Universal adaptor primer for amplifying 5' end of cDNA and 5' rca method

By inserting deoxyxanthine (I) into the adapter primer and optimizing the reverse transcription process, combined with two rounds of nested PCR, the complexity and non-specific amplification problems of existing 5'RACE methods are solved, achieving efficient and simple cDNA 5' end amplification, which is particularly suitable for amplifying unknown fragments of multiple genes.

CN115976173BActive Publication Date: 2026-05-19SANGON BIOTECH (SHANGHAI) CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211650038.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-21
Publication Date
2026-05-19
Estimated Expiration
2042-12-21

AI Technical Summary

Technical Problem

Existing 5'RACE experimental methods suffer from problems such as complex operation, numerous non-specific amplification products, long amplification cycles, and inability to cover the complete information at the 5' end of the target gene coding region.

Method used

A universal adapter primer and 5' RACE method for amplifying the 5' end of cDNA are provided. The reverse transcription process is optimized by inserting deoxyxanthine (I) into the adapter primer, and the operation steps are simplified by using a premixed PCR reaction system. The amplification efficiency is improved by combining two rounds of nested PCR.

Benefits of technology

It significantly reduces non-specific amplification bands, increases the target product, simplifies experimental steps, shortens the amplification cycle, improves the cloning efficiency of unknown fragments, and obtains complete 5' end sequence information of the coding region.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115976173B_ABST
    Figure CN115976173B_ABST
Patent Text Reader

Abstract

The application discloses a universal adapter primer for amplifying the 5' end of cDNA and a 5' RACE method, and relates to the technical field of cDNA end amplification. The adapter primer sequence provided by the application can obviously reduce non-specific amplification bands after amplifying the 5' end of cDNA, and more target products are obtained. The kit and the 5' RACE method provided by the application are simple to operate, especially, the pre-mixed PCR reaction system can obviously reduce experimental operation steps and greatly shorten the cDNA amplification period. The 5' RACE method provided by the application has high cloning efficiency for unknown fragments. Through two rounds of PCR and several simple steps, the amplification of the 5' end unknown sequence can be completed, and complete 5' end sequence information of a coding region is obtained.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the technical field of cDNA end amplification, and more specifically, to a universal adapter primer and 5'RACE method for amplifying the 5' end of cDNA. Background Technology

[0002] RACE (rapid-amplification of cDNA ends) is a molecular biology technique for rapidly cloning the 3' or 5' ends of target mRNA to obtain the full-length mRNA. RACE technology, with its unique advantages, has been applied in multiple fields, such as cDNA library construction, target gene cloning, viral genome function research, and the development of new expressed sequence tags (ESTs). With the development of molecular biology techniques, scientists have combined other different molecular biology techniques to improve the original RACE technique, thus enriching the types of RACE techniques. Currently used RACE techniques include: classic RACE, adapter-ligated RACE, RLM RACE, capswitching RACE, circular RACE, and T-RACE.

[0003] The basic principle of 5'RACE: 5'RACE is a technique for amplifying the unknown 5' end of a gene. This invention first utilizes a specific sequence in mRNA as a binding site, and synthesizes first-strand cDNA using specific reverse transcription primers under the action of reverse transcriptase. Under the action of TdT enzyme, (dC) residues are added. After annealing, the (dC) residues pair with a universal adapter primer (5' adapter Primer) containing an oligonucleotide sequence. Using a specific primer R1 as the downstream primer and the first-strand cDNA as a template, the first round of PCR amplification is performed. Then, a universal primer (5'RACE Outer Primer) containing a partial adapter sequence is used as the upstream primer, and another specific primer R2 is used as the downstream primer to amplify the cDNA fragment at the 5' end of the target gene.

[0004] There are currently three commonly used 5'RACE experimental methods: adapter ligation, oligo capping, and terminal deoxynucleotidyl transferase (TdT) method.

[0005] The adapter ligation method is exemplified by the SMARTer RACE cDNA Amplification Kit (Clontech Code: 634923). The principle of this method is to first utilize the poly(A) tail at the 3' end of the mRNA as the binding site for the reverse transcription primer. Using Oligo(dT) as the reverse transcription primer, first-strand cDNA is synthesized under the action of reverse transcriptase. This reverse transcriptase has terminal transferase activity, automatically adding 3-5 (dC) residues at the 5' end during reverse transcription. After annealing, the (dC) residues pair with the Oligo(dG) universal adapter primer (5' adapter primer) containing the oligonucleotide sequence for PCR amplification, amplifying the cDNA fragment at the 5' end of the target gene. The advantages of this method are its simplicity; a single reverse transcription can obtain the entire gene template for 5' RACE experiments of multiple genes; and, provided the RNA quality is high, a high proportion of full-length molecules are obtained. The first-strand synthesis and tailing of cDNA are completed in one step, minimizing the risk of mRNA degradation. The disadvantage of this method is that the reverse transcription has low specificity and cannot accurately obtain the gene of interest, often presenting continuous blurry bands or short product background.

[0006] The decapping method is represented by the 5'-full RACE Kit (TaKaRa Code: D315). The principle of this method is to first utilize the 5' cap structure of mRNA to specifically amplify the full-length gene. Degraded mRNA has a phosphate group at its 5' end, which is removed using alkaline phosphatase. Then, tobacco acid pyrophosphatase is used to remove the cap structure, exposing the phosphate group at the 5' end of the mRNA molecule. In the subsequent ligation step, the anchoring primer 5' Outer Primer specifically adds to the 5' end of the mRNA molecule without ligating with the degraded mRNA. The advantages of this method are a high proportion of full-length molecules and less non-specific PCR products. The disadvantages are the complexity of the experimental procedure, the need to manipulate the mRNA molecule, the increased risk of mRNA degradation, and the potential for experimental failure and failure to obtain the target band for genes with complex 5' end structures or numerous secondary structures.

[0007] Terminal transferase (TLT) methods are exemplified by the 5' RACE System for Rapid Amplification of cDNA Ends (Invitrogen Code: 18374-058). The principle of this method is to use gene-specific reverse transcription primers to synthesize the first-strand cDNA under the action of reverse transcriptase. After degrading and purifying the RNA in the RNA-DNA hybrid strand, a poly(C) tail is added to the 3' end of the cDNA strand under the action of TLT. Then, nested PCR is used to amplify the target gene using both 5' adapter primers and gene-specific primers. The advantages of this method are its affordability, the lack of special equipment required, and its ability to be performed in a laboratory setting. It typically only requires designing one or two specific reverse transcription primers and two specific gene amplification primers. The use of specific reverse transcription primers significantly improves the success rate of target gene amplification. Currently, the TLT method suffers from several drawbacks: numerous operational steps, long amplification cycle, and a large amount of non-specific amplification products. Furthermore, because the amplification products often fail to cover the complete information at the 5' end of the target gene coding region, the RACE process often needs to be repeated.

[0008] In view of this, the present invention is proposed. Summary of the Invention

[0009] The purpose of this invention is to provide a universal adapter primer and a 5'RACE method for amplifying the 5' end of cDNA to solve the above-mentioned technical problems.

[0010] This invention is implemented as follows:

[0011] In a first aspect, the present invention provides a universal adapter primer for amplifying the 5' end of cDNA, wherein the 5' end adapter primer sequence is: GCTGTCAACGATACGCTACGTAACGGCATGACAGTGIIGGIIGGII GGIIG (SEQ ID NO.1), and the universal adapter primer is paired with a template of a single-stranded cDNA fragment with poly(C) added to the 3' end.

[0012] The inventors have provided a novel universal adapter primer suitable for amplifying the 5' ends of cDNA from multiple species. Compared to existing adapter primers, the improved primer inserts two deoxyinosine (I) residues between the guanine (G) residues, increasing the length of the synthesized adapter sequence. The deoxyinosine (I) residues are complementary to all four bases, but exhibit different affinities for different bases. The stability order from highest to lowest is: I:C > I:A > I:T > I:G. The selective insertion of deoxyinosine (I) residues at the 3' end of the universal adapter primer maintains the low stability of the 3' end and ensures that the Tm value of the primer anchoring region is above 65°C. This improves the specificity of the universal adapter primer to the oligo d (C) end of cDNA and reduces non-specific amplification of C-rich sequences within the cDNA. In some embodiments, the Tm of the universal adapter primer can be set to match that of the amplification-specific primers (nested PCR primer set), facilitating the design of PCR amplification programs.

[0013] The inventors discovered that the adapter primer sequence provided by this invention significantly reduced non-specific amplification bands and increased the amount of target product after amplification of the 5' end of cDNA, indicating a significant optimization effect.

[0014] Secondly, the present invention provides a kit for amplifying the 5' end of cDNA, the kit comprising the aforementioned universal adapter primers for amplifying the 5' end of cDNA.

[0015] Based on the terminal transferase method, the inventors shortened the original steps for amplifying cDNA ends, optimized the reverse transcription process and adapter primers, thereby improving the success rate of experiments.

[0016] In a preferred embodiment of the present invention, the kit further includes an anchoring primer for amplifying the 5' end of cDNA, the sequence of which is: GCTTCAACGATACGCTACGTAAC (SEQ ID NO.2).

[0017] In a preferred embodiment of the present invention, the kit further includes reverse transcriptase, reverse transcription primers, and a nested primer set;

[0018] In one alternative implementation, the nested primer set includes a first nested primer and a second nested primer, wherein the first nested primer is used in combination with a universal adapter primer for a first round of nested PCR, and the second nested primer is used in combination with an anchoring primer for a second round of nested PCR.

[0019] In one optional embodiment, the primer sequences of the first and second nested primers are 23-28 nt in length, and the positions of the first and second nested primers are greater than 20 nt. The primer sequence length of the first nested primer is 23-28 nt, for example, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, or 28 nt. The primer sequence length of the second nested primer is also 23-28 nt, for example, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, or 28 nt. Using primers longer than 30 nt increases primer synthesis costs, and overlapping fragments in the primers lead to an increase in non-specific amplification products.

[0020] In one alternative implementation, the primers should have a GC content of 50-70% and a Tm value higher than 65°C. Primers with an annealing temperature higher than 70°C generally exhibit more stable amplification in RACE.

[0021] In one alternative implementation, the Tm value difference between the first nested primer and the second nested primer is less than 1°C. This setting helps maintain high amplification efficiency.

[0022] The reverse transcriptase is M-MLV reverse transcriptase, HIV-1 reverse transcriptase, AMV reverse transcriptase, or telomerase reverse transcriptase with reduced or removed RNase activity.

[0023] In a preferred embodiment of the present invention, the RNA template is selected from: mRNA, non-coding RNA, miRNA, siRNA, piRNA, lncRNA, or ribosomal RNA.

[0024] In one alternative implementation, the RNA template is selected from miRNA.

[0025] In a preferred embodiment of the present invention, the above-mentioned kit further includes a reaction buffer; the reaction buffer comprises 1-1.1M potassium dimethylarsinate, 1-1.1M KCl, 200-205mM Tris-HCl, 78-80mM MgCl2, 10-12mM MDT, 5-6mM CoCl2, and 0.05%-0.06% (v / v) Triton X-100, wherein the pH of the Tris-HCl is 7.8-8.0.

[0026] The kit and 5'RACE method provided by this invention are simple to operate, and the pre-mixing of the PCR reaction system significantly reduces experimental steps and greatly shortens the cDNA amplification cycle. The inventors have specifically provided a reaction buffer that can simultaneously satisfy the reverse transcription amplification reaction, RNase H digestion, and tailing reaction, allowing all three processes to be completed within the same reaction buffer.

[0027] Thirdly, the present invention also provides a 5'RACE method for obtaining a complete 5' end sequence using the above-described kit or the universal adapter primer for amplifying the 5' end of cDNA according to claim 1. The schematic diagram of this method is shown below. Figure 1 As shown, the method includes the following steps:

[0028] A single-stranded cDNA fragment with poly(C) appended to the 3' end was amplified using a universal adapter primer at the 5' end to obtain a 5' end RACE product.

[0029] In a preferred embodiment of the present invention, the 5'RACE method described above includes the following steps:

[0030] Reverse transcription: The target gene is reverse transcribed using reverse transcription primers and reverse transcriptase to obtain the first-strand cDNA fragment;

[0031] RNA degradation reaction;

[0032] Add poly(C) to the 3' end;

[0033] First round of nested PCR: The first round of nested PCR was performed using universal adapter primers and first nested primers;

[0034] Second round of nested PCR: Second round of nested PCR was performed using the second nested primers and anchoring primers.

[0035] The 5'RACE method provided by this invention has high cloning efficiency for unknown fragments. Through two rounds of PCR and a few simple steps, the amplification of the unknown 5' end sequence can be completed, obtaining complete 5' end sequence information of the coding region. It is particularly suitable for amplifying unknown 5' end fragments of multiple genes. Because the 5'RACE adapter primers are universal and the nested PCR primers are flexibly designed and matched, PCR conditions are also easy to screen and obtain; moreover, the amplification product includes complete 5' end information of the target gene coding region, eliminating the need for repeated RACE processes.

[0036] In a preferred embodiment of the present invention, the amplification program for the first round of nested PCR includes: pre-denaturation at 94°C for 1 min; denaturation at 94°C for 30 s, annealing at 70°C for 30 s, extension at 72°C for 120 s, with the annealing temperature decreasing by 1°C per cycle, for a total of 10 cycles (this is the landing PCR amplification stage); denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 120 s, for a total of 25 cycles, with the extension at 72°C for 1-5 min (this is the specific amplification stage).

[0037] In a preferred embodiment of the present invention, the amplification program for the second round of nested PCR includes: pre-denaturation at 94°C for 1 min; denaturation at 94°C for 30 s, annealing at 70°C for 30 s, extension at 72°C for 120 s, with the annealing temperature decreasing by 1°C per cycle, for a total of 10 cycles (this is the landing PCR amplification stage); denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 120 s, for a total of 25 cycles, with the extension at 72°C for 1-5 min (this is the specific amplification stage).

[0038] Fourthly, the present invention also provides the application of the above-described kit or the above-described universal adapter primers for amplifying the 5' end of cDNA in amplifying cDNA.

[0039] The present invention has the following beneficial effects:

[0040] This invention provides a novel universal adapter primer suitable for amplifying the 5' ends of cDNA from multiple species. Compared to existing adapter primers, the improved universal adapter primer inserts two deoxyinosine (I) residues between the guanine (G) residues, increasing the length of the synthesized adapter sequence. Deoxyinosine (I) is complementary to all four bases, but it has different affinities for different bases. The stability order from highest to lowest is as follows: I:C > I:A > I:T > I:G. The selective insertion of deoxyinosine (I) residues at the 3' end of the universal adapter primer maintains the low stability of the 3' end and ensures that the Tm value of the primer anchoring region is above 65°C. This improves the specificity of the universal adapter primer to the oligo d (C) end of cDNA and reduces non-specific amplification of C-rich sequences within the cDNA. Therefore, the adapter primer sequence provided by this invention significantly reduces non-specific amplification bands and yields more target products after amplifying the 5' end of cDNA.

[0041] The kit and 5'RACE method provided by this invention are simple to operate, especially by pre-mixing the PCR reaction system, which significantly reduces the number of experimental steps and greatly shortens the cDNA amplification cycle. Furthermore, the inventors have provided a reaction buffer that can simultaneously perform reverse transcription amplification, RNase H digestion, and tailing reactions, allowing all three processes to be completed within the same reaction buffer.

[0042] The 5'RACE method provided by this invention has high cloning efficiency for unknown fragments. Through two rounds of PCR and a few simple steps, the amplification of the unknown 5' end sequence can be completed, obtaining complete 5' end sequence information of the coding region. It is particularly suitable for amplifying unknown 5' end fragments of multiple genes. Because the 5'RACE adapter primers are universal and the nested PCR primers are flexibly designed and matched, PCR conditions are also easy to screen and obtain; moreover, the amplification product includes complete 5' end information of the target gene coding region, eliminating the need for repeated RACE processes. Attached Figure Description

[0043] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0044] Figure 1 This is a schematic diagram of the 5'RACE experimental method of the present invention;

[0045] Figure 2 The image shown in Example 1 is an electrophoresis result of PCR amplification products using 5' Outer Primer and H-R2 as primers. Lane "M" is the marker, "1" is the electrophoresis image of the amplification products after amplification using the control kit, and lane "2" is the electrophoresis image of the amplification products after PCR amplification using 5' Outer Primer and H-R2 as primers.

[0046] Figure 3 This is a diagram showing the NCBI alignment results of the amplified human GAPDH gene sequence;

[0047] Figure 4 The image shown in Example 2 is an electrophoresis result of PCR amplification products using 5' Outer Primer and RC927-NR2 as primers. Lane "M" is the marker, "1" is the electrophoresis image of the amplification products after amplification using the control kit, and lane "2" is the electrophoresis image of the amplification products after PCR amplification using 5' Outer Primer and RC927-NR2 as primers.

[0048] Figure 5 The sequencing sequences are those of the positive clones in Examples 1 and 2. Detailed Implementation

[0049] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0050] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0051] Example 1

[0052] This example is based on the human GAPDH gene, and uses the 5'RACE System for Rapid Amplification of cDNA Ends (Invitrogen Code: 18374-058) kit as a control experiment (operated according to the instructions). The specific steps are as follows:

[0053] 1.1 Template preparation:

[0054] HeLa cells were harvested, and total RNA was extracted using the TRIzol method. The control kit used the same RNA sample as this protocol.

[0055] 1.2 Synthesis of Primers

[0056] The 5' adapter primer sequence is as follows:

[0057] GCTGTCAACGATACGGCTACGTAACGGCATGACAGTGIIGGII GGIIGGIIG (SEQ ID NO. 1);

[0058] The adapter primers for the control kit are:

[0059] GCTGTCAACGATACGGCTACGTAACGGCATGACAGTGGGIIG GGIIGGGIIG (SEQ ID NO. 3);

[0060] Anchoring primer 5' RACE Outer Primer: GCGTGTCAACGATACGCTACGTAAC (SEQ ID NO.2);

[0061] The reverse transcription primers 5'RACE RT Primer1: AGGGGTGCTAAGCAGTTGGT (SEQ ID NO.4) and 5'RACE RT Primer2: ATGAGTCCTTCCACGATACCAA (SEQ ID NO.5);

[0062] Nested primer H-R1: CAGCAGAGGGGGCAGAGATGATGA (SEQ ID NO.6);

[0063] Nested primer H-R2: CATGGTGGTGAAGACGCCAGTGGA (SEQ ID NO.7).

[0064] 1.3 Synthesis of cDNA

[0065] The kit used was the Maxima H Minus First-Strand cDNA Synthesis Kit (containing dsDNase) (Thermo Scientific Code: K1681). 1 μg of total RNA and reverse transcription primers (5'RACE RT Primer 1 10 μM 0.5 μL and 5'RACE RT Primer 2 10 μM 0.5 μL) were added to the reaction system to complete reverse transcription PCR and obtain the first-strand cDNA.

[0066] 1.4 Digest excess mRNA with RNase H (Thermo Scientific Code: EN0201). Add 1 μL RNase H, 1 μL 100 μM dCTP solution, 10 μL 5× Buffer, and 16 μL RNase-free water to the first-strand cDNA. 5× Buffer: 1M potassium cacodylate, 1M KCl, 200mM Tris-HCl (pH 7.8), 80mM MgCl2, 10mM DTT, 5mM CoCl2, 0.05% (v / v) Triton X-100.

[0067] 1.5 Place the reaction system prepared in step 1.4 into a PCR instrument, incubate at 37°C for 20 minutes, incubate at 94°C for 3 minutes, and then incubate on ice for 5 minutes.

[0068] 1.6-Terminal deoxynucleotidyl transferase adds a poly(C) tail to the 3' end of cDNA, then adds 2 μL of terminal deoxynucleotidyl transferase TdT (Thermo Scientific Code: EP0161), incubates at 37°C for 15 minutes, reacts at 70°C for 10 minutes, and stores at -20°C for later use.

[0069] 1.7 First round of PCR amplification:

[0070] The first round of PCR amplification reaction is divided into two parts: a. the landing PCR amplification stage, in which the annealing temperature starts at 70℃ and decreases by 1℃ for each cycle, for a total of 10 cycles; b. the specific amplification stage, in which the annealing temperature is 60℃, for a total of 25 cycles.

[0071] The reaction mixture consisted of: 0.5 μL cDNA from step 1.6, 0.5 μL 5' adapter primer (10 μM), 0.5 μL H-R1 (10 μM), 0.2 μL TaKaRa LA Taq (5 U / μL), 10 μL 2×GC Buffer I, 3.2 μL dNTP Mixture (2.5 mMeach), and RNase-free water to a final volume of 20 μL. The amplification kit was TaKaRa LA Taq with GC Buffer (TaKaRa Code: RR02AG).

[0072] The amplification program was as follows: 94℃ pre-denaturation for 1 min; 94℃ denaturation for 30 s, 70℃ annealing for 30 s, 72℃ extension for 120 s, with the annealing temperature decreasing by 1℃ per cycle for a total of 10 cycles; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 120 s for a total of 25 cycles, with a 72℃ extension for 5 min.

[0073] 1.8 Second round of PCR amplification:

[0074] Dilute the PCR product obtained in step 1.7 100 times as a template.

[0075] The reaction mixture consisted of: 0.5 μL of the PCR product from step 1.7, 0.5 μL of 5' Outer Primer (10 μM), 0.5 μL of H-R2 (10 μM), 0.2 μL of TaKaRa LA Taq (5 U / μL), 10 μL of 2×GC Buffer I, 3.2 μL of dNTP Mixture (2.5 mMeach), and RNase-free water to a final volume of 20 μL. The amplification kit used was TaKaRa LA Taq with GC Buffer (TaKaRa Code: RR02AG).

[0076] The amplification program was as follows: 94℃ pre-denaturation for 1 min; 94℃ denaturation for 30 s, 70℃ annealing for 30 s, 72℃ extension for 120 s, with the annealing temperature decreasing by 1℃ per cycle for a total of 10 cycles; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 120 s for a total of 25 cycles, with a 72℃ extension for 5 min.

[0077] The amplification steps for the control kit are as follows: pre-denaturation at 94℃ for 1 min; denaturation at 94℃ for 30 s, annealing at 55℃ for 60 s, extension at 72℃ for 120 s, for a total of 35 cycles, followed by a final extension at 72℃ for 5 min.

[0078] 1.9 The PCR products from step 1.8 were analyzed by agarose gel electrophoresis. The electrophoresis diagram is shown below. Figure 2 The target band is located between 300-400 bp. The target band in the control kit is marked as 1, the target band in this example is marked as 2, and the marker (Sangon Biotech Code: B500347-0050) is marked as M.

[0079] The results showed that the optimized universal adapter primer sequence of this invention significantly reduced non-specific amplification bands and increased the amount of target product after amplification, indicating a significant optimization effect. Furthermore, the control kit requires purification and tailing after digestion, a process that takes 30 minutes, while this invention completes digestion and tailing in one step, eliminating the purification step and simplifying the process.

[0080] 1.10 Recovery of PCR Products

[0081] Add the PCR product from step 1.9 of this embodiment to 100 μL of isopropanol and 300 μL of Buffer B2, mix and then add to a purification column, and follow the procedure of the SanPrep DNA Gel Extraction Kit (Sangon Biotech Code: B518131-0050).

[0082] 1.11 Connection Conversion

[0083] Use pMD TM The 18-T Vector Cloning Kit (TaKaRa Code: 6011) was used for ligation transformation. White colonies were selected, and the length of the inserted fragment in the vector was confirmed by PCR.

[0084] Colony PCR identification primers:

[0085] PUC-M13F:acatttcgtaaaacgacggc

[0086] PUC-M13R:tatggaaaaacgccagcaac

[0087] PCR products with the correct target band size were sequenced for verification.

[0088] (Note: The sequencing primers for this positive clone are also PUC-M13F and PUC-M13R)

[0089] See the sequenced sequence. Figure 5 Sequence 1 is shown.

[0090] According to NCBI comparison, see Figure 3 The amplified sequence was the human GAPDH gene, with 100% sequence identity, indicating successful 5'RACE amplification.

[0091] Example 2

[0092] This example uses the LRK41830 gene of black pine and employs the 5'RACE System for Rapid Amplification of cDNA Ends (Invitrogen Code: 18374-058) kit as a control experiment (following the instructions). The specific steps are as follows:

[0093] 2.1 Template preparation:

[0094] Total RNA was extracted from black pine needles using the TRIzol method. The control kit used the same RNA sample as this protocol.

[0095] 2.2 Synthesis of Primers

[0096] The 5' adapter primer sequence is as follows:

[0097] GCTGTCAACGATACGCTACGTAACGGCATGACAGTGIIGGII GGIIGGIIG(SEQ ID NO.1)

[0098] The anchoring primer 5' RACE Outer Primer is: GCGTGTCAACGATACGCTACGTAAC (SEQ ID NO.2)

[0099] The reverse transcription primers RC927-NRT1 GTCTCTTGACAATTCACAGGCTG (SEQ ID NO.8) and

[0100] RC927-NRT2 CACTTGGAGGAAGTTCTGTGGTAT(SEQ IDNO.9)

[0101] Nested primer RC927-NR1 CAGCAATCTGCCAGAGCTAACC (SEQ ID NO.10)

[0102] Nested primers RC927-NR2 TTTATCTGAGACCGCTACGTTTCC (SEQ ID NO.11)

[0103] 2.3 Synthesis of cDNA

[0104] The kit used was the Maxima H Minus First-Strand cDNA Synthesis Kit (containing dsDNase) (Thermo Scientific Code: K1681). 1 μg of total RNA and reverse transcription primers (RC927-NRT1 10 μM 0.5 μL and RC927-NRT2 10 μM 0.5 μL) were added to the reaction system to complete reverse transcription PCR and obtain the first-strand cDNA.

[0105] 2.4 Digest excess mRNA with RNase H (Thermo Scientific Code: EN0201). Add 1 μL RNase H, 1 μL 100 μM dCTP solution, 10 μL 5× Buffer, and 16 μL RNase-free water to the first-strand cDNA. 5× Buffer: 1M potassium cacodylate, 1M KCl, 200mM Tris-HCl (pH 7.8), 80mM MgCl2, 10mM DTT, 5mM CoCl2, 0.05% (v / v) Triton X-100.

[0106] 2.5 Place the reaction system prepared in step 2.4 into a PCR instrument, incubate at 37°C for 20 minutes, incubate at 94°C for 3 minutes, and then incubate on ice for 5 minutes.

[0107] 2.6 Terminal deoxynucleotidyl transferase adds a poly(C) tail to the 3' end of cDNA, then adds 2 μL of terminal deoxynucleotidyl transferase TdT (Thermo Scientific Code: EP0161), incubates at 37°C for 15 minutes, reacts at 70°C for 10 minutes, and stores at -20°C for later use.

[0108] 2.7 First round of PCR amplification:

[0109] The first round of PCR amplification reaction is divided into two parts: a. the landing PCR amplification stage, in which the annealing temperature starts at 70℃ and decreases by 1℃ for each cycle, for a total of 10 cycles; b. the specific amplification stage, in which the annealing temperature is 60℃, for a total of 25 cycles.

[0110] The reaction mixture consisted of: 0.5 μL cDNA from step 2.6, 0.5 μL 5' adapter primer (10 μM), 0.5 μL RC927-NR1 (10 μM), 0.2 μL TaKaRa LA Taq (5 U / μL), 10 μL 2×GC Buffer I, 3.2 μL dNTP Mixture (2.5 mM each), and RNase-free water to a final volume of 20 μL. The amplification kit was: TaKaRa LA Taq with GC Buffer (TaKaRa Code: RR02AG).

[0111] The amplification program was as follows: 94℃ pre-denaturation for 1 min; 94℃ denaturation for 30 s, 70℃ annealing for 30 s, 72℃ extension for 120 s, with the annealing temperature decreasing by 1℃ per cycle for a total of 10 cycles; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 120 s for a total of 25 cycles, with a 72℃ extension for 5 min.

[0112] 2.8 Second round of PCR amplification:

[0113] Dilute the PCR product obtained in step 2.7 100 times as a template.

[0114] The reaction mixture consisted of: 0.5 μL of the PCR product from step 2.7, 0.5 μL of 5' Outer Primer (10 μM), 0.5 μL of RC927-NR2 (10 μM), 0.2 μL of TaKaRa LA Taq (5 U / μL), 10 μL of 2×GC Buffer I, 3.2 μL of dNTP Mixture (2.5 mMeach), and RNase-free water to a final volume of 20 μL. The amplification kit was: TaKaRa LA Taq with GC Buffer (TaKaRa Code: RR02AG).

[0115] The amplification program was as follows: 94℃ pre-denaturation for 1 min; 94℃ denaturation for 30 s, 70℃ annealing for 30 s, 72℃ extension for 120 s, with the annealing temperature decreasing by 1℃ per cycle for a total of 10 cycles; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 120 s for a total of 25 cycles, with a 72℃ extension for 5 min.

[0116] The amplification steps for the control kit are as follows: pre-denaturation at 94℃ for 1 min; denaturation at 94℃ for 30 s, annealing at 55℃ for 60 s, extension at 72℃ for 120 s, for a total of 35 cycles, followed by a final extension at 72℃ for 5 min.

[0117] 2.9 The PCR products from step 2.8 were analyzed by agarose gel electrophoresis. The electrophoresis diagram is shown below. Figure 4The target band is located between 300-400 bp. The target band in the control kit is marked as 1, the target band in this example is marked as 2, and the marker (Sangon Biotech Code: B500347-0050) is marked as M.

[0118] The results showed that the 5' adapter primer sequence provided by this invention significantly reduced non-specific amplification bands and increased the amount of target product after amplification, indicating a significant optimization effect. Furthermore, the control kit requires purification and tailing after digestion, a process that takes 30 minutes, while this invention completes digestion and tailing in one step, eliminating the purification step and simplifying the process.

[0119] 2.10 Recovery of PCR Products

[0120] Add the PCR product from step 2.9 of this embodiment to 100 μL of isopropanol and 300 μL of Buffer B2, mix and then add to a purification column, and follow the procedure of the SanPrep DNA Gel Extraction Kit (Sangon Biotech Code: B518131-0050).

[0121] 2.11 Connection Conversion

[0122] Use pMD TM The 18-T Vector Cloning Kit (TaKaRa Code: 6011) was used for ligation transformation. White colonies were selected, and the length of the inserted fragment in the vector was confirmed by PCR.

[0123] Colony PCR identification primers:

[0124] PUC-M13F:acatttcgtaaaacgacggc

[0125] PUC-M13R:tatggaaaaacgccagcaac

[0126] PCR products with the correct target band size were sequenced for verification.

[0127] (Note: The sequencing primers for this positive clone are also PUC-M13F and PUC-M13R)

[0128] See the sequenced sequence. Figure 5 Sequence 2 is shown. After alignment, the amplified sequence was successfully spliced ​​with the known CDS sequence, and the experiment was successful.

[0129] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A universal adapter primer for amplifying the 5' end of cDNA, characterized in that, The 5' end adapter primer sequence is: GCTGTCAACGATACGCTACGTAACGGCATGACAGTGIIGGIIGGIIGGIIG (SEQ ID NO.1). The universal adapter primer is paired with a template containing a single-stranded cDNA fragment with poly(C) appended to its 3' end.

2. A kit for amplifying cDNA ends, characterized in that, The kit includes the universal adapter primers for amplifying the 5' end of cDNA as described in claim 1.

3. The reagent kit according to claim 2, characterized in that, The kit also includes anchoring primers for amplifying the 5' end of cDNA, the sequence of which is: GCGTGTCAACGATACGCTACGTAAC (SEQ ID NO.2).

4. The reagent kit according to claim 3, characterized in that, The kit also includes reverse transcriptase, reverse transcription primers, and a nested primer set.

5. The reagent kit according to claim 4, characterized in that, The nested primer set includes a first nested primer and a second nested primer, wherein the first nested primer is used in combination with the universal adapter primer for a first round of nested PCR, and the second nested primer is used in combination with the anchoring primer for a second round of nested PCR.

6. The reagent kit according to claim 5, characterized in that, The primer sequence lengths of the first and second nested primers are 23-28 nt, and the positions of the first and second nested primers are greater than 20 nt.

7. The reagent kit according to claim 4, characterized in that, The kit also includes a reaction buffer comprising 1-1.1 M potassium dimethylarsinate, 1-1.1 M KCl, 200-205 mM Tris-HCl, 78-80 mM MgCl2, 10-12 mM DTT, 5-6 mM CoCl2, and 0.05%-0.06% v / v Triton X-100, wherein the pH of the Tris-HCl is 7.8-8.

0.

8. A 5' RACE method for obtaining a complete 5' end sequence using the kit as described in any one of claims 2-7 or the universal adapter primer for amplifying the 5' end of cDNA as described in claim 1, characterized in that, The method includes the following steps: The 5' end universal adapter primer was used to amplify the single-stranded cDNA fragment with poly(C) added to the 3' end, resulting in the 5' end RACE product.

9. The 5'RACE method according to claim 8, characterized in that, The 5'RACE method includes the following steps: Reverse transcription: The target gene is reverse transcribed using reverse transcription primers and reverse transcriptase to obtain the first-strand cDNA fragment; RNA degradation reaction; Add poly(C) to the 3' end; First round of nested PCR: The first round of nested PCR was performed using the universal adapter primers and the first nested primers; Second round of nested PCR: Second round of nested PCR was performed using the second nested primers and anchoring primers.

10. The 5'RACE method according to claim 9, characterized in that, The amplification program for the first round of nested PCR included: 94℃ pre-denaturation for 1 min; 94℃ denaturation for 30 s, 70℃ annealing for 30 s, 72℃ extension for 120 s, with the annealing temperature decreasing by 1℃ per cycle, for a total of 10 cycles; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 120 s, for a total of 25 cycles, with the 72℃ extension lasting 1-5 min.

11. The 5'RACE method according to claim 9, characterized in that, The amplification program for the second round of nested PCR included: 94℃ pre-denaturation for 1 min; 94℃ denaturation for 30 s, 70℃ annealing for 30 s, 72℃ extension for 120 s, with the annealing temperature decreasing by 1℃ per cycle for a total of 10 cycles; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 120 s for a total of 25 cycles, with the 72℃ extension lasting 1-5 min.

12. The use of the kit as described in any one of claims 2-7 or the universal adapter primer for amplifying the 5' end of cDNA as described in claim 1 in the amplification of cDNA.