A chrysosporium strain zjje004 and a method for industrial cultivation thereof

Abstract

The application discloses a chrysosporium strain ZJJE004 and a factory cultivation method thereof, the chrysosporium strain ZJJE004 ( Naematelia aurantialba ), is preserved in the China General Microbiological Culture Collection Center, and the preservation date is May 12, 2022, and the preservation number is CGMCC NO.40189, and the ITS sequence is shown as SEQ NO.1. The factory cultivation method of the chrysosporium strain ZJJE004 adopts a liquid strain one-time inoculation method, does not need to inoculate tissue blocks, greatly optimizes the cultivation method, and is simple in cultivation method, fast in mycelium growth, low in pollution, strong in mycelium, obviously shortens the cultivation period of the chrysosporium, and can be picked in 45-55 days; the ear yield is high, the size of the fruiting body is uniform, the mushroom effect is good, the conversion rate of the first crop can be higher than 80%, the yield is high, large-scale cultivation can be realized, has high application value, and is suitable for factory production.

Description

Technical Field

[0001] This invention belongs to the field of edible fungi technology, specifically relating to a strain of Auricularia auricula-judae ZJJE004 and its industrialized cultivation method. Background Technology

[0002] Golden Ear ( Naematelia aurantialba (Bandoni & M. Zang) Millanes & Wedin), belonging to the kingdom fungi, phylum Basidiomycota, class Tremellomycetes, order Tremellales, family Naemateliaceae, genus Lepidoptera. Naematelia .

[0003] Golden ear fungus has a parasitic or partial symbiotic relationship with other leathery fungi such as *Gynostemma pentaphyllum* and *Gynostemma platyphyllum*, meaning that the fruiting body of golden ear fungus can only grow when the two fungi combine together. *Gynostemma pentaphyllum* (… Stereum hirsutum (Willd.) Pers.) It belongs to the kingdom fungi, class Basidiomycetes, order Polyporales, family Thelephoraceae, and genus Leptomyces. Stereum .

[0004] When mature, the fruiting body of *Auricularia auricula-judae* is golden yellow and ear-shaped, resembling a brain, hence its other names such as "brain ear" and "brain-shaped silver ear." As a valuable edible and medicinal fungus, it contains abundant amino acids, proteins, and minerals essential for the human body. Its unique polysaccharide, a current research focus, is one of the main active ingredients, possessing various effects such as lowering blood lipids, lowering blood sugar, and enhancing immunity. As early as the *Compendium of Materia Medica*, it was recorded that *Auricularia auricula-judae* has the effects of relieving cough and phlegm, promoting body fluid production and quenching thirst, and can be used to treat symptoms such as excessive phlegm, asthma, tuberculosis, consumptive diseases, cough, and night sweats.

[0005] However, the yield of wild golden ear fungus is relatively low, far from meeting market demand, making artificial cultivation essential. However, due to the unique biological characteristics of golden ear fungus and the specific nature of its strain production, the golden ear fungus strain is unstable, resulting in low and inconsistent yields from artificial cultivation.

[0006] The present invention aims to provide a new strain of Auricularia auricula-judae and its industrialized cultivation method. Summary of the Invention

[0007] The first objective of this invention is to provide a new strain of Auricularia auricula-judae ZJJE004. The second objective of this invention is to provide a method for culturing liquid culture of strain ZJJE004. The third objective of this invention is to provide a method for industrialized cultivation of strain ZJJE004.

[0008] The first objective of this invention is achieved as follows: *Auricularia auricula-judae* strain (… Naematelia aurantialba ZJJE004 was deposited on May 12, 2022, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; accession number: CGMCC NO.40189; its ITS sequence is shown in SEQ NO.1 of the sequence listing.

[0009] The second objective of this invention is achieved by the following method for culturing the liquid strain of *Auricularia auricula-judae* ZJJE004:

[0010] 1) Prepare a liquid culture medium according to the formula (4-6g wheat flour, 2-4g corn flour, 2-4g peptone, 15-20g glucose, 0.5-1g magnesium sulfate, 1-2g dipotassium hydrogen phosphate, 1L water). Sterilize the liquid culture medium at 0.1-0.2MPa and 121℃ for 20-40 minutes and then cool to obtain the fermentation broth.

[0011] 2) Inoculate the fermentation broth with 1% of the *Trichoderma harzianum* seed liquid, and then inoculate it again with 1% of the *Auricularia auricula-judae* strain ZJJE004 seed liquid. The inoculation ratio of *Trichoderma harzianum* to *Auricularia auricula-judae* is 1:1.

[0012] 3) After inoculation, liquid culture can be obtained by culturing on a shaker or fermenter for 8-12 days.

[0013] The third objective of this invention is achieved by providing a method for the industrialized cultivation of the Auricularia auricula strain ZJJE004, which is implemented through the following steps:

[0014] A. Prepare the culture medium for the spawn, adjust the moisture content to 56-62%, dispense it into cultivation bags, autoclave at 121℃ for 120 minutes, and then cool.

[0015] B. Make 4 holes on the surface of the cultivation bag, inoculate 5-10ml of the liquid inoculum into each hole, seal the bag with a breathable film after inoculation, and incubate in the dark for 20-25 days at 17℃-20℃ and 50%-60% humidity.

[0016] C. When the golden ear primordia begin to grow and the breathable membrane expands, tear off the breathable membrane, increase the air humidity to 80%-85%, and continue to cultivate at 16-18℃ for 10-15 days.

[0017] D. When the golden ear primordia grow to the size of an egg, increase the humidity to 90%-95%, 16-19℃, and continue to cultivate under light for 7-10 days.

[0018] E. When the golden ear fungus is about to open its petals, increase the humidity to 95%-100% and continue to cultivate it under light for 5-7 days until it matures.

[0019] F. When the golden ear fungus turns golden yellow and opens its petals, it is mature and ready for harvesting.

[0020] The beneficial effects of this invention are as follows:

[0021] 1. This invention provides a novel *Auricularia auricula-judae* strain ZJJE004 and its industrialized cultivation technology. This invention employs a single liquid inoculation method, eliminating the need for tissue blocks, thus greatly optimizing the cultivation method. The cultivation method is simple, with rapid mycelial growth, less contamination, and robust mycelium. Figure 3 Using liquid inoculation significantly shortens the cultivation cycle of golden ear fungus, allowing harvesting in 45-55 days; it also results in a high fruiting rate and uniform fruiting body size. Figure 5 It has good fruiting effect, with a first-crop conversion rate of over 80%, high yield, and can achieve large-scale cultivation. It has high application value and is suitable for factory production.

[0022] 2. This invention also provides an SSR molecular marker for the new Auricularia auricula strain ZJJE004, with a marker combination of 1+3 / 1+3 / 2 / 1 / 1+4 / 1 / 1, which can be used for the rapid identification of Auricularia auricula strain ZJJE004. It has the characteristics of saving costs, improving efficiency, convenient operation and accurate results. Attached Figure Description

[0023] Figure 1 This is a colony diagram of the *Auricularia auricula-judae* strain ZJJE004 of the present invention;

[0024] Figure 2 This is a microstructure diagram of the spores of the *Auricularia auricula-judae* strain ZJJE004 of this invention.

[0025] Figure 3 This is a diagram of the liquid culture of the *Auricularia auricula-judae* strain ZJJE004 after 6 days of cultivation.

[0026] Figure 4 This is a diagram of mycelial germination of the *Auricularia auricula-judae* strain ZJJE004 of this invention.

[0027] Figure 5 Figure 6 of this invention shows the fruiting of fruiting bodies of the auricularia auricula strain ZJJE004 in a factory setting.

[0028] Figure 6 This is a diagram of the gold ear fruit entity obtained in Embodiment 6 of the present invention;

[0029] Figure 7 UPGMA clustering tree of genetic distances for eight strains of Auricularia auricula-judae based on SSR molecular markers;

[0030] Figure 8The relative molecular weight peaks of alleles obtained by sequentially detecting primers JESSR003, JESSR010, JESSR032, JESSR090, JESSR098, and JESSR100 in Auricularia auricula-judae strain ZJJE004 are shown in the figure. Detailed Implementation

[0031] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments, but this does not limit the present invention in any way. Any modifications or improvements made based on the teachings of the present invention shall fall within the protection scope of the present invention.

[0032] The *Auricularia auricula-judae* strain ZJJE004 of this invention was collected from wild *Auricularia auricula-judae* fruiting bodies in Gaoligong Mountain and deposited on May 12, 2022, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO.40189.

[0033] The present invention also provides a liquid culture medium for the auricularia auricula strain ZJJE004, which consists of 4-6g wheat flour, 2-4g corn flour, 2-4g peptone, 15-20g glucose, 0.5-1g magnesium sulfate, 1-2g dipotassium hydrogen phosphate, and 1L water.

[0034] This invention further provides a method for culturing the liquid culture of *Auricularia auricula-judae* strain ZJJE004, which is implemented according to the following steps:

[0035] 1) Prepare the liquid culture medium according to the liquid culture medium formula, sterilize it at 0.1-0.2 MPa and 121℃ for 20-40 min and then cool it to obtain the fermentation broth;

[0036] 2) Inoculate the fermentation broth with *Trichoderma harzianum* at a ratio of 1%, and then inoculate it again with *Auricularia auricula-judae* ZJJE004 at a ratio of 1%. The inoculation ratio of *Trichoderma harzianum* to *Auricularia auricula-judae* is 1:1.

[0037] 3) After inoculation, liquid culture can be obtained by culturing on a shaker or fermenter for 8-12 days.

[0038] In step 3, the vibration speed of the shaking table is 800-1000 r / min, and the temperature is 20-23℃.

[0039] The present invention further provides a culture medium for the cultivation of Auricularia auricula-judae strain ZJJE004, which consists of 65-70 parts sawdust, 15-18 parts corn cob, 13.9-15.4 parts wheat bran, 0.5-0.7 parts gypsum, 0.5-0.7 parts lime, and 0.1-0.2 parts potassium dihydrogen phosphate.

[0040] This invention discloses a method for the industrialized cultivation of the Auricularia auricula-judae strain ZJJE004, which is implemented according to the following steps:

[0041] A. Prepare the culture medium according to the culture medium formula, adjust the moisture content to 56-62%, dispense into cultivation bags, autoclave at 121℃ for 120 minutes, and cool.

[0042] B. Make 4 holes on the surface of the cultivation bag, inoculate 5-10ml of liquid inoculum into each hole, seal the bag with a breathable film after inoculation, and incubate in the dark for 20-25 days at 17℃-20℃ and 50%-60% humidity.

[0043] C. When the golden ear primordia begin to grow and the breathable membrane expands, tear off the breathable membrane, increase the air humidity to 80%-85%, and continue to cultivate at 16-18℃ for 10-15 days.

[0044] D. When the golden ear primordia grow to the size of an egg, increase the humidity to 90%-95%, 16-19℃, and continue to cultivate under light for 7-10 days.

[0045] E. When the golden ear fungus is about to open its petals, increase the humidity to 95%-100% and continue to cultivate it under light for 5-7 days until it matures.

[0046] F. When the golden ear fungus turns golden yellow and opens its petals, it is mature and ready for harvesting.

[0047] In step A, 5*15*55 shiitake mushroom bags are used as cultivation bags.

[0048] The present invention also provides a molecular marker combination for the Auricularia auricula strain ZJJE004, which consists of 7 pairs of SSR molecular markers: JESSR003, JESSR010, JESSR032, JESSR075, JESSR090, JESSR098 and JESSR100.

[0049] The strain that matches the SSR allelic fragment numbering combination 1+3 / 1+3 / 2 / 1 / 1+4 / 1 / 1 is the Auricularia auricula strain ZJJE004.

[0050] Example 1: Classification and identification of strain ZJJE004

[0051] 1. Morphological identification

[0052] Colony morphology: Mycelia were obtained by isolating and purifying mature fruiting body spores of the collected *Auricularia auricula-judae* strain ZJJE004. The mycelia were milky white, and the colonies resembled yeast morphology. Figure 1 As shown.

[0053] Hyphae morphology: such as Figure 2 The spores are round, contain oil droplets, and many spores begin to germinate and grow mycelium.

[0054] Sub-entity morphology: such as Figure 6 As shown, the mature fruiting body is golden yellow and auricular in shape, resembling a brain. Initially, it is small, white, and has a relatively smooth surface. As it grows to early maturity, the base of the auricle becomes wedge-shaped, while the upper part becomes uneven, twisted, and thickened, resembling a brain or irregularly lobed structure, with a full internal structure. From mid to late maturity, the lobes vary in depth; in the mid-maturity stage, some lobes are full, while others are soft; the mature surface is golden yellow, the interior is fleshy, and it exhibits a marbled pattern; the diameter is 10-20 cm, and the thickness is 5-11 cm.

[0055] 2. Molecular biological identification

[0056] Genomic DNA was extracted from ZJJE004 using the CTAB method, and detected after 1% agarose gel electrophoresis and GelRed staining. Using the extracted total DNA as a template, the internal transcribed spacer (ITS) sequence was amplified using a Mix reagent (Hunan Qingke Biotechnology Co., Ltd.) with primers ITS4 (5'—TCCTCCGCTTATTGATATGC—3') and ITS5 (5'—GGAAGTAAAAGTCGTAACAAGG—3'). The PCR amplification system was (25 μL): 12.5 μL 2×Mix, 0.5 μL each of 10 μM primers, 11 μL ddH2O, and 0.5 μL DNA template. The reaction procedure was as follows: pre-denaturation at 95℃ for 5 min, followed by 35 amplification cycles: denaturation at 95℃ for 40 sec, annealing at 50℃ for 40 sec, extension at 72℃ for 1 min, followed by extension at 72℃ for 10 min, and storage at 4℃. Sequencing was performed using 1% agarose gel electrophoresis and sent to Qingke Biotechnology for sequencing. The sequencing results were bidirectionally assembled to obtain the sequence (as shown in SEQ No. 1). The sequence was submitted to GeneBank, and BLAST (www.ncbi.nlm.nih.gov / BLAST) was used for homology search, similarity analysis was performed with sequences of various strains in the database, and comparisons were made with existing sequences in the database. Naematelia aurantialba The corresponding sequence identities of each strain reached 93%~100%.

[0057] Therefore, based on the combined results of BLAST comparison and fruiting body morphology identification, strain ZJJE004 can be identified as a new strain of *Auricularia auricula-judae*. Naematelia aurantialba (Bandoni & M. Zang) Millanes & Wedin).

[0058] Example 3: Preparation of liquid culture of Auricularia auricula-judae strain ZJJE004

[0059] The preparation method of liquid culture medium for Auricularia auricula-judae strain ZJJE004 is as follows: Add 5g wheat flour, 3g corn flour, 3g peptone, 20g glucose, 1g magnesium sulfate, and 2g dipotassium hydrogen phosphate to each 1L of water. Dispense the mixture into 1L Erlenmeyer flasks to make 700ml liquid shake flasks. Sterilize at 121℃ for 30 minutes, cool, and place on an ultraviolet sterilizer for 30 minutes before use.

[0060] After cooling, inoculate the shake flasks with 1% of the *Trichoderma harzianum* and *Auricularia auricula-judae* ZJJE004 strains (the inoculation ratio of *Trichoderma harzianum* to *Auricularia auricula-judae* is 1:1), 7 ml each.

[0061] After inoculation, the culture was carried out at 23℃ and a shaking speed of 800 r / min for 7 days. The resulting liquid culture showed clearly visible mycelia and had a high viscosity. Figure 4 It has a light, pleasant aroma.

[0062] Example 4: Preparation of liquid culture of Auricularia auricula-judae strain ZJJE004

[0063] The preparation method of liquid culture medium for Auricularia auricula-judae strain ZJJE004 is as follows: Add 4g wheat flour, 2g corn flour, 4g peptone, 15g glucose, 0.7g magnesium sulfate, and 1g dipotassium hydrogen phosphate to 1L of water. Dispense the mixture into 700ml liquid shake flasks using 1L Erlenmeyer flasks. Sterilize at 121℃ for 30 minutes, cool, and place on an ultraviolet sterilizer for 30 minutes before use.

[0064] After cooling, inoculate the shake flasks with 1% of the *Trichoderma harzianum* and *Auricularia auricula-judae* ZJJE004 strains (the inoculation ratio of *Trichoderma harzianum* to *Auricularia auricula-judae* is 1:1), 7 ml each.

[0065] After inoculation, the product is obtained by culturing in a shaker at 20℃ and 1000r / min for 10 days.

[0066] Example 5: Preparation of liquid culture of Auricularia auricula-judae strain ZJJE004

[0067] The preparation method of liquid culture medium for Auricularia auricula-judae strain ZJJE004 is as follows: Add 6g wheat flour, 4g corn flour, 2g peptone, 18g glucose, 0.5g magnesium sulfate, and 1.5g dipotassium hydrogen phosphate to 1L of water, dispense into 1L Erlenmeyer flasks, prepare 700ml liquid shake flasks, sterilize at 121℃ for 30 minutes, cool, and place on an ultraviolet sterilization platform for 30 minutes for later use;

[0068] After cooling, inoculate the seed liquid of *Trichoderma harzianum* and *Auricularia auricula-judae* strain ZJJE004 into the shake flask at a ratio of 1% (the inoculation ratio of *Trichoderma harzianum* to *Auricularia auricula-judae* is 1:1), 7 ml for each flask.

[0069] After inoculation, the culture is carried out in a shaker at a temperature of 21℃ and a shaking speed of 900r / min for 9 days to obtain the product.

[0070] Example 6: Factory cultivation of Auricularia auricula-judae strain ZJJE004

[0071] 1) Prepare the cultivation substrate: Weigh the raw materials according to the following proportions: 70 parts sawdust, 15 parts corn cob, 13.9 parts wheat bran, 0.5 parts gypsum, 0.5 parts lime, and 0.1 parts potassium dihydrogen phosphate. Add water and mix well to make the moisture content 60%.

[0072] 2) Use 5*15*55 shiitake mushroom bags as cultivation bags; fill the bags with cultivation material;

[0073] 3) Sterilize using high-pressure steam at 121℃ for 120 minutes; remove and cool after sterilization.

[0074] 4) When the cultivation substrate is cooled to about 25°C, liquid inoculation is carried out. Four holes are punched on the surface of the long bag, and 10ml of liquid inoculum prepared in Example 3 is inoculated into the holes. After inoculation, the bag is sealed with a breathable film and cultured in the dark for 22 days at 17°C-20°C and 50%-60% humidity.

[0075] 5) Mushroom management: When the golden ear primordia begin to grow and the breathable membrane is stretched open, tear off the breathable membrane, increase the air humidity to 80%-85%, and continue to cultivate at 16-18℃ for 10 days;

[0076] 6) Once the golden ear primordia buds have grown to the size of an egg, increase the humidity to 90%-95%, maintain a temperature of 16-19℃, and continue cultivation under light for 10 days.

[0077] 7) When the golden ear fungus is about to open, increase the humidity to 95%-100% and continue to cultivate it under light for 5 days until it matures;

[0078] 8) Harvest golden-yellow mature ear fungus. According to statistics, the ear-bearing rate of strain ZJJE004 is 97%, and the first-crop conversion rate is 85%.

[0079] Example 7: Factory cultivation of Auricularia auricula-judae strain ZJJE004

[0080] 1) Prepare the cultivation substrate: Weigh the raw materials according to the following proportions: 80 parts sawdust, 10 parts corn cob, 14.5 parts wheat bran, 0.6 parts gypsum, 0.4 parts lime, and 0.12 parts potassium dihydrogen phosphate. Add water and mix well to make the moisture content 65%.

[0081] The other steps are the same as in Example 6.

[0082] According to statistics, the fruiting rate of strain ZJJE004 was 97.5%, and the biological efficiency of one crop was 90%.

[0083] Example 8: Identification of strain ZJJE004 using SSR molecular markers

[0084] S1. The eight Auricularia auricula-judae strains ZJJE001, ZJJE002, ZJJE003, J-2, J-5, J-6, J-7 and strain ZJJE004 were transferred to potato dextrose agar solid medium and cultured at 25°C for 15 days before mycelium was collected.

[0085] S2. Extract genomic DNA from the hyphae, and determine the total genomic DNA concentration and quality by ultraviolet spectrophotometry;

[0086] S3. The DNA extracted in step 2 was subjected to SSR-labeled PCR amplification using the 7 pairs of SSR molecular markers shown in Table 1.

[0087] S4. The amplification products obtained in S3 are subjected to capillary electrophoresis to analyze the number and molecular weight of the alleles amplified by the SSR primers, and the numbering combination of different SSR alleles is obtained. The strain that meets the SSR allele numbering combination of 1+3 / 1+3 / 2 / 1 / 1+4 / 1 / 1 is the Auricularia auricula strain ZJJE004. Figure 8 ).

[0088] Table 1 SSR marker primer information

[0089]

[0090] S5, Cluster Analysis

[0091] Genetic diversity analysis was performed on eight *Auricularia auricula-judae* strains based on polymorphic fragments amplified from seven pairs of SSRs. UPGMA clustering trees for the eight strains were constructed based on Nei genetic distance. Figure 7 ).from Figure 8 It can be seen that the seven primer pairs provided by this invention clustered *Auricularia auricula-judae* strains ZJJE003 and ZJJE002 into one group, and the other strains J-2, J-5, J-6, and J-7 into another group. Strain ZJJE001 was a separate strain and completely distinguished from the other strains. This indicates that strain ZJJE004 is different from the other seven strains and has specificity. Therefore, it is evident that the seven SSR primer pairs provided by this invention can distinguish strain ZJJE004 from the other seven different *Auricularia auricula-judae* strains.

Claims

1. A strain of *Auricularia auricula-judae* ZJJE004 ( Naematelia aurantialba The sample was deposited at the China General Microbiological Culture Collection Center (CGMCC) on May 12, 2022, with accession number CGMCC NO.40189. Its ITS sequence is shown in SEQ NO.

1.

2. A method for culturing the liquid strain ZJJE004 of *Auricularia auricula-judae* as described in claim 1, characterized in that, Follow these steps to achieve the following: 1) The liquid culture medium consists of 4-6g wheat flour, 2-4g corn flour, 2-4g peptone, 15-20g glucose, 0.5-1g magnesium sulfate, 1-2g dipotassium hydrogen phosphate, and 1L water. Prepare the liquid culture medium according to the formula, sterilize the liquid culture medium at 121℃ for 20-40 minutes under a pressure of 0.1-0.2MPa for 20-40 minutes, and then cool to obtain the fermentation broth. 2) Inoculate the fermentation broth with 1% of the Mycorrhizal spore liquid and then inoculate it again with 1% of the Auricularia auricula-judae ZJJE004 spore liquid. The inoculation ratio of Mycorrhizal spore liquid to Auricularia auricula-judae is 1:

1. 3) After inoculation, liquid culture can be obtained by culturing on a shaker or fermenter for 8-12 days.

3. The cultivation method according to claim 2, characterized in that, In step 3), the vibration speed of the shaking table is 800~1000 r / min and the temperature is 20~23℃.

4. A method for the industrialized cultivation of the *Auricularia auricula-judae* strain ZJJE004 as described in claim 1, characterized in that, Follow these steps to achieve the following: A. The culture medium consists of 65-70 parts sawdust, 15-18 parts corn cob, 13.9-15.4 parts wheat bran, 0.5-0.7 parts gypsum, 0.5-0.7 parts lime, and 0.1-0.2 parts potassium dihydrogen phosphate. Prepare the culture medium according to the formula, adjust the moisture content to 56-62%, dispense into cultivation bags, autoclave at 121℃ for 120 minutes, and then cool. B. Make 4 holes on the surface of the cultivation bag, inoculate 5-10 mL of liquid inoculum into each hole, seal the bag with a breathable film after inoculation, and incubate in the dark for 20-25 days at 17℃-20℃ and 50%-60% humidity. C. When the golden ear primordia begin to grow and the breathable membrane expands, tear off the breathable membrane, increase the air humidity to 80%~85%, and continue to cultivate at 16~18℃ for 10~15 days. D. When the golden ear primordia buds grow to the size of an egg, increase the humidity to 90%~95%, 16~19℃, and continue to cultivate under light for 7~10 days; E. When the golden ear fungus is about to open its petals, increase the humidity to 95%~100% and continue to cultivate it under light for 5~7 days until it matures. F. When the golden ear fungus turns golden yellow and opens its petals, it is mature and ready for harvesting.

5. The factory-scale cultivation method according to claim 4, characterized in that, In step A, 5*15*55 shiitake mushroom bags are used as cultivation bags.

Images