[0048] (8) Add the recombinant bovine enterokinase with the His6 tag to the solution obtained in step (7) and digest it with enzymes;

[0049] (9) Mix the solution from step (8) with Ni-NTA resin, incubate, and then centrifuge to collect the supernatant.

[0050] (10) Take the supernatant obtained in step (9), concentrate it using an ultrafiltration tube, and then add it to the enzyme storage solution to obtain the NCN protein solution.

[0051] The specific method for purifying the His6-tagged fusion protein from the filtrate obtained in step (5) using affinity chromatography is as follows:

[0052] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then load 50 ml of the filtrate obtained in step (5) (flow rate: 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate: 1 ml / min) to remove contaminating proteins; then elute with 10 column volumes of elution buffer at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).

[0053] The PRONCN protein described above comprises the following components from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease cleavage site, nuclear localization signal, Cas9 protein, and nuclear localization signal.

[0054] The function of the signal peptide is to promote the secretory expression of a protein. The signal peptide can be selected from the Escherichia coli alkaline phosphatase (phoA) signal peptide, Staphylococcus aureus protein A signal peptide, Escherichia coli outer membrane protein (ompa) signal peptide, or any other prokaryotic gene signal peptide, preferably the alkaline phosphatase signal peptide (phoA signal peptide). The alkaline phosphatase signal peptide is used to guide the secretory expression of the target protein into the bacterial periplasmic lumen, thereby separating it from the intracellular protein. The target protein secreted into the bacterial periplasmic lumen is soluble and can be cleaved by the signal peptidase in the bacterial periplasmic lumen.

[0055] The function of the molecular chaperone protein is to increase the solubility of the protein. The molecular chaperone can be any protein that helps form disulfide bonds, preferably a thioreduction protein (TrxA protein). A thioreduction protein, acting as a molecular chaperone, helps the co-expressed target protein (e.g., Cas9 protein) form disulfide bonds, improving protein stability, correct folding, and increasing the solubility and activity of the target protein.

[0056] The protein tag is used for protein purification. The tag can be a His tag (His-Tag, His6 protein tag), GST tag, Flag tag, HA tag, c-Myc tag, or any other protein tag, with a His tag being more preferred. The His tag can bind to a Ni column, enabling one-step Ni column affinity chromatography to purify the target protein, greatly simplifying the purification process.

[0057] The function of the protease cleavage site is to cleave the non-functional segment after purification to release the native form of Cas9 protein. The protease can be selected from enterokinase, factor Xa, thrombin, TEV protease, HRV 3C protease, WELQut protease, or any other endopeptide, with enterokinase being more preferred. EK is an enterokinase cleavage site, facilitating the cleavage of the fused TrxA-His segment using enterokinase to obtain the native form of Cas9 protein. In this application, after cleaving the fusion protein with a His-tagged commercial enterokinase, the TrxA-His segment and the His-tagged enterokinase can be removed by a single affinity chromatography to obtain the native form of Cas9 protein, avoiding the damage and loss of the target protein caused by multiple purification dialysis processes.

[0058] The nuclear localization signal can be any nuclear localization signal, preferably the SV40 nuclear localization signal and / or the nucleoplasmin nuclear localization signal. The NLS is the nuclear localization signal; an NLS site is designed at both the N-terminus and C-terminus of Cas9, enabling Cas9 to more effectively enter the cell nucleus for gene editing.

[0059] The Cas9 protein may be saCas9 or spCas9, preferably spCas9 protein.

[0060] The PRONCN protein is shown in SEQ ID NO: 2.

[0061] Each of the above-mentioned specific plasmids comprises the following elements from upstream to downstream: promoter, operon, ribosome binding site, gene encoding PRONCN protein, and terminator.

[0062] The promoter may specifically be the T7 promoter. The T7 promoter is a strong prokaryotic expression promoter that can efficiently drive the expression of exogenous genes.

[0063] The operon can specifically be the Lac operon. The Lac operon is a regulatory element for lactose-induced expression. After the bacteria have grown to a certain number, the expression of the target protein can be induced by IPTG at low temperature, which can avoid the impact of premature expression of the target protein on the growth of the host bacteria. Induction at low temperature also significantly improves the solubility of the expressed target protein.

[0064] The ribosome binding site is the ribosome binding site during protein translation, which is essential for protein translation.

[0065] The terminator can specifically be a T7 terminator. The T7 terminator can effectively terminate gene transcription at the end of the target gene, preventing other downstream sequences outside the target gene from being transcribed and translated.

[0066] For the codons of spCas9 protein, this application has optimized the codons to fully adapt to the codon preferences of the high-efficiency E. coli expression strain E. coli BL21(DE3) selected in this application, thereby improving the expression level of Cas9 protein.

[0067] The T7 promoter is shown as nucleotides 5121-5139 in SEQ ID NO: 1.

[0068] The Lac operon is shown as nucleotides 5140-5164 in SEQ ID NO: 1.

[0069] The ribosome binding site is shown as nucleotides 5178-5201 in SEQ ID NO: 1.

[0070] The coding sequence of the alkaline phosphatase signal peptide is shown as nucleotides 5209-5271 in SEQ ID NO: 1.

[0071] The coding sequence of the TrxA protein is shown as nucleotides 5272-5598 in SEQ ID NO: 1.

[0072] The coding sequence of His-Tag is shown as nucleotides 5620-5637 in SEQ ID NO: 1.

[0073] The coding sequence of the enterokinase cleavage site is shown as nucleotides 5638-5652 in SEQ ID NO: 1.

[0074] The coding sequence of the nuclear localization signal is shown as nucleotides 5656-5670 in SEQ ID NO: 1.

[0075] The coding sequence of the spCas9 protein is shown as nucleotides 5701-9801 in SEQ ID NO: 1.

[0076] The coding sequence of the nuclear localization signal is shown as nucleotides 9802-9849 in SEQ ID NO: 1.

[0077] The T7 terminator is nucleotides 9902-9949 in SEQ ID NO: 1.

[0078] Specifically, the specific plasmid is plasmid pKG-GE4.

[0079] The plasmid pKG-GE4 contains the DNA molecule represented by nucleotides 5121-9949 of SEQ ID NO: 1.

[0080] Specifically, any of the plasmids pKG-GE4 described above is shown in SEQ ID NO: 1.

[0081] This invention also protects recombinant cells prepared by any of the methods described above.

[0082] The recombinant cells are recombinant cells with mutations in the SPR gene.

[0083] The recombinant cells can specifically be single-cell clones with genotypes of heterozygosity, identical biallelic mutants, or different biallelic mutants as listed in Table 1.

[0084] This invention also protects the use of the recombinant cells in the preparation of a porcine model of metoprolol reductase deficiency.

[0085] Using the recombinant cells as nuclear transfer donor cells for somatic cell cloning, cloned pigs can be obtained, which are metoprolol reductase deficiency model pigs.

[0086] The present invention also protects porcine tissues of model pigs prepared using the recombinant cells, namely metoprolol reductase deficiency tissue models.

[0087] The present invention also protects porcine organs of model pigs prepared using the recombinant cells, namely metoprolol reductase deficiency organ models.

[0088] The present invention also protects porcine cells of model pigs prepared using the recombinant cells, namely metoprolol reductase deficiency cell models.

[0089] The present invention also protects the use of the recombinant cells, the metoprolol reductase deficiency tissue model, the metoprolol reductase deficiency organ model, the metoprolol reductase deficiency cell model, or the metoprolol reductase deficiency model pig, as follows (d1) or (d2) or (d3) or (d4):

[0090] (d1) Screening for drugs to treat metoprolol reductase deficiency;

[0091] (d2) Efficacy evaluation of drugs for metoprolol reductase deficiency;

[0092] (d3) Evaluate the efficacy of gene therapy and / or cell therapy for metoprolol reductase deficiency;

[0093] (d4) To study the pathogenesis of metoprolol reductase deficiency.

[0094] The pig mentioned above can specifically refer to the Congjiang Xiang pig.

[0095] The pigs mentioned above can specifically refer to newborn Congjiang Xiang pigs.

[0096] The metoprolol reductase deficiency described above is caused by mutations in the SPR gene.

[0097] Porcine SPR gene information: encodes metoprolol reductase; located on chromosome 3; Gene ID is 100521367, Susscrofa.

[0098] The amino acid sequence of the protein encoded by the porcine SPR gene is shown in SEQ ID NO: 8.

[0099] The porcine SPR gene contains the DNA segment shown in SEQ ID NO: 9.

[0100] Any of the above-described mutations are deletions and / or insertions and / or substitutions of one or more nucleotides.

[0101] Any of the above-described mutations is the deletion of one or more nucleotides.

[0102] Any of the above mutations is an insertion of one or more nucleotides.

[0103] Any of the above-described mutations are deletions and insertions of one or more nucleotides.

[0104] Compared with the prior art, the present invention has at least the following beneficial effects:

[0105] (1) The research object of this invention (pig) has better applicability than other animals (mice, mice, primates).

[0106] Rodents such as mice and rats differ greatly from humans in body size, organ size, physiology, and pathology, making it impossible to realistically simulate normal human physiological and pathological states. Studies have shown that over 95% of drugs proven effective in mice and rats are ineffective in human clinical trials. Among large animals, primates are the closest relatives to humans, but they are small, reach sexual maturity late (mating begins at 6-7 years old), and are single-birth animals, resulting in extremely slow population expansion and high rearing costs. Furthermore, primate cloning is inefficient, difficult, and costly.

[0107] Pigs, as model animals, do not have the aforementioned drawbacks. Pigs are the closest relatives to humans besides primates, and their body size, weight, and organ size are similar to humans. They are also remarkably similar to humans in anatomy, physiology, immunology, nutritional metabolism, and disease pathogenesis. Furthermore, pigs reach sexual maturity early (4-6 months), have high reproductive capacity, produce multiple offspring per litter, and can form a large herd within 2-3 years. In addition, pig cloning technology is very mature, and the costs of cloning and raising pigs are much lower than for primates. Therefore, pigs are very suitable animals to serve as human disease models.

[0108] (2) The vector constructed in this invention uses the strong promoter T7-lac, which can efficiently express the target protein, to express the target protein. The signal peptide of bacterial periplasmic protein alkaline phosphatase (phoA) guides the secretion of the target protein into the bacterial periplasmic lumen, thereby separating it from intracellular proteins. The target protein secreted into the bacterial periplasmic lumen is soluble. Simultaneously, the thioreduction protein TrxA is fused with the Cas9 protein for expression. TrxA helps the co-expressed target protein form disulfide bonds, improving protein stability, correct folding, and increasing the solubility and activity of the target protein. To facilitate the purification of the target protein, a His tag is designed, allowing for one-step Ni column affinity chromatography purification of the target protein, greatly simplifying the purification process. Furthermore, an enterokinase cleavage site is designed after the His tag to facilitate the removal of the fused TrxA-His polypeptide fragment, yielding the native form of the Cas9 protein. After cleaving the fusion protein with a His-tagged enterokinase, the TrxA-His polypeptide fragment and the His-tagged enterokinase can be removed by a single affinity chromatography step, yielding the native form of Cas9 protein. This avoids the damage and loss to the target protein caused by multiple purification dialysis steps. Furthermore, this invention also designs an NLS site at the N-terminus and C-terminus of Cas9, enabling Cas9 to more effectively enter the cell nucleus for gene editing. Additionally, this invention selects E. coli BL21(DE3) as the target protein expression strain, which can efficiently express exogenous genes cloned into expression vectors containing the phage T7 promoter (such as pET-32a). Moreover, this invention optimizes the codons for the Cas9 protein to perfectly suit the codon preferences of the expression strain, thereby improving the expression level of the target protein. Furthermore, this invention induces the expression of the target protein with IPTG at low temperature after the bacteria have grown to a certain quantity, avoiding the impact of premature expression on host bacterial growth. Low-temperature induction also significantly improves the solubility of the expressed target protein. After the above-mentioned optimization design and experimental implementation, the activity of the obtained Cas9 protein was significantly improved compared with that of the commercial Cas9 protein.

[0109] (3) Gene editing was performed using the Cas9 high-efficiency protein constructed and expressed in this invention in combination with in vitro transcribed gRNA, and the optimal ratio of Cas9 and gRNA was optimized. The final rate of gene-edited single-cell clones was as high as 90.9%, which is much higher than the conventional gene editing efficiency (10-30%).

[0110] (4) Using the target gene knockout single-cell clone obtained by the present invention to perform somatic cell nuclear transfer animal cloning, the target gene knockout clone pig can be directly obtained, and the gene mutation can be stably inherited.

[0111] The method of microinjecting gene-edited material into fertilized eggs followed by embryo transfer, used in mouse model creation, has a relatively low probability of directly obtaining gene-mutated offspring, requiring crossbreeding and selection of offspring. This method is not suitable for creating models of large animals (such as pigs) with long gestation periods. Therefore, this invention employs a technically challenging method of primary cell in vitro editing, Cas9 protein and double gRNA cleavage, and screening for positively edited single-cell clones. Subsequently, somatic cell nuclear transfer animal cloning technology is used to directly obtain pig models of the corresponding disease. This significantly shortens the pig model creation cycle and saves manpower, material resources, and financial resources.

[0112] This invention utilizes CRISPR / Cas9 technology combined with dual gRNA editing to knock out the SPR gene, mimicking the genetic characteristics of metoprolol reductase deficiency, and obtaining single-cell clones with the SPR gene knockout. This lays the foundation for later development of pig models of metoprolol reductase deficiency using somatic cell nuclear transfer animal cloning technology. This invention will contribute to the research and elucidation of the pathogenesis of metoprolol reductase deficiency caused by SPR gene dysfunction. It can also be used for drug screening, efficacy evaluation, gene therapy, and cell therapy research, providing effective experimental data for further clinical applications and thus offering a powerful experimental tool for the successful treatment of human metoprolol reductase deficiency. This invention has significant application value for the development of drugs for metoprolol reductase deficiency and for elucidating the pathogenesis of this disease. Attached Figure Description

[0113] Figure 1 This is a schematic diagram of the structure of plasmid pET-32a.

[0114] Figure 2 This is a schematic diagram of the structure of plasmid pKG-GE4.

[0115] Figure 3 This is an electrophoresis diagram showing the optimized ratio of gRNA to NCN protein in Example 2.

[0116] Figure 4 This is an electrophoresis diagram comparing the gene editing efficiency of NCN protein and commercial Cas9 protein in Example 2.

[0117] Figure 5 This is an electrophoresis image of PCR amplification performed using different primer pairs with genome extracted from ear tissue of pig No. 1 as a template in Example 3.

[0118] Figure 6 The image shows electrophoresis results of PCR amplification using primer pairs SPR-E1-JDF30 and SPR-E1-JDR530, respectively, with genomic DNA from 18 pigs as templates in Example 3.

[0119] Figure 7 The reverse sequencing results of single-cell clone number 2 are compared with the wild-type sequence.

[0120] Figure 8 The reverse sequencing results of single-cell clone number 15 are compared with the wild-type sequence.

[0121] Figure 9 The reverse sequencing results of single-cell clone number 5 are compared with the wild-type sequence.

[0122] Figure 10 The results of forward sequencing of single-cell clone number 1 are compared with wild-type sequences. Detailed Implementation

[0123] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0124] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. The recombinant plasmids constructed in the examples have all been sequenced and verified. The commercially available Cas9-A protein is a commercially available, effective Cas9 protein. The commercially available Cas9-B protein is a commercially available, effective Cas9 protein. Complete culture medium (% by volume): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37°C, incubator with 5% CO2 and 5% O2.

[0125] The primary porcine fibroblasts used in the examples were all prepared from newly formed ear tissue of Jiangxian pigs. The method for preparing primary porcine fibroblasts was as follows: ① Take 0.5g of pig ear tissue, remove hair and bone tissue, then soak in 75% alcohol for 30-40s, then wash 5 times with PBS buffer containing 5% (v / v) Penicillin-Streptomycin (Gibco), and then wash once with PBS buffer; ② Cut the tissue into small pieces with scissors, digest with 5mL of 0.1% collagenase solution (Sigma) at 37℃ for 1h, then centrifuge at 500g for 5min and discard the supernatant; ③ Resuspend the precipitate in 1mL of complete culture medium, then place it into a 10cm diameter cell culture dish containing 10mL of complete culture medium and sealed with 0.2% gelatin (VWR), and culture until the cells reach approximately 60% confluence with the bottom of the dish; ④ After completing step ③, digest with trypsin and collect the cells, then resuspend them in complete culture medium. These cells are then used for subsequent electroporation experiments.

[0126] Example 1: Preparation and purification of NCN protein

[0127] I. Construction of a high-efficiency prokaryotic Cas9 expression vector

[0128] A schematic diagram of the structure of plasmid pET-32a is shown below. Figure 1 .

[0129] Plasmid pKG-GE4 was obtained by modifying plasmid pET-32a. Plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (abbreviated as plasmid pKG-GE4), as shown in SEQ ID NO: 1, is a circular plasmid; its structural diagram is shown below. Figure 2 .

[0130] In SEQ ID NO: 1, nucleotides 5121-5139 form the T7 promoter, nucleotides 5140-5164 encode the Lac operator, nucleotides 5178-5201 form the ribosome binding site (RBS), nucleotides 5209-5271 encode the alkaline phosphatase signal peptide (phoA signal peptide), nucleotides 5272-5598 encode the TrxA protein, nucleotides 5620-5637 encode the His-Tag (also known as the His6 tag), nucleotides 5638-5652 encode the enterokinase cleavage site (EK cleavage site), nucleotides 5656-5670 encode the nuclear localization signal, nucleotides 5701-9801 encode the spCas9 protein, nucleotides 9802-9849 encode the nuclear localization signal, and nucleotides 9902-9949 form the T7 terminator. The nucleotides encoding the spCas9 protein have been codon-optimized for Escherichia coli BL21(DE3) strain.

[0131] The main modifications to plasmid pKG-GE4 are as follows: ① The coding region of the TrxA protein was retained. The TrxA protein can help the expressed target protein form disulfide bonds, increasing the solubility and activity of the target protein. An alkaline phosphatase signal peptide coding sequence was added before the TrxA protein coding region. The alkaline phosphatase signal peptide can guide the expressed target protein to be secreted into the bacterial periplasmic lumen and can be cleaved by prokaryotic periplasmic signal peptidase. ② A His-Tag coding sequence was added after the TrxA protein coding sequence. The His-Tag can be used for... Enrichment of the target protein; ③ Add the coding sequence of the enterokinase cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) downstream of the His-Tag coding sequence. The purified protein will remove His-Tag and the upstream fused TrxA protein under the action of enterokinase; ④ Insert the Cas9 gene of suitable Escherichia coli BL21(DE3) strain with optimized codons, and add nuclear localization signal coding sequences upstream and downstream of this gene to increase the nuclear localization ability of the purified Cas9 protein in the later stage.

[0132] The fusion gene in plasmid pKG-GE4, as shown in nucleotides 5209-9852 of SEQ ID NO: 1, encodes the fusion protein shown in SEQ ID NO: 2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, abbreviated as PRONCN protein). Due to the presence of alkaline phosphatase signal peptide and enterokinase cleavage site, the fusion protein is cleaved by enterokinase to form the protein shown in SEQ ID NO: 3. The protein shown in SEQ ID NO: 3 is named NCN protein.

[0133] II. Induced Expression

[0134] 1. Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria.

[0135] 2. Inoculate the recombinant bacteria obtained in step 1 into liquid LB medium containing 100 μg / ml ampicillin and culture overnight at 37°C with shaking at 200 rpm.

[0136] 3. Inoculate the bacterial culture obtained in step 2 into liquid LB medium and incubate at 30°C with shaking at 230 rpm until OD reaches 100%. 600nm The concentration was set to 1.0, then isopropyl thiogalactoside (IPTG) was added to a concentration of 0.5 mM in the system. The mixture was then cultured at 25°C and 230 rpm for 12 hours with shaking. Finally, the cells were collected by centrifugation at 4°C and 10,000 g for 15 minutes.

[0137] 4. Take the bacterial cells obtained in step 3 and wash them with PBS buffer.

[0138] III. Purification of the fusion protein TrxA-His-EK-NLS-spCas9-NLS

[0139] 1. Take the bacterial cells obtained in step 2, add crude extraction buffer and suspend the bacterial cells, then homogenize the bacterial cells using a homogenizer (3 cycles at 1000 par), then centrifuge at 4℃ and 15000g for 30 min, collect the supernatant, filter the supernatant through a 0.22μm pore size filter membrane, and collect the filtrate. In this step, 10 ml of crude extraction buffer is prepared for every gram of wet bacterial cells.

[0140] Crude extraction buffer: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, 1mM PMSF, with the balance being ddH2O.

[0141] 2. Affinity chromatography was used to purify the fusion protein.

[0142] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then load 50 ml of the filtrate obtained in step 1 (flow rate: 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate: 1 ml / min) to remove contaminating proteins; finally, elute with 10 column volumes of elution buffer at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).

[0143] Ni-NTA agarose column: GenScript, L00250 / L00250-C, 10ml packing material.

[0144] Equilibrium solution: contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, and the balance is ddH2O.

[0145] Buffer solution: containing 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 50 mM Imidazole, with the balance being ddH2O.

[0146] Eluent: Contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, and the balance is ddH2O.

[0147] IV. Enzymatic digestion of the fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein

[0148] 1. Take 15 ml of the post-column solution collected in step 3, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, 15 ml capacity), and then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0). Use 6 ultrafiltration tubes to obtain a total of 6 ml.

[0149] 2. Add the commercially available His6-tagged recombinant bovine enterokinase (Sangon Biotech, C620031, Recombinant Bovine Enterokinase Light Chain, His6-tagged) to the solution obtained in step 1 (approximately 6 ml), and digest at 25°C for 16 hours. Add 2 units of enterokinase per 50 μg of protein.

[0150] 3. Take the solution from step 2 (about 6 ml), mix it with 480 μl of Ni-NTA resin (GenScript, L00250 / L00250-C), mix by rotation at room temperature for 15 min, then centrifuge at 7000 g for 3 min, and collect the supernatant (4-5.5 ml).

[0151] 4. Take the supernatant obtained in step 3 and concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml). Then add it to the enzyme storage solution and adjust the protein concentration to 5 mg / ml to obtain the NCN protein solution.

[0152] Sequencing revealed that the N-terminal 15 amino acid residues in the NCN protein solution are as shown in positions 1 to 15 of SEQ ID NO: 3, which is the NCN protein.

[0153] The NCN protein used in subsequent embodiments was provided by an NCN protein solution.

[0154] Enzyme stock solution (pH 7.4): contains 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% (v / v) glycerol, with the balance being ddH2O.

[0155] Example 2: Performance of NCN protein

[0156] The following two gRNA targets targeting the TTN gene were selected:

[0157] TTN-gRNA1: AGAGCACAGTCAGCCTGGCG;

[0158] TTN-gRNA2: CTTCCAGAATTGGATCTCCG.

[0159] The primers used to identify target fragments containing gRNA from the TTN gene are as follows:

[0160] TTN-F55: TACGGAATTGGGGAGCCAGCGGA;

[0161] TTN-R560: CAAAGTTAACTCTCTGTGTCT.

[0162] I. Preparation of gRNA

[0163] 1. Preparation of TTN-T7-gRNA1 and TTN-T7-gRNA2 transcription templates

[0164] The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 4.

[0165] The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 5.

[0166] 2. Obtain gRNA through in vitro transcription

[0167] Using TTN-T7-gRNA1 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The TTN-gRNA1 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908). TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 6.

[0168] Using TTN-T7-gRNA2 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The TTN-gRNA2 was recovered and purified using the Transcription Clean-Up Kit (Thermo, AM1908). TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 7.

[0169] II. Optimization of the ratio of gRNA to NCN protein

[0170] 1. Co-transfection of porcine primary fibroblasts

[0171] Group 1: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 0.5 μg TTN-gRNA1 : 0.5 μg TTN-gRNA2 : 4 μg NCN protein.

[0172] Group 2: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 0.75 μg TTN-gRNA1 : 0.75 μg TTN-gRNA2 : 4 μg NCN protein.

[0173] Group 3: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg NCN protein.

[0174] Group 4: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 1.25 μg TTN-gRNA1 : 1.25 μg TTN-gRNA2 : 4 μg NCN protein.

[0175] Group 5: TTN-gRNA1 and TTN-gRNA2 were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0176] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0177] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0178] 3. After completing step 2, cells were digested and collected with trypsin, genomic DNA was extracted, and PCR amplification was performed using primers consisting of TTN-F55 and TTN-R560, followed by 1% agarose gel electrophoresis.

[0179] See electrophoresis image Figure 3 The 505bp band is the wild-type band (WT), and the band around 254bp (the wild-type band theoretically has a deletion of 251bp) is the deletion mutation band (MT).

[0180] Gene deletion mutation efficiency = (MT gray level / MT band bp) / (WT gray level / WT band bp + MT gray level / MT band bp) × 100%. The gene deletion mutation efficiency of the first group is 19.9%, the gene deletion mutation efficiency of the second group is 39.9%, the gene deletion mutation efficiency of the third group is 79.9%, and the gene deletion mutation efficiency of the fourth group is 44.3%. No mutation occurred in the fifth group.

[0181] The results showed that the gene editing efficiency was highest when the mass ratio of the two gRNAs to the NCN protein was 1:1:4, and the actual dosage was 1 μg:1 μg:4 μg. Therefore, the optimal dosage of the two gRNAs to the NCN protein was determined to be 1 μg:1 μg:4 μg.

[0182] III. Comparison of gene editing efficiency between NCN protein and commercial Cas9 protein

[0183] 1. Co-transfection of porcine primary fibroblasts

[0184] Cas9-A group: TTN-gRNA1, TTN-gRNA2, and commercial Cas9-A protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg Cas9-A protein.

[0185] pKG-GE4 group: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg NCN protein.

[0186] Cas9-B group: TTN-gRNA1, TTN-gRNA2, and commercial Cas9-B protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts : 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg Cas9-B protein.

[0187] Control group: porcine primary fibroblasts were co-transfected with TTN-gRNA1 and TTN-gRNA2. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2.

[0188] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0189] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0190] 3. After completing step 2, cells were digested and collected with trypsin, genomic DNA was extracted, and PCR amplification was performed using primers consisting of TTN-F55 and TTN-R560, followed by 1% agarose gel electrophoresis.

[0191] See electrophoresis image Figure 4 The gene deletion mutation efficiency using commercial Cas9-A protein was 28.5%, that using NCN protein was 85.6%, and that using commercial Cas9-B protein was 16.6%.

[0192] The results showed that, compared with commercially available Cas9 protein, the NCN protein prepared using this invention significantly improved gene editing efficiency.

[0193] Example 3: Screening for highly efficient gRNA targets of the SPR gene

[0194] Information on the porcine SPR gene: Encoding metoprolol reductase; located on chromosome 3; Gene ID: 100521367, Susscrofa. The amino acid sequence of the protein encoded by the porcine SPR gene is shown in SEQ ID NO: 8. The SPR gene in the porcine genomic DNA has three exons; the first coding exon and its upstream and downstream exons (200 bp each) are shown in SEQ ID NO: 9.

[0195] The plasmid pKG-GE3 is a circular plasmid, as shown in SEQ ID NO: 2 of patent application 202010084343.6. In SEQ ID NO: 2 of patent application 202010084343.6, nucleotides 395-680 form the CMV enhancer, nucleotides 682-890 form the EF1a promoter, nucleotides 986-1006 encode the nuclear localization signal (NLS), nucleotides 1016-1036 encode the nuclear localization signal (NLS), nucleotides 1037-5161 encode the Cas9 protein, nucleotides 5162-5209 encode the nuclear localization signal (NLS), nucleotides 5219-5266 encode the nuclear localization signal (NLS), and nucleotides 5276-5332 encode polypeptide P2A (the amino acid sequence of polypeptide P2A is “ATNFSLLKQAGDVEENPGP”, with the break point at…). Nucleotides 5333-6046 (between the first and second amino acid residues at the C-terminus) encode the EGFP protein, nucleotides 6056-6109 encode polypeptide T2A (the amino acid sequence of polypeptide T2A is “EGRGSLLTCGDVEENPGP”, with the break point between the first and second amino acid residues at the C-terminus), nucleotides 6110-6703 encode the Puromycin protein (abbreviated as Puro protein), nucleotides 6722-7310 form the WPRE sequence element, nucleotides 7382-7615 form the 3'LTR sequence element, and nucleotides 7647-7871 form the bGH poly(A)signal sequence element. In SEQ ID NO: 2 of patent application 202010084343.6, nucleotides 911-6706 form a fusion gene, expressing a fusion protein. Due to the presence of the self-cleaving peptide P2A and the self-cleaving peptide T2A, the fusion protein spontaneously forms the following three proteins: a protein with Cas9 protein, a protein with EGFP protein, and a protein with Puro protein.

[0196] The pKG-U6gRNA vector, or plasmid pKG-U6gRNA, is a circular plasmid, as shown in SEQ ID NO: 3 of patent application 202010084343.6. In SEQ ID NO: 3 of patent application 202010084343.6, nucleotides 2280-2539 form the hU6 promoter, and nucleotides 2558-2637 are used for transcription to form the gRNA backbone. In use, a DNA molecule of approximately 20 bp (the target sequence binding region for gRNA transcription) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid. The recombinant plasmid is then transcribed into gRNA in cells.

[0197] I. Conservation analysis of the pre-defined deletion region of the SPR gene and adjacent genomic sequences

[0198] Eighteen newborn Congjiang Xiang pigs were selected, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10) and 8 males (named A, B, C, D, E, F, G, and H).

[0199] SPR-E1-JDF52:GTCGCAGCAGTTACTCGTC;

[0200] SPR-E1-JDR398: TGTTGAAGAGCAGCACTCGC;

[0201] SPR-E1-JDF30: CCAGACCCCTGACTGGTTTC;

[0202] SPR-E1-JDR530: CCAGGACTTTCAGGCGTCAT.

[0203] Genomic DNA was extracted from ear tissue of pig '1' as a template, and PCR amplification was performed using different primer pairs, followed by 1% agarose gel electrophoresis. See the electrophoresis image below. Figure 5 . Figure 5 In the study, primer pairs were used in four groups: Group 1: SPR-E1-JDF30 and SPR-E1-JDR398; Group 2: SPR-E1-JDF52 and SPR-E1-JDR530; Group 3: SPR-E1-JDF30 and SPR-E1-JDR530; and Group 4: SPR-E1-JDF52 and SPR-E1-JDR398. The results showed that the primer pair using SPR-E1-JDF30 and SPR-E1-JDR530 was preferred for amplifying the target fragment.

[0204] Using genomic DNA from 18 pigs as templates, PCR amplification was performed using primer pairs consisting of SPR-E1-JDF30 and SPR-E1-JDR530, followed by 1% agarose gel electrophoresis. (See electrophoresis image below.) Figure 6 PCR amplification products were recovered and sequenced. The sequencing results were compared with SPR gene sequences in public databases. Conserved regions common to 18 pigs were selected for gRNA target design.

[0205] II. Target Screening

[0206] Several targets were initially screened by NGG (avoiding possible mutation sites), and four targets were further screened out after preliminary experiments.

[0207] The four target points are as follows:

[0208] SPR-E1-gRNA1 target: GCGGGCGGTTAGGACCAACA;

[0209] SPR-E1-gRNA2 target: AGGCCGAGTTGGGCTCCGAG;

[0210] SPR-E1-gRNA3 target: GGAGCCAGGCGACAGCAGCG;

[0211] SPR-E1-gRNA4 target: CGTCCGTCCGAAACCGCGGG.

[0212] III. Preparation of gRNA

[0213] The pKG-U6gRNA plasmid was digested with restriction endonuclease BbsI, and the vector backbone (a large linear fragment of about 3kb) was recovered.

[0214] SPR-E1-gRNA1-S and SPR-E1-gRNA1-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(SPR-E1-gRNA1). Plasmid pKG-U6gRNA(SPR-E1-gRNA1) expresses the sgRNA shown in SEQ ID NO: 10. SPR-E1-gRNA1 sgRNA SPR-E1-gRNA1 (SEQ ID NO: 10):

[0215] GCGGGCGGUUAGGACCAACAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0216] SPR-E1-gRNA2-S and SPR-E1-gRNA2-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(SPR-E1-gRNA2). Plasmid pKG-U6gRNA(SPR-E1-gRNA2) expresses the sgRNA shown in SEQ ID NO: 11. SPR-E1-gRNA2 sgRNA SPR-E1-gRNA2 (SEQ ID NO: 11):

[0217] AGGCCGAGUUGGGCUCCGAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0218] SPR-E1-gRNA3-S and SPR-E1-gRNA3-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(SPR-E1-gRNA3). Plasmid pKG-U6gRNA(SPR-E1-gRNA3) expresses the sgRNA shown in SEQ ID NO: 12. SPR-E1-gRNA3 sgRNA SPR-E1-gRNA3 (SEQ ID NO: 12):

[0219] GGAGCCAGGCGACAGCAGCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0220] SPR-E1-gRNA4-S and SPR-E1-gRNA4-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(SPR-E1-gRNA4). Plasmid pKG-U6gRNA(SPR-E1-gRNA4) expresses the sgRNA shown in SEQ ID NO: 13. SPR-E1-gRNA4 sgRNA SPR-E1-gRNA4 (SEQ ID NO: 13):

[0221] CGUCCGUCCGAAACCGCGGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0222] SPR-E1-gRNA1-S:caccGCGGGCGGTTAGGACCAACA;

[0223] SPR-E1-gRNA1-A:aaacTGTTGGTCCTAACCGCCCGC;

[0224] SPR-E1-gRNA2-S:caccgAGGCCGAGTTGGGCTCCGAG;

[0225] SPR-E1-gRNA2-A:aaacCTCGGAGCCCAACTCGGCCTc;

[0226] SPR-E1-gRNA3-S: caccGGAGCCAGGCGACAGCAGCG;

[0227] SPR-E1-gRNA3-A: aaacCGCTGCTGTCGCCTGGCTCC;

[0228] SPR-E1-gRNA4-S: caccgCGTCCGTCCGAAACCGCGGG;

[0229] SPR-E1-gRNA4-A:aaacCCCGCGGTTTCCGGACGGACGc.

[0230] SPR-E1-gRNA1-S, SPR-E1-gRNA1-A, SPR-E1-gRNA2-S, SPR-E1-gRNA2-A, SPR-E1-gRNA3-S, SPR-E1-gRNA3-A, SPR-E1-gRNA4-S, and SPR-E1-gRNA4-A are all single-stranded DNA molecules.

[0231] IV. Comparison of editing efficiency for different target combinations

[0232] 1. Co-transfection

[0233] Group 1: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (SPR-E1-gRNA1) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (SPR-E1-gRNA1): 1.08 μg plasmid pKG-GE3.

[0234] Group 2: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (SPR-E1-gRNA2) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (SPR-E1-gRNA2): 1.08 μg of plasmid pKG-GE3.

[0235] Group 3: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (SPR-E1-gRNA3) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (SPR-E1-gRNA3): 1.08 μg of plasmid pKG-GE3.

[0236] Group 4: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (SPR-E1-gRNA4) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (SPR-E1-gRNA4): 1.08 μg plasmid pKG-GE3.

[0237] Group 5: Primary porcine fibroblasts were electroporated without plasmids using the same electroporation parameters.

[0238] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0239] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0240] 3. After completing step 2, cells were digested and collected using trypsin, lysed, and genomic DNA was extracted. PCR amplification was performed using primer pairs consisting of SPR-E1-JDF30 and SPR-E1-JDR530, followed by 1% agarose gel electrophoresis. The mutation status of target genes in the cells was detected.

[0241] After the target product was gel-extracted and recovered, it was sent to a sequencing company for sequencing. The sequencing results were then analyzed using the web-based Synthego ICE tool to determine the gene editing efficiency of different target sites. The gene editing efficiencies of the first, third, and fourth groups were 47%, 1%, and 46%, respectively. Sequencing failed in the second group, and no gene editing occurred in the fifth group. The results indicate that SPR-E1-gRNA1 and SPR-E1-gRNA4 have high editing efficiencies.

[0242] Example 4: Preparation of a single-cell clone of Congjiang Xiang pig with SPR gene knockout

[0243] Two highly efficient gRNA targets (SPR-E1-gRNA1 and SPR-E1-gRNA4) selected from Example 3 were chosen.

[0244] I. Preparation of gRNA

[0245] 1. Preparation of SPR-T7-gRNA1 and SPR-T7-gRNA4 transcription templates

[0246] The SPR-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 14.

[0247] The SPR-T7-gRNA4 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 15.

[0248] 2. Obtain gRNA through in vitro transcription

[0249] Using SPR-T7-gRNA1 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The SPR-gRNA1 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908). SPR-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 16.

[0250] Using SPR-T7-gRNA4 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The SPR-gRNA4 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908). SPR-gRNA4 is a single-stranded RNA, as shown in SEQ ID NO: 17.

[0251] SPR-gRNA1 (SEQ ID NO: 16):

[0252] GGGCGGGCGGUUAGGACCAACAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU

[0253] SPR-gRNA4 (SEQ ID NO: 17):

[0254] GGCGUCCGUCCGAAACCGCGGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU

[0255] II. Transfection of porcine primary fibroblasts

[0256] 1. Co-transfect porcine primary fibroblasts with SPR-gRNA1, SPR-gRNA4, and NCN protein. The ratio was approximately 100,000 porcine primary fibroblasts: 1 μg SPR-gRNA1 : 1 μg SPR-gRNA4 : 4 μg NCN protein. Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0257] 2. After completing step 1, incubate in complete culture medium for 16-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0258] 3. After completing step 2, digest and collect cells with trypsin, wash with complete culture medium, resuspend in complete culture medium, and then pick each single clone and transfer it to a 96-well plate (1 cell per well, 100 μl of complete culture medium per well) and culture for 2 weeks (replace with fresh complete culture medium every 2-3 days).

[0259] 4. After completing step 3, digest the cells with trypsin and collect them (about 2 / 3 of the cells obtained from each well are seeded into a 6-well plate containing complete culture medium, and the remaining 1 / 3 are collected in a 1.5 mL centrifuge tube).

[0260] 5. Take the 6-well plate from step 4, culture until the cells reach 80% confluence, digest with trypsin and collect the cells, and freeze the cells using cell cryopreservation solution (90% complete culture medium + 10% DMSO, volume ratio).

[0261] 6. Take the centrifuge tube from step 4, collect the cells, lyse the cells and extract genomic DNA. Perform PCR amplification using primer pairs consisting of SPR-E1-JDF30 and SPR-E1-JDR530, followed by electrophoresis. Use porcine primary fibroblasts as wild-type controls (WT).

[0262] 7. After completing step 6, recover the PCR amplification products and sequence them.

[0263] If a single-cell clone has only one sequencing result, its genotype is wild-type (also known as homozygous wild-type). If a single-cell clone has two sequencing results, one consistent with the sequencing result of a primary porcine fibroblast and the other showing a mutation (including deletion, insertion, or substitution of one or more nucleotides), the genotype of that single-cell clone is heterozygous. If a single-cell clone has two sequencing results, both showing mutations (including deletion, insertion, or substitution of one or more nucleotides) compared to the sequencing result of a primary porcine fibroblast, the genotype of that single-cell clone is biallelic mutant. If a single-cell clone has only one sequencing result and shows a mutation (including deletion, insertion, or substitution of one or more nucleotides) compared to the sequencing result of a primary porcine fibroblast, the genotype of that single-cell clone is biallelic mutant. If a single-cell clone has only one sequencing result and is consistent with the sequencing result of a primary porcine fibroblast, the genotype of that single-cell clone is wild-type (also known as homozygous wild-type).

[0264] The results are shown in Table 1. Single-cell clones numbered 2, 4, and 31 had wild-type genotypes. Single-cell clones numbered 13, 15, 16, 18, 21, 25, 27, and 30 had heterozygous genotypes. Single-cell clones numbered 3, 5, 6, 7, 11, 12, 14, 17, 19, 23, 24, 29, 32, and 33 had biallelic mutant genotypes. Single-cell clones numbered 1, 8, 9, 10, 20, 22, 26, and 28 had biallelic mutant genotypes. The success rate of obtaining SPR gene-editing single-cell clones was 90.9%.

[0265] Example sequencing alignment results can be found in Figures 7 to 10 . Figure 7 The reverse sequencing results of single-cell clone number 2 were compared with the wild-type sequence, and it was determined to be wild-type. Figure 8 The results of forward and reverse sequencing of single-cell clone number 15 were compared with the wild-type sequence, and it was determined to be heterozygous. Figure 9 The results are the reverse sequencing results of single-cell clone number 5 and the wild-type sequence, showing different mutant types of biallelic genes. Figure 10 The results are from the forward sequencing of single-cell clone number 1 and the comparison of the wild-type sequence, indicating a biallelic mutant.

[0266] Table 1. Genotyping results of SPR gene-edited single-cell clones

[0267]

[0268]

[0269]

[0270] The aforementioned heterozygous, biale-identical mutant, and biale-different mutant single-cell clones are all target single-cell clones. Using these cells as nuclear transfer donor cells for somatic cell cloning yields cloned pigs, which are metoprolol reductase deficiency model pigs.

[0271] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A kit comprising SPR-gRNA1, SPR-gRNA4 and NCN protein; The SPR-gRNA1 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 16; the SPR-gRNA4 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 17; the NCN protein is shown as in SEQ ID NO: 3; The kit is used to prepare recombinant cells.

2. The kit according to claim 1, characterized in that: The method for preparing the NCN protein includes the following steps: (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria; (2) The recombinant bacteria were cultured in liquid culture medium at 30°C, then IPTG was added and the culture was induced at 25°C, and then the bacterial cells were collected; (3) The collected bacterial cells were broken down to collect the crude protein solution; (4) The His6-tagged fusion protein was purified from the crude protein solution by affinity chromatography; (5) The His6-tagged fusion protein was digested with His6-tagged enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein. The plasmid pKG-GE4 contains the fusion gene shown in nucleotides 5209-9852 of SEQ ID NO:

1.

3. Application of SPR-gRNA1, SPR-gRNA4 and NCN proteins in the preparation of the kit; SPR-gRNA1 is the SPR-gRNA1 described in claim 1; SPR-gRNA4 is the SPR-gRNA4 described in claim 1; NCN protein is the NCN protein described in claim 1; The kit is used to prepare recombinant cells.

4. The application as described in claim 3, characterized in that: The method for preparing the NCN protein includes the following steps: (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria; (2) The recombinant bacteria were cultured in liquid culture medium at 30°C, then IPTG was added and the culture was induced at 25°C, and then the bacterial cells were collected; (3) The collected bacterial cells were broken down to collect the crude protein solution; (4) The His6-tagged fusion protein was purified from the crude protein solution by affinity chromatography; (5) The His6-tagged fusion protein was digested with His6-tagged enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein. The plasmid pKG-GE4 contains the fusion gene shown in nucleotides 5209-9852 of SEQ ID NO:

1.

5. A method for preparing recombinant cells, comprising the following steps: co-transfecting porcine cells with SPR-gRNA1, SPR-gRNA4 and NCN protein to obtain recombinant cells; SPR-gRNA1 is the SPR-gRNA1 described in claim 1; SPR-gRNA4 is the SPR-gRNA4 described in claim 1; and NCN protein is the NCN protein described in claim 1.

6. The method as described in claim 5, characterized in that: The method for preparing the NCN protein includes the following steps: (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria; (2) The recombinant bacteria were cultured in liquid culture medium at 30°C, then IPTG was added and the culture was induced at 25°C, and then the bacterial cells were collected; (3) The collected bacterial cells were broken down to collect the crude protein solution; (4) The His6-tagged fusion protein was purified from the crude protein solution by affinity chromatography; (5) The His6-tagged fusion protein was digested with His6-tagged enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein. The plasmid pKG-GE4 contains the fusion gene shown in nucleotides 5209-9852 of SEQ ID NO: 1.