DNA barcode of Rubus plant and its application

Abstract

The present invention relates to the technical field of molecular markers, and in particular to a DNA barcode of Rubus tianmu and its application. The DNA barcode of the present invention can be obtained by amplification using a primer pair as shown in SEQ ID NO.1‑2. The DNA barcode can be used to identify Rubus tianmu, and specifically includes: (1) extracting DNA of a Rubus plant to be identified; (2) using the DNA as a template and performing PCR amplification using the primers shown in SEQ ID NO.1‑2; (3) sequencing the PCR amplification results; (4) splicing and comparing the sequencing results; (5) judging whether the Rubus plant to be identified is Rubus tianmu based on the comparison results. The molecular marker of the present invention can effectively identify Rubus tianmu.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a DNA barcode of Rubus plants and an application thereof. Background Art

[0002] Rubus tianmuensis K. Zhang & Y. F. Yin is native to Tianmu Mountain in Anhui and Zhejiang Provinces. It is a recently identified new species of Rubus. It grows on hillsides, sunny places on the roadside, and in low to medium altitude areas. This species is similar to Rubus chingii, but the difference is that the latter has simple leaves with five deep palmate lobes, while the leaves of this species are bird-foot compound leaves, and the terminal leaflets have obvious petioles; Rubus chingii has soft hairs or almost no hairs on both sides of its cotyledons along the veins, while this species has short soft hairs on both sides; Rubus chingii has linear-lanceolate stipules, while this species has lanceolate stipules, which are wider and have obvious soft hairs; Rubus chingii has no hairs on its pedicels, while this species has obvious soft hairs, short glandular hairs and hooked spines on its pedicels. Although the two have some phenotypic differences, due to the overlapping habitats and the influence of the environment, the phenotypes often converge, and even professionals still find it difficult to clearly identify them by phenotype in the seedling stage or in mixed populations of the two. In addition, other species of Rubus distributed in the area include palm leaf raspberry, mountain raspberry, sorghum bubble, field bubble, raspberry, hollow bubble, red gland Rubus, and three-flowered Rubus, some of which are phenotypically similar to Tianmu Rubus, affecting the identification of Tianmu Rubus. Summary of the invention

[0003] The present invention mainly aims at the above technical problems, provides a simple molecular labeling method to realize the identification of Rubus tianmu, and specifically provides a DNA barcode for identifying Rubus tianmu and its application.

[0004] Specifically, the present invention provides the following technical solutions:

[0005] In a first aspect, the present invention provides a DNA barcode molecular marker of Rubus tianmu, wherein the DNA barcode is the base sequence at positions 224-229 of SEQ ID NO.3, which can be amplified by the primer pair shown in SEQ ID NO.1-2.

[0006] The present invention utilizes a high-throughput sequencing method to assemble a chloroplast genome from the whole genome sequence of Rubus tianmu, and compares the sequences with 61 Rubus species published on NCBI. It is found that Rubus tianmu contains a specific 6bp insertion sequence in the intron of the rps16 gene, which only exists in the chloroplast genome of Rubus tianmu.

[0007] Primers are further designed for the above insertion sequence so that the above insertion sequence is contained inside the primer amplification product.

[0008] Thirty-three (21 species) Rubus samples, including Rubus tianmu, were selected and primers were designed for PCR amplification.

[0009] Sanger sequencing and comparative analysis of 33 amplified products revealed that the specific 6bp insertion sequence existed stably and specifically in Rubus tianmu.

[0010] In a second aspect, the present invention provides primers for amplifying the above-mentioned DNA barcodes.

[0011] The primers of the present invention include the sequences shown in SEQ ID NO. 1-2.

[0012] In a third aspect, the present invention provides a reagent or a kit containing the above-mentioned primers.

[0013] In a fourth aspect, the present invention provides a DNA chip comprising the above primers.

[0014] In a fifth aspect, the present invention provides any of the following applications of the above-mentioned DNA barcode, primer, reagent, kit or DNA chip:

[0015] (1) Application in identification of Rubus tianmu;

[0016] (2) Application in identification, improvement or molecular marker-assisted breeding of Rubus germplasm resources;

[0017] (3) Application in the screening of Rubus hybrid breeding or in the creation of different Rubus varieties;

[0018] (4) Application in constructing a DNA fingerprint database of Rubus genus;

[0019] (5) Application in the quality inspection of Rubus oxyphylla seedlings.

[0020] In a sixth aspect, the present invention provides a method for identifying Rubus tianmoides, comprising:

[0021] (1) extracting DNA from the Rubus plant to be identified;

[0022] (2) using DNA as a template and performing PCR amplification using the primers shown in SEQ ID NO.1-2;

[0023] (3) sequencing the PCR amplification results;

[0024] (4) Splicing and aligning the sequencing results;

[0025] (5) Determine whether the Rubus plant to be identified is Rubus tianmu based on the comparison results.

[0026] The method for determining whether the Rubus plant to be identified in step (5) is Rubus tianmu is as follows: comparing the sequencing sequence with SEQ ID NO.3 and the intron of the rps16 gene of the known Rubus genus. When the sequencing result of the Rubus plant to be identified contains a 6 bp insertion sequence 5'-ATTTAT-3' at the base site 224-229 corresponding to SEQ ID NO:3, the Rubus plant to be identified is Rubus tianmu.

[0027] Among them, the PCR amplification reaction system in step (2) is 25μL, 2×Phanta Max Master Mix 12.5μL, upstream primer (10μM) / downstream primer (10μM) 1μL each, DNA template 200-300ng, ddH2O supplemented to 25μL. 2×PhantaMax Master Mix contains Phanta Max Super-Fidelity DNA Polymerase, dNTP, protective agent and buffer system; the amplification program is: ① 95℃ pre-denaturation for 3min; ② 95℃ denaturation for 15s, 60℃ annealing for 15s, 72℃ extension for 75s, 35 cycles; ③ 72℃ extension for 5min;

[0028] The single DNA barcode molecular marker of the present invention can effectively distinguish whether the tested variety is Rubus tianmuensis, providing a guarantee for the identification, planting, resource utilization and breeding of Rubus tianmuensis. It is also of great significance for the classification, phylogeny, and phylogenetic research of Rubus species, as well as the protection and utilization of Rubus resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The present invention is described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0030] Figure 1 It is a specific marker site screened after comparing the chloroplast genome of Rubus tianmuensis with the chloroplast genome sequence of Rubus genus on Genbank.

[0031] Figure 2 It is the comparison result after sequencing of PCR products of 33 (21 species) Rubus samples amplified by SEQ ID NO:1-2, wherein sequence 30 is SEQ ID NO:3 obtained by high-throughput sequencing of Rubus tianmu, and sequence 29 is the Sanger sequencing result of the PCR product of Rubus tianmu. DETAILED DESCRIPTION

[0032] In order to make the purpose, technical scheme and beneficial technical effect of the present invention clearer, the present invention is further described in detail below in conjunction with embodiment.It should be understood that the following embodiments are provided only for the purpose of illustration and are not intended to limit the scope of the present invention.Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.The experimental methods used in the following examples are conventional methods unless otherwise specified.The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0033] The Rubus plant samples used in the following examples can be obtained through commercial purchase or collected from the wild.

[0034] Example 1 Collection of Rubus tianmoides

[0035] Rubus tianmuensis K. Zhang & Y. F. Yin is produced in the Tianmu Mountain area of ​​Anhui Province and Zhejiang Province. It grows on hillsides, sunny places on the roadside, and in low to medium altitude areas. This species is similar to Rubus chingii. Other Rubus species distributed in the region include Rubus chingii, Rubus chinensis, Rubus chinensis, Rubus chinensis, Rubus chinensis, Rubus chinensis, Rubus chinensis, Rubus chinensis, Rubus chinensis, Rubus chinensis, Rubus chinensis. The Rubus tianmuensis of the present invention are all collected from the Tianmu Mountain area.

[0036] Example 2 Development of Rubus tianmoides-specific molecular markers

[0037] The specific molecular markers of Rubus tianmuensis, i.e. DNA barcodes, were obtained by the following steps:

[0038] 1) Collecting leaves of Rubus tianmu;

[0039] 2) Extracting total DNA from Rubus tianmu leaves;

[0040] 3) performing second-generation high-throughput sequencing on the total DNA to obtain sequencing reads;

[0041] 4) The chloroplast genome was assembled using Noveplastys software to obtain the complete chloroplast genome of Rubus acephalus.

[0042] 5) Compare with the chloroplasts of 61 Rubus species in Genbank and screen for specific marker sites.

[0043] Results Figure 1 The Tianmu Rubus contains a 6bp insertion fragment ATTTAT in the intron of the rps16 gene. This insertion fragment is not found in other Rubus species and is a Tianmu Rubus-specific insertion fragment. It is speculated that it can be used as a DNA barcode for species identification of Tianmu Rubus.

[0044] Example 3 Primer design of Rubus tianmoides-specific molecular markers

[0045] According to the comparison results in Example 2, PCR primers for identifying Rubus tianmu were designed, wherein the PCR primer product contained a Rubus tianmu-specific insert fragment 5'-ATTTAT-3', and the primer sequence was as follows:

[0046] Forward primer TM-F: 5'-AAGTTTTCCCCTCGTACGGC-3' (SEQ ID NO: 1)

[0047] Reverse primer TM-R: 5'-GGAACAACTTCGTAAGTATATTTTCGA-3' (SEQ ID NO: 2)

[0048] The base sequence of the PCR product of Rubus tianmu is as follows, where the underlined part is the insertion fragment unique to Rubus tianmu:

[0049] 5'-AAGTTTTCCCCTCGTACGGCTCGAGAAAATTAGAAATTATGTCTATGTATCGAATTACAATATCAAATATATCCATAAAATCATCAAATTAATTAGACTATAGATTTAAGTACTTTTTTTGTTATTCTTATCCAATCAAAAAATTAGTCGTATTTGCACCCTCATAACTCAAGTTGGATAACTCTGAAATAACTCAAAAGAGAACCTTTTTAGATATTTC ATTTAT ATTTATTGAGTGGTCTCTAACCCTTTATTGTCTGTCTACTTTAGAATCTATTTCGATTCTTCATTCTGATCTAGTTATTAAGACAATTGAAAAGGTATTTACTTGTTCCAGGATCTTTTACCTTAAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAAATCCT TTCAAAACGGCAGCAACATATCATTTTTTGTGATTTCTTTCTGTCAAAGAATCATACGAATGGTTGATTCCTGCGTAATACACCTTCCTTTTGAAGTTGAAATTTTCTCGAATAGGACCTTTTAAGTTTATGTATCGAAAATATACTTACGAAGTTGTTCC-3'(SEQ ID NO:3)

[0050] Embodiment 4 Tianmo Rubus identification method

[0051] 1) Collect 33 (21 species) Rubus plant leaves as samples to be tested;

[0052] 2) extracting total DNA from the sample to be tested;

[0053] 3) using the primer pairs designed in Example 3, PCR was performed on the total DNA of the above samples respectively;

[0054] The PCR amplification reaction system is 25 μL, 2×Phanta Max Master Mix 12.5 μL, upstream primer (10 μM) / downstream primer (10 μM) 1 μL each, DNA template 200-300 ng, ddH2O supplemented to 25 μL. 2×Phanta Max Master Mix contains Phanta Max Super-Fidelity DNA Polymerase, dNTP, protective agent and buffer system;

[0055] The PCR amplification program was as follows: ① pre-denaturation at 95°C for 3 min; ② denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 75 s, 35 cycles; ③ extension at 72°C for 5 min;

[0056] 4) PCR amplification product detection:

[0057] The PCR product was detected by 1% agarose gel electrophoresis, stained with 10× Loading Buffer, and the PCR amplification was observed under the gel imaging system. The bands were clear and single, and could be directly sent to a biological company for sequencing.

[0058] 5) Sequencing result assembly and alignment: The sequencing results were imported into the software Vector NTI 11.0 for sequence assembly, and then the sequence alignment was performed using the Mafft software.

[0059] From the comparison results ( Figure 2 ) can be seen that compared with 32 different species of Rubus, including Rubus palmatus, which is phenotypically the closest to Rubus tianmuensis, Rubus tianmuensis (R2021016) has a higher affinity with Rubus tianmuensis in the corresponding SEQ ID NO:3 ( Figure 2 Sequence 30, numbered as TMXGZ, the sequence is the high-throughput sequencing assembly result of Example 1) and contains a 6 bp insertion sequence 5'-ATTTAT-3' at the 224-229 base site. The method of the present invention can stably and reliably perform species identification on Rubus tianmu.

[0060] In summary, first of all, the present invention is a powerful supplement to traditional species identification, and the sample identification process can be automated and standardized, breaking through the excessive reliance on experience, and can use fresh or dried leaves of plants, such as specimen samples for rapid and effective identification, and can establish an easy-to-use application system in a relatively short time. Secondly, the present invention can distinguish between Rubus tianmu and closely related species, and can stably and accurately identify Rubus tianmu and closely related species at a higher resolution level. Finally, the method of the present invention can be of great significance for the classification, phylogeny, and phylogenetic research of Rubus species, as well as the protection and utilization of Rubus resources.

[0061] According to the disclosure and teaching of the above description, those skilled in the art to which the present invention belongs may also make appropriate changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and some modifications and changes to the present invention should also fall within the scope of protection of the claims of the present invention. In addition, although some specific terms are used in this specification, these terms are only for the convenience of description and do not constitute any limitation to the present invention.

Claims

1. A DNA barcode of a Rubus plant, characterized in that: The DNA barcode is shown in SEQ ID NO.3, and the Rubus plant is Rubus tianmu Rubus tianmuensis K. Zhang & Y. F. Yin.

2. Any of the following uses of the DNA barcode according to claim 1: (1) Application in identification of Rubus tianmu; (2) Application in identification, improvement or molecular marker-assisted breeding of Rubus tianmuensis germplasm resources; (3) Application in screening or creating different varieties of Rubus tianmu; (4) Application in constructing a DNA fingerprint database of Rubus tianmuensis; (5) Application in the quality inspection of Rubus tianmuensis seedlings.

3. Identification of Rubus tianmu Rubus tianmuensis The method of K.Zhang & YF Yin is characterized in that include: (1) extracting DNA from the Rubus plant to be identified; (2) using DNA as a template and performing PCR amplification using the primers shown in SEQ ID NO.1-2; (3) sequencing the PCR amplification results; (4) Splicing and aligning the sequencing results; (5) Judging whether the Rubus plant to be identified is Rubus tianmu according to the comparison results, the judging method is as follows: The sequencing sequences are spliced ​​and then aligned with SEQ ID NO.3 and the introns of the rps16 gene of the known Rubus genus. If the sequencing result of the Rubus plant to be identified is consistent with the sequence of SEQ ID NO.3, the Rubus plant to be identified is Rubus tianmu.

Images