Application of lncRNAGACAT2 in the preparation of products for predicting the prognosis of renal clear cell carcinoma

Abstract

The present invention discloses the application of lncRNAGACAT2 in preparing a product for predicting the prognosis of renal clear cell carcinoma. The application of lncRNAGACAT2 as a detection target in preparing a product for predicting the prognosis of renal clear cell carcinoma using real-time quantitative PCR, reagents, kits or chips, and the sequence of the lncRNAGACAT2 is shown in SEQ ID NO.1. Studies have confirmed that lncRNAGACAT2 is upregulated in renal clear cell carcinoma tissues, and renal clear cell carcinoma patients with high expression of lncRNAGACAT2 have a worse prognosis than renal clear cell carcinoma patients with low expression of lncRNAGACAT2. Therefore, the expression of lncRNAGACAT2 is used for the prognosis prediction of renal clear cell carcinoma patients, which can provide a strong molecular biological basis for the prognosis of renal clear cell carcinoma patients, and has far-reaching clinical significance and promotion.

Description

Technical Field

[0001] The present invention belongs to the field of tumor molecular biology, and specifically relates to the application of lncRNAGACAT2 in preparing a product for predicting the prognosis of renal clear cell carcinoma. Background Art

[0002] Renal cell carcinoma (RCC) is the 14th most common malignant tumor in the world and the third most common urinary system tumor. Clear cell renal cell carcinoma (ccRCC) is the most common renal cancer, originating from the proximal tubular epithelium, and is highly associated with tumor metastasis, accounting for more than 75% of renal cancer-related deaths. Most deaths are due to tumor progression, migration and invasion, as well as postoperative recurrence. Although some treatment methods, including surgery, radiotherapy and chemotherapy, have made great progress, there is currently no reference standard for the prognosis of clear cell renal cell carcinoma, nor are there specific indicators, which are far from meeting the needs of prognosis judgment for human clear cell renal cell carcinoma. Therefore, prognosis judgment for human clear cell renal cell carcinoma in order to select the best treatment plan and significantly improve patient survival has become an important issue that needs to be solved in the field of urology.

[0003] About 75% of the genes in the human genome can be transcribed to generate RNA, of which only 1-2% encode proteins, and most of them exist in the form of non-coding RNA. The existence of non-coding RNA is of great significance. Long non-coding RNA (lncRNA) is a type of non-coding RNA with a length greater than 200bp. It cannot be translated into protein, but participates in the regulation of various physiological processes in the form of RNA. LncRNA can regulate gene expression at multiple levels such as transcription, epigenetics and variable splicing. In recent years, as a regulatory molecule, the application value of lncRNA in clinical diagnosis, chemotherapy sensitivity and prognosis evaluation has gradually attracted the attention of researchers. Studies have shown that HULC is specifically highly expressed in primary liver cancer tissues, and higher levels of transcripts can also be detected in the serum of liver cancer patients. Therefore, it may become a serological marker for liver cancer testing. The expression level of HULC can be used as an indicator of tumor treatment prognosis. LncRNA PCA3 is highly expressed in prostate cancer and can be detected in urine, which is also convenient for clinical testing. LncRNA-LALR1 accelerates the cell cycle process and promotes hepatocyte proliferation by activating Wnt / β-catenin signaling. Drug intervention of lncRNA-LALR1 to induce liver regeneration may be beneficial for the treatment of liver failure and liver transplantation. It can be seen that lncRNA has great potential as a molecular marker for diagnosis, prognosis and treatment. Summary of the invention

[0004] In order to solve the deficiencies of the prior art, the purpose of the present invention is to provide an application of lncRNAGACAT2 in the preparation of a product for predicting the prognosis of renal clear cell carcinoma. The present invention has found that lncRNAGACAT2 (gastric cancer associative transcript 2) is located on chromosome 18p11.22, and the GeneBank accession number: NR-120598 can be used as a criterion for judging the prognosis of renal clear cell carcinoma, and is used to prepare a product for predicting the prognosis of renal clear cell carcinoma, and further provides a product for predicting the prognosis of renal clear cell carcinoma with high cost performance and easy to promote and apply.

[0005] In order to achieve the above object, the technical solution of the present invention is:

[0006] On the one hand, lncRNAGACAT2 is used in the preparation of a product for predicting the prognosis of renal clear cell carcinoma, and the sequence of the lncRNAGACAT2 is shown in SEQ ID NO.1.

[0007] The present invention discovered lncRNAGACAT2 through transcriptome sequencing, extracted RNA from renal clear cell carcinoma tissue, and analyzed the expression of lncRNAGACAT2 by real-time fluorescence quantitative PCR after reverse transcription. The results showed that lncRNAGACAT2 was upregulated in renal clear cell carcinoma tissue, and the expression difference was statistically significant compared with that in adjacent tissues (P<0.001)( Figure 1 ). At the same time, there was a significant difference in the prognosis of patients with renal clear cell carcinoma with different expression levels of lncRNAGACAT2. Kaplan-Meier survival analysis found that the survival rate of patients with renal clear cell carcinoma with high expression of lncRNAGACAT2 was significantly lower than that of patients with low expression (p=0.032)( Figure 2 ). The prognostic analysis of the multivariate Cox proportional hazard model found that the relative risk of lncRNAGACAT2 was >1, indicating that patients with high expression of lncRNAGACAT2 had a worse prognosis than patients with low expression, so high expression of lncRNAGACAT2 was an independent risk factor for the prognostic risk prediction of patients with renal clear cell carcinoma. Based on this effect, it is not difficult for those skilled in the art to imagine using lncRNAGACAT2 to prepare a product for predicting the prognosis of renal clear cell carcinoma.

[0008] In a second aspect, the use of specific primers or specific probe nucleotides for detecting the expression of lncRNAGACAT2 described in the first aspect in the preparation of a product for predicting the prognosis of renal clear cell carcinoma.

[0009] In a third aspect, a product for predicting the prognosis of renal clear cell carcinoma comprises real-time quantitative PCR, reagents, kits or chips for detecting the expression level of lncRNA GACAT2 described in the first aspect.

[0010] In a fourth aspect, a method for detecting the prognosis of a patient with renal clear cell carcinoma comprises using the product for predicting the prognosis of renal clear cell carcinoma according to the third aspect.

[0011] The beneficial effects of the present invention are:

[0012] The present invention discovered lncRNAGACAT2 through transcriptome sequencing, extracted RNA from renal clear cell carcinoma tissue, and analyzed the expression of lncRNAGACAT2 by real-time fluorescence quantitative PCR after reverse transcription. The results showed that lncRNAGACAT2 was upregulated in renal clear cell carcinoma tissue, and the expression difference was statistically significant compared with that in adjacent tissues (P<0.001)( Figure 1 ). At the same time, there was a significant difference in the prognosis of patients with renal clear cell carcinoma with different expression levels of lncRNAGACAT2. Kaplan-Meier survival analysis found that the survival rate of patients with renal clear cell carcinoma with high expression of lncRNAGACAT2 was significantly lower than that of patients with low expression (p=0.032)( Figure 2 ). The prognostic analysis of the multivariate Cox proportional hazard model found that the relative risk of lncRNAGACAT2 was >1, indicating that patients with high expression of lncRNAGACAT2 had a worse prognosis than those with low expression, and high expression of lncRNAGACAT2 was an independent risk factor for the prognostic risk prediction of patients with renal clear cell carcinoma. Therefore, lncRNAGACAT2 can be used as a specific molecular marker for the prognosis of patients with renal clear cell carcinoma, as a criterion for the prognosis of renal clear cell carcinoma, and used to prepare products for predicting the prognosis of renal clear cell carcinoma.

[0013] After rigorous and careful research, the present invention provides the use of lncRNAGACAT2 in the preparation of a product for predicting the prognosis of renal clear cell carcinoma, as well as primers or probes for detecting the combination, and further provides a product for predicting the prognosis of renal clear cell carcinoma. The product of the present invention can provide certain suggestions for the treatment of tumor patients and provide a reference for doctors' treatment selection, thereby reducing unnecessary treatments, achieving individualized treatment, and improving the patient's postoperative survival rate. In clinical treatment, after the diagnosis of renal clear cell carcinoma patients is confirmed, the detection of the above-mentioned lncRNAGACAT2 can provide a strong molecular biological basis for the prediction of the prognosis of renal clear cell carcinoma patients, quickly judge the patient's postoperative prognosis and sensitivity to postoperative auxiliary molecular targeted therapy, and select a suitable treatment plan based on the results to achieve individualized treatment, which has far-reaching clinical significance and promotion. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0015] Figure 1 This is a graph showing the difference in expression of lncRNAGACAT2 in renal clear cell carcinoma tissues and adjacent tissues analyzed by real-time fluorescence quantitative PCR;

[0016] Figure 2 This is a graph showing the relationship between lncRNAGACAT2 and the prognosis of 35 patients with renal clear cell carcinoma. DETAILED DESCRIPTION

[0017] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0018] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0019] In view of the fact that there is currently no reference standard or specific indicator for the prognosis of renal clear cell carcinoma, which is far from meeting the needs of prognosis determination for human renal clear cell carcinoma, the present invention proposes the use of lncRNAGACAT2 in the preparation of a product for predicting the prognosis of renal clear cell carcinoma.

[0020] A first typical embodiment of the present invention provides the use of lncRNAGACAT2 in preparing a product for predicting the prognosis of renal clear cell carcinoma, and the sequence of the lncRNAGACAT2 is shown in SEQ ID NO.1.

[0021] In some examples of this embodiment, the lncRNA GACAT2 is used as a detection target in the preparation of a product for predicting the prognosis of renal clear cell carcinoma using real-time quantitative PCR, reagents, kits or chips.

[0022] In some examples of this embodiment, the product for predicting the prognosis of renal clear cell carcinoma includes a real-time fluorescence quantitative PCR detection reagent.

[0023] In some examples of this embodiment, the real-time fluorescence quantitative PCR detection reagent includes specific primers for real-time fluorescence quantitative PCR;

[0024] The primer sequences are as follows:

[0025] lncRNAGACAT2 forward primer: 5′-CATTATCCTGAACCGCCACG-3′ (SEQ ID NO. 2);

[0026] lncRNAGACAT2 reverse primer: 5′-AGCCAGACTTCCTTCCAGAC-3′ (SEQ ID NO. 3).

[0027] A second typical embodiment of the present invention provides the use of specific primers or specific probe nucleotides for detecting the expression of lncRNAGACAT2 described in the first typical embodiment in the preparation of a product for predicting the prognosis of renal clear cell carcinoma.

[0028] In some examples of this embodiment, the product is selected from real-time quantitative PCR, reagents, kits or chips; wherein the kit includes real-time fluorescent quantitative PCR detection reagents, and the real-time fluorescent quantitative PCR detection reagents include the following:

[0029] (1) Reagents used to extract total RNA from renal clear cell carcinoma tissue;

[0030] (2) Reagents used to reverse transcribe lncRNAGACAT2 into cDNA using total RNA as a template;

[0031] (3) Reagents used for real-time fluorescence quantitative PCR using cDNA generated by reverse transcription.

[0032] Preferably, in (1), the reagents include Trizol reagent, chloroform, isopropanol, anhydrous ethanol, and enzyme-free sterile water.

[0033] Preferably, in (2), the reagents include reverse transcription reaction buffer solution, FQ-RTPrimermix, RTenzymemix and random primers used for lncRNAGACAT2.

[0034] Preferably, in (3), the reagents include lncRNA GACAT2 real-time fluorescence quantitative PCR specific primers, U6 snRNA internal reference PCR specific primers, real-time fluorescence quantitative SYBR dye, premix, RNase-FreeddH2O.

[0035] Further preferably, the nucleotide sequence of the U6snRNA internal reference PCR specific primer is as follows:

[0036] The forward primer is: 5′-ATTGGAACGATACAGAGAAGATT-3′ (SEQ ID NO. 4);

[0037] The reverse primer is: 5′-GGAACGCTTCACGAATTTG-3′ (SEQ ID NO. 5).

[0038] Further preferably, it is characterized in that the nucleotide sequence of the real-time fluorescence quantitative PCR specific primer is as follows:

[0039] Forward primer: 5′-CATTATCCTGAACCGCCACG-3′ (SEQ ID NO. 2);

[0040] Reverse primer: 5′-AGCCAGACTTCCTTCCAGAC-3′ (SEQ ID NO. 3).

[0041] A third typical embodiment of the present invention provides a product for predicting the prognosis of renal clear cell carcinoma, comprising real-time quantitative PCR, reagents, kits or chips for detecting the expression of lncRNAGACAT2 described in the first typical embodiment.

[0042] A fourth typical embodiment of the present invention provides a method for detecting the prognosis of a patient with renal clear cell carcinoma, comprising using the product for predicting the prognosis of renal clear cell carcinoma according to the third aspect. Specifically, it comprises:

[0043] (1) Collect renal clear cell carcinoma tissue and adjacent tissue removed after surgery and extract total RNA;

[0044] (2) lncRNAGACAT2 was reverse transcribed into cDNA using total RNA as a template;

[0045] (3) Real-time fluorescence quantitative PCR amplification was performed using lncRNAGACAT2 specific primers to obtain the relative expression level 2 -ΔΔCT , when 2 -ΔΔCT >7.46 indicated that lncRNAGACAT2 was highly expressed.

[0046] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0047] Example 1 lncRNA GACAT2 is used to prepare a kit for predicting the prognosis of patients with renal clear cell carcinoma (50 reactions)

[0048] 1. Isopropyl alcohol 100ml

[0049] 2. Chloroform 100ml

[0050] 3.Trizol 50ml

[0051] 4.RNase-Freed ddH2 O5ml

[0052] 5. 1μM random reverse transcription primer 50ul

[0053] 6. 10× reverse transcription buffer 100ml

[0054] 7. 10mM FQ-RT Primermix 100ul

[0055] 8. 200U / μlEnzymemix50ul

[0056] 9. 2×Premix 50ul

[0057] 10. 100μM lncRNA GACAT2 specific primer 30ul

[0058] Forward primer 5′-CATTATCCTGAACCGCCACG-3′ (SEQ ID NO. 2)

[0059] Reverse primer 5′-AGCCAGACTTCCTTCCAGAC-3′ (SEQ ID NO. 3)

[0060] 11. 100μM U6snRNA specific primer 30ul

[0061] The forward primer is 5′-ATTGGAACGATACAGAGAAGATT-3′ (SEQ ID NO. 4)

[0062] The reverse primer is 5′-GGAACGCTTCACGAATTTG-3′ (SEQ ID NO. 5).

[0063] Example 2 Detection of lncRNA GACAT2 in renal clear cell carcinoma tissue

[0064] 1. Storage of renal clear cell carcinoma tissue: Collect the renal clear cell carcinoma tissue to be tested and adjacent tissues, store them in cryopreservation tubes containing RNA stabilizing solution, and store them in a -80°C refrigerator.

[0065] 2. Extraction of RNA from tissues: Take about 150 mg of specimens and add 1.2 mL Trizol. After grinding and ultrasonic treatment, add 240 μl of chloroform to an EP tube, shake by hand and centrifuge at 4°C 12000g for 20 min; carefully transfer the upper aqueous phase to a new 1.5 mL EP tube, add an equal volume of isopropanol and gently mix, let stand at room temperature for 15 min, centrifuge at 4°C 12000g for 15 min; discard the supernatant, add 750 μl of ethanol diluted with 75% DEPC water and mix, resuspend the precipitate, centrifuge at 4°C 7500g for 8 min, discard the supernatant, repeat 2 times, dry at room temperature for 5 min, add 40-60 μl of DEPC water to dissolve RNA. It is convenient for Nanodrop to measure the concentration of RNA, the OD260 / 280 ratio is between 1.8-2.0, and store at -80°C.

[0066] 3. Reverse transcription: Use Tiangen's reverse transcription kit. The system for 20 μL reverse transcription reaction is as follows:

[0067]

[0068] Reverse transcription step 1: 42°C for 6 min

[0069]

[0070] Reverse transcription second step procedure: 42℃1h.

[0071] 4. Real-time fluorescence quantitative PCR using lncRNAGACAT2 specific primers: The lncRNAGACAT2 specific primer sequence was synthesized by Genewise Biotechnology Co., Ltd.

[0072] First, dilute the reverse transcription product cDNA by 2 times and mix well. The 20μL reaction system is as follows:

[0073]

[0074] Real-time fluorescence quantitative PCR reaction program: 94°C for 5 min, 40 cycles, 95°C for 15 s, and 60°C for 1 min.

[0075] The lncRNAGACAT2 specific primer sequences are:

[0076] F: 5'-CATTATCCTGAACCGCCACG-3'(SEQIDNO.2)

[0077] R: 5'-AGCCAGACTTCCTTCCAGAC-3'(SEQIDNO.3)

[0078] 5.2 -ΔΔCTDetermination of indicators: The experimental data were analyzed by relative quantitative analysis method, U6snRNA was used as the internal reference gene, and the data were analyzed by SPSS software. The analysis found that compared with adjacent tissues, the expression of lncRNAGACAT2 in 50 cases of renal clear cell carcinoma tissues was significantly upregulated, and the difference was statistically significant (P<0.001)( Figure 1 ).

[0079] 6. Prognostic analysis

[0080] Through the follow-up statistics of 50 patients with renal clear cell carcinoma used in the experiment, it was found that 15 patients could not be contacted during the follow-up due to mobile phone outage, number change or other reasons. Finally, 35 patients with renal clear cell carcinoma or their families could be contacted. These 35 patients or their families received subsequent follow-up analysis. The patients or their families were asked in detail about the time of first onset, treatment, recurrence and death, and the follow-up time was 1-61 months. Among the selected patients with renal clear cell carcinoma, the expression value of fluorescence quantitative PCR analysis was selected as the reference standard. After the results were arranged in descending order, those higher than the median were lncRNAGACAT2 high expression, a total of 20 cases, and the others were lncRNAGACAT2 low expression, a total of 15 cases. According to Kaplan-Meier survival analysis, patients with high expression of lncRNAGACAT2 had a shorter survival time and poorer prognosis than those with low expression of lncRNAGACAT2. The difference was statistically significant (P=0.032)( Figure 2 ). The prognostic analysis of the multivariate Cox proportional hazard model found that the relative risk of lncRNAGACAT2 was >1, indicating that patients with high expression of lncRNAGACAT2 had a worse prognosis than those with low expression. Therefore, high expression of lncRNAGACAT2 was an independent risk factor for predicting the prognostic risk of patients with renal clear cell carcinoma.

[0081] The above studies show that lncRNAGACAT2 can be used as a specific molecular marker for the prognosis of patients with renal clear cell carcinoma.

[0082] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Use of primers for detecting lncRNA GACAT2 in preparing a product for predicting the prognosis of renal clear cell carcinoma, wherein the sequence of the lncRNA GACAT2 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The product for predicting the prognosis of renal clear cell carcinoma includes a real-time fluorescence quantitative PCR detection reagent.

3. The use according to claim 1, characterized in that: The primer sequences are as follows: lncRNA GACAT2 forward primer: 5′- CATTATCCTGAACCGCCACG -3′ (SEQ ID NO. 2); lncRNA GACAT2 reverse primer: 5′- AGCCAGACTTCCTTCCAGAC -3′ (SEQ ID NO. 3).

4. Use of a specific probe for detecting the expression of lncRNA GACAT2 in the preparation of a product for predicting the prognosis of renal clear cell carcinoma, wherein the sequence of the lncRNA GACAT2 is shown in SEQ ID NO.

1.

5. The use according to claim 4, characterized in that: The product includes a kit or a chip; wherein the kit includes a real-time fluorescence quantitative PCR detection reagent, and the real-time fluorescence quantitative PCR detection reagent includes the following: (1) Reagents used to extract total RNA from renal clear cell carcinoma tissue; (2) Reagents used to reverse transcribe lncRNA GACAT2 into cDNA using total RNA as a template; (3) Reagents used for real-time fluorescence quantitative PCR of cDNA generated by reverse transcription.

6. The use according to claim 5, characterized in that: (1), the reagents include Trizol reagent, chloroform, isopropanol, anhydrous ethanol and enzyme-free sterile water; Or, in (2), the reagents include reverse transcription reaction buffer solution, FQ-RT Primer mix, RT enzyme mix, and random primers for lncRNA GACAT2; Or, in (3), the reagents include lncRNA GACAT2 real-time fluorescence quantitative PCR specific primers, U6snRNA internal reference PCR specific primers, real-time fluorescence quantitative SYBR dye, premix and RNase-Free ddH2O.

7. The use according to claim 6, characterized in that: The nucleotide sequence of the U6snRNA internal reference PCR specific primer is as follows: The forward primer was: 5′-ATTGGAACGATACAGAGAAGATT-3′ (SEQ ID NO. 4); The reverse primer is: 5′-GGAACGCTTCACGAATT TG-3′ (SEQ ID NO. 5).

8. The use according to claim 7, characterized in that: The nucleotide sequences of the real-time fluorescence quantitative PCR specific primers are as follows: Forward primer: 5′- CATTATCCTGAACCGCCACG -3′ (SEQ ID NO. 2); Reverse primer: 5′-AGCCAGACTTCCTTCCAGAC-3′ (SEQ ID NO. 3).

Images