Wheat stem rot resistance gene TaP5CS, its encoding protein and application

Abstract

The present application discloses a wheat stem rot resistance gene TaP5CS The invention discloses and confirms a new wheat stem rot resistance gene for the first time. TaP5CS , as shown in the sequence list SEQ ID NO.3, its length is 2193bp; its amino acid sequence is shown in the sequence list SEQ ID NO.4, its length is 730; a gene expression vector was constructed and a recombinant bacterium was prepared. TaP5CS The wheat stem rot resistance function. TaP5CS It can be applied to wheat disease resistance breeding and stem rot prevention and control; the research discovery of this gene helps to reveal the molecular genetic basis of wheat stem rot and provides an important and unique genetic resource for wheat disease resistance breeding.

Description

Technical Field

[0001] The present application relates to the field of molecular biology technology, and specifically to a wheat stem rot resistance gene. TaP5CS , its encoded protein and applications. Background Art

[0002] Wheat is one of the most important food crops widely grown in the world and is the staple food source for 40% of the world's population. However, in recent years, due to the frequent occurrence of various extreme weather conditions and the continuous reduction of cultivated land area, the high and stable yield of wheat has been greatly affected; among them, wheat stem base rot (Fusarium crown rot, FCR) has occurred widely, causing serious wheat yield and quality losses worldwide. Wheat stem base rot is a typical fungal soil-borne disease caused by a variety of pathogens. It can cause rot in seeds, seedlings, root crowns, underground stems and stem base tissues. Its main symptoms are browning, blackening and even rotting and death at the base of the wheat stem. During the occurrence process, it not only causes serious yield losses and economic losses to wheat, but also produces toxins and secondary metabolites such as DON and NIV that seriously affect food safety and endanger the health of humans and animals.

[0003] At present, no wheat varieties with high resistance or immunity to this disease have been identified. Most of the resistant varieties that have been found are only resistant to the disease in a certain growth period, and the resistance is generally low. Wheat stem rot is a potential soil-borne disease controlled by micro-effect polygenes. Currently, research on wheat stem rot is mainly focused on the resistance identification of breeding materials and the preliminary location of genes. The first reported QTL for stem rot came from the Kukri / Janz DH population and was located on a dwarf gene on chromosome 4B. Rht1 Nearby. Poole et al. (2012) conducted a series of greenhouse and field experiments using Sunco / Macon and Sunco / Otis populations and detected significant QTLs on multiple chromosomes, such as 2B, 3B, 4B, 4D and 7A. At present, the number of QTLs on wheat chromosomes A, B and D are 7, 25 and 11, respectively, with more on chromosomes B and D. Among these QTLs loci, the loci that can be repeatedly detected are located on chromosomes 2DL, 3BL, 4B and 5DS, respectively, with the largest effect on 3BL. Yang et al. used a set of Yanzhan 1 introgression line populations and a DH parent population to locate and clone the first wheat stem rot gene on chromosome 4B. TaDIR, This gene can significantly negatively regulate wheat stem rot resistance.

[0004] So far, there are few reports on wheat stem rot resistance genes with important application value, so further disease resistance gene mining and effective utilization are imminent. By using omics technology to discover excellent disease resistance genes and then explore the functions of disease resistance genes, it can promote the study of the molecular mechanism of wheat disease resistance, which has important practical significance for achieving wheat stem rot resistance breeding.

[0005] The information disclosed in this background technology section is only used to deepen the understanding of the background technology of the present disclosure, and should not be regarded as acknowledging or suggesting in any form that the information constitutes the prior art known to those skilled in the art. Summary of the invention

[0006] The present application provides a wheat stem rot resistance gene TaP5CS , its encoded protein and application are aimed at solving the technical problem of the lack of wheat stem rot resistance genes, so as to provide more options for wheat disease-resistant breeding and stem rot prevention and control.

[0007] According to one aspect of the present disclosure, a wheat stem rot resistance gene is screened and obtained. TaP5CS , whose genomic nucleotide sequence is shown in SEQ ID NO.1, which is 6238 bp in length and contains 20 exons and 19 introns; TaP5CS The cDNA nucleotide sequence of the gene is shown in SEQ ID NO. 2, and its length is 2557 bp; TaP5CS The CDS nucleotide sequence of the gene is shown in SEQ ID NO.3, which is the deoxyribonucleotides from the 152nd to 2344th positions from the 5' end of the sequence SEQ ID NO.2, and encodes the amino acid sequence shown in SEQ ID NO.4 in the sequence listing, with 730 amino acids.

[0008] According to another aspect of the present disclosure, a primer pair for amplifying the above gene is provided, and its full nucleotide sequence is as follows:

[0009] TaP5CS -1F:5'- CCACTTGTTATCCCACGGTT -3';

[0010] TaP5CS -1R: 5'-TCACGGAACTAGATAGCGACA -3'; or

[0011] TaP5CS -2F:5'- ATGGGCAGGGGAGGCATCGG -3';

[0012] TaP5CS -2R:5'-TCATTGCAAAGGAAGATCCT -3'.

[0013] According to another aspect of the present disclosure, there is provided a wheat stem rot resistance gene TaP5CS For example, the wheat stem rot resistance gene TaP5CS Inserted into the LGY-OE3 plant overexpression vector; a recombinant bacterium constructed by the expression vector is provided. When the above gene is used to construct a plant expression vector, any enhanced promoter or inducible promoter can be added before the transcription start nucleotide; in order to facilitate the identification and screening of transgenic plant cells or plants, the vector used can be processed, such as adding a plant selectable marker (GUS gene, luciferase gene, etc.) or a resistance antibiotic marker (gentamicin, kanamycin, etc.).

[0014] According to yet another aspect of the present disclosure, an overexpression vector containing a DNA fragment as shown in SEQ ID NO.3 is provided.

[0015] According to another aspect of the present disclosure, the wheat stem rot resistance gene TaP5CS Or the recombinant bacteria are used in wheat disease resistance breeding.

[0016] According to another aspect of the present disclosure, the wheat stem rot resistance gene TaP5CS Used to promote proline synthesis in wheat.

[0017] According to another aspect of the present disclosure, the wheat stem rot resistance gene TaP5CS Or the protein is used in preventing and treating wheat stem base rot.

[0018] According to another aspect of the present disclosure, a method for improving wheat resistance to stem base rot is provided, wherein the wheat stem base rot resistance gene TaP5CS Overexpression in wheat plants.

[0019] One or more technical solutions provided in the embodiments of the present application have at least the following technical effects or advantages:

[0020] The differential transcriptome of the wheat stem base inoculated with Pseudomonas graminearum WZ-8A at different time periods (0h, 24h, 48h, 72h, 96h) was studied, and the key genes that responded to wheat stem base rot were mined. A key gene that responded to wheat stem base rot at multiple time points was cloned: TaP5CS ; Using the Agrobacterium-mediated transformation system, TaP5CS The plant expression vector was used to transform wheat embryos. Compared with the control, the disease index (DI) and mycelial mass in the overexpression transgenic lines were significantly decreased, indicating that TaP5CS It is a wheat stem rot resistance gene.

[0021] This application TaP5CS The gene helps to reveal the molecular genetic basis of wheat resistance to stem rot, and can provide an important and unique genetic resource for wheat disease-resistant breeding, which is of great significance to the genetic improvement of wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 In one embodiment of this application TaP5CS Relative expression at the stem base at different time periods after inoculation in the wheat variety Nongyou 9.

[0023] Figure 2 This is the plasmid map of the LGY-OE3 vector in one embodiment of the present application.

[0024] Figure 3 In one embodiment of this application TaP5CS Relative expression levels in its overexpression lines (OE#5, OE#7 and OE#8) and the control Fielder.

[0025] Figure 4 In one embodiment of this application TaP5CS Proline content in its overexpression lines (OE#5, OE#7, and OE#8) and the control Fielder.

[0026] FIG. 5 is a phenotype diagram of the overexpression strains (OE#5, OE#7 and OE#8) and the control Fielder after inoculation with Pseudomonas graminearum WZ-8A in one embodiment of the present application.

[0027] Figure 6 This is a graph showing the disease index and mycelium amount of the overexpression strains (OE#5, OE#7 and OE#8) and the control Fielder after inoculation with Fusarium graminearum WZ-8A in an example of the present application. DETAILED DESCRIPTION

[0028] In order to better understand the technical solution of the present application, the above technical solution will be described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0029] Unless otherwise specified, the instruments and equipment involved in the following examples are all conventional instruments and equipment; the reagents, carriers and other test materials involved are all commercially available conventional products unless otherwise specified; the test methods, detection methods, etc. involved are all conventional methods unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged. Primer synthesis and sequencing were completed by Sangon Biotech (Shanghai) Co., Ltd.

[0030] Example 1: Wheat stem rot resistance gene TaP5CS Acquisition

[0031] The discovery of wheat stem rot resistance genes was carried out through transcriptome sequencing, as follows:

[0032] 1. Pathogen propagation

[0033] The strain used in the experiment was Pseudofusorium graminearum WZ-8A (provided by the Disease Research Laboratory of the College of Plant Protection, Henan Agricultural University), which is the dominant pathogen currently prevalent in the Huanghuai wheat region, with significant characteristics such as a wide range of infection and strong pathogenicity. The preserved Pseudofusorium graminearum was taken out and activated on the PDA culture medium. When expanding, healthy and vigorous fungal blocks with hyphae were picked from the edge of the newly activated Pseudofusorium graminearum PDA culture plate and inoculated into the sterilized millet culture medium for culture at 25°C for 7 days.

[0034] 2. Material inoculation, cultivation and sampling

[0035] Refer to the method of Yang (2019). 150g of sterile soil was weighed into a 7cm×7cm small square box, 12 grains of wheat variety Nongyou 9 were evenly placed on the surface, and 20g of soil was covered. Each treatment was repeated three times, and the tray was placed, the bottom was watered thoroughly, and it was placed in an incubator with 16h / 8h, 25℃ / 15℃, and humidity of 60-80%. 3 days after the seedlings, the weak seedlings were removed, and 0.4g of infected millet was inoculated into the box, evenly spread over the small box and ensure that there was a millet fungus at the base of each wheat seedling. The culture conditions were the same as before, and water was applied every 2 days. The stem base was quickly sampled at 0h, 24h, 48h, 72h, and 96h after the infection, and was quickly frozen in liquid nitrogen and placed at -80℃ for use. The stem base material stored at -80℃ was used for RNA extraction.

[0036] 3. Discovery of wheat stem rot resistance genes

[0037] The Illumina DNBSEQ-T7 platform was used to study the transcriptome of wheat stem bases at different inoculation time points. A total of 132,570 transcripts were identified at the transcriptional level, involving 11,2964 genes. Based on the |log2FC|>1 and FDR <0.05 standards, 0h was used as the control, and the differentially expressed genes at the four inoculation time points of 24h, 48h, 72h, and 96h were analyzed, and a total of 53 genes were identified.

[0038] Previous studies of this application have shown that exogenous spraying of proline can significantly enhance wheat stem rot resistance. Using transcriptomics, a differentially expressed gene was identified that responded to all four inoculation time points: Delta-1-pyrroline-5-carboxylate synthase, a key proline pathway synthase gene. TaP5CS, China Spring Accession No.: TraesCS3B02G395900). The results of quantitative fluorescence (qRT-PCR) showed that the RNA expression of this gene was upregulated at the four inoculation time points of 24h, 48h, 72h, and 96h, so it was selected as the target gene.

[0039] Based on the published Chinese Spring reference sequence, the TaP5CS After cloning, a complete open reading frame was finally obtained.

[0040] The specific steps are as follows:

[0041] ① DNA extraction: The DNA of Nongyou 9 seedlings was extracted using the SLS method.

[0042] ② Total RNA extraction and synthesis of the first chain of cDNA: The total RNA of wheat variety Nongyou No. 9 was extracted using the TRIZOL method. 2 μL RNA was electrophoresed on 2% agarose to detect the integrity of RNA. It was found that the extracted total RNA had basically clear 28S and 18S main bands; the OD260 / OD280 ratio detected by UV spectrophotometer was between 1.80 and 2.00, and OD260 / OD230>2.0. Take total RNA that meets the quality requirements and refer to PrimeScript TM RT Reagent Kit (perfect Realtime) instructions for synthesis of the first strand of cDNA.

[0043] ③ TaP5CS Gene cloning and sequence analysis

[0044] Design nested PCR primers, TaP5CS -1F and TaP5CS -1R was designed at both ends of the start codon ATG and the stop codon TGA; TaP5CS -2F and TaP5CS -2R was designed at the start codon ATG and the stop codon TGA, respectively, as follows:

[0045] TaP5CS -1F:5'- CCACTTGTTATCCCACGGTT -3';

[0046] TaP5CS -1R:5'- TCACGGAACTAGATAGCGACA -3';

[0047] TaP5CS -2F:5'- ATGGGCAGGGGAGGCATCGG -3';

[0048] TaP5CS-2R:5'-TCATTGCAAAGGAAGATCCT -3'.

[0049] Using the DNA of Nongyou No. 9 as a template, TaP5CS -1F and TaP5CS -1R primer pair for PCR amplification. PCR reaction solution (50 μl system): 10×PCR Buffer (25 μl), ddH2O (9 μl), dNTP (10 μl), TaP5CS -1F (1.5 μl), TaP5CS -1R (1.5 μl), DNA (2 μl), TaKaRa LA Taq enzyme (1 μl); PCR parameters: 95℃5min, 95℃30 s, 60℃30 s, 72℃5 min, 35 cycles; then 72℃10 min. PCR products were subjected to 1% agarose gel electrophoresis, recovered and connected to PMD18-T vector (TAKARA), and sent to Bioengineering for sequencing.

[0050] A similar method was used to use the cDNA of Nongyou 9 as a template. TaP5CS -1F and TaP5CS -1R primer pair for PCR amplification; using the PCR product as a template, TaP5CS -2F and TaP5CS -2R primers were used for nested PCR amplification, electrophoresis, and recovery was connected to the PMD18 vector (TAKARA) and sent to Bioengineering for sequencing. The PCR reaction system was the same as the above method. PCR parameters: 95℃ 5min, 95℃ 30s, 60℃ 30s, 72℃ 2.5min, 35 cycles.

[0051] The sequencing results showed that the DNA fragment obtained by PCR amplification using the DNA of Nongyou No. 9 as a template was TaP5CS The genome level sequence of the gene is shown in the sequence table SEQ ID NO.1. The total length of the gene is 6238 bp, containing 20 exons and 19 introns. The DNA fragment obtained by PCR amplification using the cDNA of Nongyou No. 9 as a template is TaP5CS The cDNA sequence of the gene is shown in SEQ ID NO.2 in the sequence list, and its length is 2557 bp; TaP5CS -2F and TaP5CS The DNA fragment obtained by nested PCR amplification with primers composed of -2R is TaP5CSThe CDS sequence of the gene, as shown in SEQ ID NO.3 in the sequence list, is 2193 bp in length and is the deoxyribonucleotide sequence from positions 152 to 2344 from the 5' end in SEQ ID NO.2 in the sequence list, and encodes an amino acid sequence as shown in SEQ ID NO.4 in the sequence list, with 730 amino acids.

[0052] Embodiment 2: TaP5CS Fluorescence quantitative analysis

[0053] Fluorescence quantitative analysis was performed on the stem base of Nongyou 9 at different time periods (0h, 24h, 48h, 96h) after inoculation at the seedling stage: the extraction of total RNA and the inversion of cDNA were the same as in Example 1.

[0054] against TaP5CS The specific primers for fluorescence quantitative analysis were designed based on the gene sequence as follows:

[0055] TaP5CS -3F: 5'-TGCGGCACAAGATTCAGGTT-3';

[0056] TaP5CS -3R: 5'-AATTGCGGACATGGAGGACC-3'.

[0057] Selection of internal reference genes β -actin (GenBank accession no. AB181991), the primer sequences are as follows:

[0058] β -actin-F:GTTCCAATCTATGAGGGATACACGC;

[0059] β -actin-R:GAACCTCCACTGAGAACAACATTACC.

[0060] Fluorescence quantification was performed using the Bio-Rad IQ5 Real-Time PCR Detection System. A 20 μL reaction system, 0.4 μL of upstream and downstream primers, 10 μL of Go Taq® qPCR Master Mix (Perfect Real Time; Promega), and 7.2 μL of nuclease-free water. PCR program: 95°C for 3 min, 95°C for 5 s, 60°C for 30 s, 72°C for 30 s, 40 cycles. TaP5CS The gene expression level was used as the control. TaP5CS -3F andTaP5CS -3R as primer, using 2 -△△CT Calculation TaP5CS The relative expression of genes is shown in Figure 1 As shown in the figure, compared with 0h after inoculation, after different time periods of inoculation, TaP5CS The expression of genes was upregulated and reached the highest level at 48h, which was 12 times that of 0h, which was consistent with the expression pattern of transcriptome data.

[0061] Embodiment three: TaP5CS Obtaining genetically modified wheat

[0062] 1. TaP5CS Construction of plant overexpression vector

[0063] According to the cloned TaP5CS Primers were designed based on the full-length cDNA sequence of the PCR product, and restriction endonuclease BamHI and SacI recognition sites and protective bases were introduced at both ends of the primers. The primer sequences are as follows:

[0064] TaP5CS -4F: 5'- GGATTCATGGGCAGGGGAGGCATCGG -3';

[0065] TaP5CS -4R:5'-GAGCTCTCATTGCAAAGGAAGATCCT -3'.

[0066] The expression vector LGY-OE3 was selected, and its vector map is as follows Figure 2 shown.

[0067] The 2193 bp DNA fragment was cloned into the plant expression vector pLGY-02 between the restriction sites BamHI and SacI to obtain a DNA fragment containing wheat TaP5CS The recombinant expression vector of the gene was named LGY-OE3- TaP5CS .

[0068] 2. TaP5CS Obtaining genetically modified wheat

[0069] LGY-OE3- TaP5CS The immature embryo callus of wheat Fielder was transformed by Agrobacterium infection, and transgenic wheat plants were obtained through screening, pre-differentiation and differentiation.

[0070] 3. Positive identification of transgenic wheat

[0071] The T1 transgenic plants were positively identified using the hygromycin tag (Hyg) primers Hyg-F and Hyg-R. The primer sequences are as follows:

[0072] Hyg-F: 5'-TCTGCACCATCGTCAACCAC-3';

[0073] Hyg-R: 5'-AAACCCACGTCATGCCAGTT -3'.

[0074] A total of 10 positive transgenic plants were obtained. After additional generations, T2 generation homozygous transgenic lines OE#5, OE#7 and OE#8 were obtained.

[0075] 4. Genetically modified wheat TaP5CS Expression identification

[0076] use TaP5CS -3F and TaP5CS -3R primer, real-time fluorescence quantitative detection TaP5CS The expression level in the T2 generation positive transgenic lines is shown in Figure 3 As shown. Figure 3 It can be seen that TaP5CS The expression levels in the leaves of T2 positive transgenic lines OE#5, OE#7 and OE#8 were significantly higher than those of the receptor control, which were 4.5 times, 3.3 times and 4.1 times of the control, respectively.

[0077] Embodiment 4: TaP5CS Determination of Proline Content in Transgenic Wheat

[0078] The proline content of the seedlings of the T2 generation overexpression transgenic lines (OE#5, OE#7 and OE#8) and the control Fielder was determined using the ninhydrin colorimetric method. Wheat protein was extracted with sulfosalicylic acid, and after heating, the protein reacted with the acidic ninhydrin solution to generate red; after extraction with toluene, the absorbance was measured at 520nm. The results are shown in Figure 2. Figure 4 As shown. Figure 4 It can be seen that the content of proline in the leaves of the T2 generation overexpression transgenic lines (OE#5, OE#7 and OE#8) was significantly higher than that of the receptor control Fielder. TaP5CS It plays an important role in the proline biosynthesis pathway in wheat.

[0079] Embodiment five: TaP5CS Identification of stem rot resistance in transgenic wheat

[0080] The pathogen was propagated according to step 1 in Example 1, and the T2 generation overexpression transgenic lines (OE#5, OE#7 and OE#8) and the control Fielder were inoculated and cultured according to step 2 in Example 1. The plant phenotype was investigated 4 weeks after inoculation. The wheat seedlings were taken out of the culture box, the base of the plant was washed with water, the degree of plant disease was counted according to the disease level classification method of Smiley et al. (2005b), the disease index was calculated, and the mycelial infection of the stem base was observed. The results are as follows: Figure 5 , Figure 6 shown.

[0081] from Figure 5 It can be seen that compared with the receptor control, the browning of the stem base of the T2 generation overexpressing transgenic lines (OE#5, OE#7 and OE#8) was weakened and the resistance was enhanced.

[0082] from Figure 6 As shown in A, compared with the receptor control, the disease index (DI) in the T2 generation overexpressing transgenic lines (OE#5, OE#7 and OE#8) was significantly decreased to 42, 47 and 46, respectively.

[0083] from Figure 6 As shown in B, the amount of hyphae was reduced in the T2 generation overexpressing transgenic line (OE#5) compared to the receptor control.

[0084] As described in the review, the wheat stem rot response gene described in this application TaP5CS It can enhance wheat stem base rot resistance. It can be used to study the molecular mechanism of wheat stem base rot resistance and has important application value in wheat disease resistance breeding.

[0085] Although some preferred embodiments of the present application have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications falling within the scope of the present application.

[0086] Obviously, those skilled in the art can make various changes and modifications to the present application without departing from the inventive spirit and scope of the present application. Thus, if these modifications and variations fall within the scope of the claims of the present application and their equivalents, the present application is also intended to include these modifications and variations.

Claims

1. Wheat stem rot resistance gene TaP5CS or its recombinant bacteria in the breeding of wheat stem rot resistant varieties / lines, the wheat stem rot resistance gene TaP5CS The genomic nucleotide sequence is shown as SEQ ID NO.1, or its full-length cDNA nucleotide sequence is shown as SEQ ID NO.2, or its CDS nucleotide sequence is shown as SEQ ID NO.3; the recombinant bacteria is constructed by an overexpression vector containing the DNA fragment shown as SEQ ID NO.

3.

2. Wheat stem rot resistance gene TaP5CS Or the use of a protein with an amino acid sequence as shown in SEQ ID NO.4 in preventing and controlling wheat stem base rot, the wheat stem base rot resistance gene TaP5CS The genomic nucleotide sequence is shown as SEQ ID NO.1, or its full-length cDNA nucleotide sequence is shown as SEQ ID NO.2, or its CDS nucleotide sequence is shown as SEQ ID NO.

3.

3. A method for improving wheat resistance to stem rot, characterized in that: Overexpression of the wheat stem rot resistance gene as claimed in claim 1 TaP5CS .

Images