Primer probe for detecting bcc by fluorescence quantitative PCR, design method and kit thereof
By using pan-genome data analysis and quantitative real-time PCR primer and probe design, the problems of rapid and accurate detection of Burkholderia in onions were solved, achieving detection results with high sensitivity and specificity.
Patent Information
- Application Number
- CN202211392337.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-08
- Publication Date
- 2025-12-30
- Estimated Expiration
- 2042-11-08
AI Technical Summary
Existing technologies struggle to rapidly and accurately detect the 23 species in Burkholderia cepacia (Bcc) of onions. Traditional culture methods are time-consuming and easily masked by other bacterial groups, while molecular methods lack universal targets, leading to detection difficulties.
Using pan-genome data analysis technology, common and exclusive conserved fragments covering the Bcc complex were screened out, and specific fluorescent quantitative PCR primers and probes were designed. Combined with a kit, high sensitivity and specificity of detection were achieved.
It achieves rapid and accurate detection of Bcc, with a sensitivity of 99.82% and a specificity of 100%, a detection time of less than 3 hours, and is simple to operate and has good repeatability.
Smart Images

Figure CN115992274B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a real-time quantitative PCR detection method for Burkholderia cepacia, particularly to the screening and probe design of 23 species-specific fragments of Burkholderia cepacia, and the application of the kit. Background Technology
[0002] The Burkholderia cepacia complex (Bcc) consists of 23 species of the genus Burkholderia, namely Burkholderia cepacia (… B. cepacia Burkholderia polyphaga ( ), B. multivorans Burkholderia neonsis ( ), B. cenocepacia ), stable Burkholderia ( B. stabilis Burkholderia viminalis ( B. vietnamiensis Burkholderia cunningi ( B. dolosa Burkholderia bifidum ( ) B. ambifaria Burkholderia gardenii ( ) B. anthina Burkholderia arsenicide ( ) B. pyrrocinia Burkholderia cryptotavia ( B. latens Burkholderia spp. ( ) B. diffusa Burkholderia forestosa ( ) B. arboris Burkholderia seed ( ) B. seminalis Burkholderia metalloids ( B. metallica Burkholderia ursenii ( ) B. ubonensis Burkholderia contamination ( B. contaminans Burkholderia commonis ( ) B. lata Burkholderia fowleri ( ), B. stagnalis Burkholderia territorialis ( ) B. territorri ), Pseudomonas dobkiformis ( B. pseudomultivorans Burkholderia purpurea ( ), pure water Burkholderia ( B. puraquae Burkholderia marcescens ( ) B. paludis Burkholderia mysterio ( B. aenigmaticaBurkholderia cepacia (BCC) is opportunistically pathogenic to certain populations. It can be transmitted through aerosol particles, direct physical contact between infected individuals and patients, or contact with contaminated surfaces. Infections include specific populations such as patients with cystic fibrosis (CF) and immunocompromised individuals with long-term hospitalization. Symptoms can include bacteremia, urinary tract infections, infectious arthritis, peritonitis, and pneumonia. Statistical analysis of FDA recall data from 1998 to 2006 found that 22% of non-sterile product recalls were due to Burkholderia cepacia complex contamination, rising to 34% between 2004 and 2011. BCC ranks first among non-sterile drug recalls due to microbial contamination, largely due to the challenges of end-point hygiene control.
[0003] In October 2022, the Center for Drug Evaluation of the National Medical Products Administration (NMPA) issued the "Technical Guidelines for Microbial Limit Studies of Non-Sterile Chemical Drugs and Raw Materials (Draft for Comments)," which explicitly requires that "for inhaled formulations and oral, mucosal, and nasal aqueous solutions of non-sterile preparations, risk management and control studies of Burkholderia cepacia should be conducted with reference to relevant technical requirements, and corresponding control strategies should be formulated. If necessary, BCC should be included in product release / shelf life standards." To achieve process control and end-product detection of BCC, specialized methods are required. BCC grows relatively slowly and is easily masked by other rapidly growing microbial communities, making it difficult to screen using traditional culture methods. To isolate BCC from products, USP42... <60> The "Microbial Testing of Non-Sterile Products - Burkholderia Complex Test" provides a method for using BCSA selective medium. This method changes the previous situation where BCC was undetectable and promotes end-point control of BCC. However, it still has the disadvantages of long cycle time, limited application in process control, and a certain probability of false positives (e.g., Flavobacterium spp., Ralstonia spp., Burkholderia gladioli can grow on BCSA selective medium).
[0004] Molecular methods offer higher sensitivity, stability, and convenience, and have been widely used in clinical, food, and other fields, showing potential as an alternative method for drug microbial detection. However, the challenge in applying molecular methods to BCC detection lies in the fact that BCC is not a single species, but a complex group comprising 23 species with high genetic diversity, making the identification of a universal target challenging. Summary of the Invention
[0005] To overcome the shortcomings of existing technologies, this invention develops a large-scale pan-genome data analysis technology. The genomes of 23 BCC target species are broken into overlapping fragment groups. Using non-target genomes as controls, common and exclusive conserved fragments covering the entire Bcc complex are obtained. Based on these fragments, a nucleic acid identification kit, DM-BCC Quester, is developed.
[0006] A primer and probe design method for quantitative real-time PCR detection of BCC.
[0007] 1) Prepare a positive set of genomes for screening BCC species-specific DNA fragments, containing 871 genomes covering all 23 BCC species; prepare a negative set of genomes of non-BCC species, containing 19,183 genomes covering 13,708 species and 3,092 genera.
[0008] 2) Based on the BCC positive set genome, core conserved sequences were screened using RUCS software, and amplification primers were designed for the core conserved sequences with the following parameters: product length 120-200 bp, k-mer set to 20.
[0009] 3) Verification of the core conserved sequence and amplification primers
[0010] Primers were validated using the software mfeprimer v3.2.4. The validation database included 1,127 positive genomes, covering all 23 BCC species, and 61,927 negative genomes, covering 11,481 species and 2,807 genera.
[0011] 4) Taqman probe design: simulate the extraction of corresponding amplification products from all BCC genomes, set the kmer to 15-35bp, and count the kmers with 0 mismatches with all positive amplification products and >= 1 mismatches with negative amplification products as probe sequences, thereby obtaining probe sequences;
[0012] 5) Evaluation of amplification primers and probes, using the Wilson method to statistically analyze the specificity and sensitivity of primers, primer + probe, and primer + probe + length filtering;
[0013] Step 2) yields the core conserved sequence as shown in SEQ ID No. 1;
[0014] Based on the core conservative sequence
[0015] The forward amplification primer sequence is: CAAGGTCGAGGAAGGCAAGAA, as shown in SEQ ID No. 2;
[0016] The reverse amplification primer sequence is: CCGGGCACAACCTTTTCTTTG, as shown in SEQ ID No. 3.
[0017] The probe sequence obtained in step 4) of the primer and probe design method is: TACTGAGCGCCTGACGCAG, as shown in SEQ ID No. 4.
[0018] In step 5) of the primer and probe design method described above, the sensitivity reaches 99.82 (CI 99.36-99.95) and the specificity reaches 100.00 (CI 99.99-100.00) according to in-silico verification.
[0019] A primer and probe for detecting BCC using real-time PCR.
[0020] The forward amplification primer sequence is: CAAGGTCGAGGAAGGCAAGAA, as shown in SEQ ID No. 2;
[0021] The reverse amplification primer sequence is: CCGGGCACAACCTTTTCTTTG; as shown in SEQ ID No. 3;
[0022] The fluorescent probe sequence is: TACTGAGCGCCTGACGCAG, as shown in SEQ ID No. 4.
[0023] A kit for detecting BCC based on real-time PCR technology, using the aforementioned primer and fluorescent probe combination, wherein the forward amplification primer sequence is: CAAGGTCGAGGAAGGCAAGAA, as shown in SEQ ID No. 2;
[0024] The reverse amplification primer sequence is: CCGGGCACAACCTTTTCTTTG, as shown in SEQ ID No. 3;
[0025] The fluorescent probe sequence is: TACTGAGCGCCTGACGCAG, as shown in SEQ ID No. 4; the 5' end of the fluorescent probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.
[0026] The reagent kit described herein contains a fluorescent group of FAM and a quenching group of BHQ1.
[0027] The kit includes a control probe labeled with a fluorescent group VIC at the 5' end and a quencher group BHQ1 at the 3' end; the sequence is CTTGCTCGCGTAATTAATGACAAGACGC, as described in SEQ ID No. 5.
[0028] The kit contains PCR buffer, Taq enzyme, dNTPs, and Mg. 2+ Solution.
[0029] The kit includes a standard positive template, a negative template, and a control amplification template. The positive template is a constructed standard positive plasmid, the negative template is sterile double-distilled water, and the control amplification template sequence is shown in SEQ ID No. 6.
[0030] The beneficial effects of this invention are:
[0031] Accurate nucleic acid identification of specific microbial species requires well-designed amplification primers and probes. This invention establishes a set of specific primers covering 23 species of BCC based on pan-genome data. Computer-simulated PCR validation was performed on 1127 positive strains (inclusively) and over 61927 non-target genomes (exclusively), overcoming the drawback of low confidence due to small sample sizes. The diagnostic sensitivity and specificity reach 99.82% and 100%, respectively. Built-in insilico-designed cross-reaction-free Spike-in controls and positive controls provide more reliable quality control for the test results. The cycle time is short, with results obtained in as little as 2-3 hours (low-concentration samples may require an additional 6-hour enrichment step). The operation is simple and reproducible. Attached Figure Description
[0032] Figure 1 This is a flowchart of the present invention.
[0033] Figure 2 This is the result of the lowest detection limit;
[0034] In the figure, 1: 4.0 × 10 4 copy / μL; 2: 4.0×10 3 copy / μL; 3: 4.0×10 2 copy / μL; 4: 4.0×10 1 5: 4.0 copy / μL; 6: 0.4 copy / μL; 7: Blank control.
[0035] Figure 3 This is the lowest detection limit result after enrichment.
[0036] In the figure, 1: 7.8 × 10 4 CFU / mL; 2: 7.8 × 10 3 CFU / mL; 3: 7.8 × 10 2 CFU / mL; 4: 7.8 × 10 1CFU / mL; 5: 7.8 CFU / mL; 6: 0.78 CFU / mL; 7: Blank control.
[0037] Figure 4 This is a result of a specific experiment. Detailed Implementation
[0038] The present invention will be further described below with reference to the accompanying drawings and embodiments.
[0039] A primer and probe design method for detecting Burkholderia cepacia in onions based on real-time quantitative PCR (RT-PCR) Figure 1 ):
[0040] 1) Prepare genome files for screening BCC species-specific DNA fragments as a positive set, containing 871 genomes covering 23 BCC species; and prepare genomes of non-BCC species as a negative set, containing 19,183 genomes covering 13,708 species and 3,092 genera.
[0041] Table 1. Primer Design Positive Genome Set
[0042] Species Number of available genomes Burkholderia aenigmatica 1 Burkholderia ambifaria 9 Burkholderia anthina 1 Burkholderia arboris 1 Burkholderia cenocepacia 267 Burkholderia cepacia 129 Burkholderia contaminans 19 Burkholderia diffusa 13 Burkholderia dolosa 4 Burkholderia lata 3 Burkholderia latens 1 Burkholderia metallica 2 Burkholderia multivorans 205 Burkholderia paludis 1 Burkholderia pseudomultivorans 11 Burkholderia puraquae 1 Burkholderia pyrrocinia 5 Burkholderia seminalis 6 Burkholderia stabilis 4 Burkholderia stagnalis 101 Burkholderia territorii 35 Burkholderia ubonensis 4 Burkholderia vietnamiensis 48
[0043] 2) Based on the Bcc positive set genome, core conserved sequences were screened using RUCS software, and amplification primers were designed for these sequences with the following parameters: product length 120-200 bp, k-mer set to 20.
[0044] The core conserved sequence is shown in SEQ ID No. 1:
[0045] CAAGGTCGAGGAAGGCAAGAAGGTTCGCTTCCTGAAGACGACCGGTGCCGTACTGAGCGCCTGACGCAGCGGAGTAAAAAATGGCTCGTTTTCAAGAGTTTTACAAAGAAAAGGTTGTGCCCGG;
[0046] The forward primer sequence is: CAAGGTCGAGGAAGGCAAGAA, as shown in SEQ ID No. 2;
[0047] The reverse primer sequence is: CCGGGCACAACCTTTTCTTTG, as shown in SEQ ID No. 3.
[0048] 3) Validation of the core conserved sequence and amplification primers. Primers were validated using mfeprimer v3.2.4 software. The validation database included a positive genome set of 1127 genomes (containing all 23 BCC species) and a negative genome set (non-BCC) totaling 61927 genomes (containing 11481 species, covering 2807 genera). The core conserved sequence obtained through screening includes the downstream region of rplX (50S ribosomal protein L24) and the upstream region of rplE (50S ribosomal protein L5), as well as sequences from two intergenic regions.
[0049] 4) Taqman probe design. A script was written to extract the corresponding amplification products from each positive genome. The kmer (length range: 15-35bp) was set, and the kmer with 0 mismatches with all positive amplification products and >= 1 mismatch with negative amplification products was selected as the probe sequence. The final probe sequence obtained is: TACTGAGCGCCTGACGCAG, as shown in SEQ ID No. 4.
[0050] 5) Evaluation of amplification primers and probes. A self-developed script was used to statistically analyze the specificity and sensitivity of primers, primer + probe, and primer + probe + length filtering using the Wilson method. Validated using in-silico assays, the sensitivity reached 99.82 (CI 99.36-99.95), and the specificity reached 100.00 (CI 99.99-100.00).
[0051] Establishment of Burkholderia onion microbiota real-time PCR kit
[0052] 1) This invention provides a primer and fluorescent probe combination for detecting Bcc based on real-time PCR technology. The primers include forward primers, reverse primers, probes and control probes, as shown in Table 2.
[0053] The probe is labeled with a fluorescent group at its 5' end and a quenching group at its 3' end; the fluorescent group includes
[0054] FAM, wherein the quenching group includes BHQ1.
[0055] The control probe has the sequence shown in SEQ ID No. 5, with a fluorescent group labeled at the 5' end and a quenching group labeled at the 3' end; the fluorescent group includes VIC and the quenching group includes BHQ1.
[0056] Table 2. Probe List for Bcc Quantitative Fluorescence Reagent Kit
[0057]
[0058] 2) This invention provides a real-time quantitative PCR detection kit for Streptococcus pneumoniae nucleic acid, comprising the primers and fluorescent probes described above.
[0059] The kit also includes PCR buffer, Taq enzyme, dNTPs, and Mg. 2+ wait.
[0060] Preferably, the kit further includes a standard positive template, a negative template, and a control amplification template. The positive template is a constructed standard positive plasmid, the negative template is sterile double-distilled water, and the control amplification template sequence is:
[0061] CAAGGTCGAGGAAGGCAAGAATGATTTAGAACTTGCTCGCGTAATTAATGACAAGACGCAGTCCGCGAGTCATGTCGTGGCAGCAGAGGAGTCCTTCGCTTGGCAAAGAAAAGGTTGTGCCCGG, as shown in SEQ ID No. 6.
[0062] The same primer sequence is used as the control template sequence, and the original template is reversed (non-complementary) to synthesize a sequence not found in nature, reducing the possibility of cross-reaction.
[0063] 3) The present invention also provides a TaqMan real-time quantitative PCR method for detecting Streptococcus pneumoniae, especially using the above-mentioned primers and probes, or the kit described above, to perform TaqMan real-time quantitative PCR detection of Bcc.
[0064] The aforementioned method includes the following steps:
[0065] A. Extract and purify total bacterial DNA from bacterial strains or tissue samples;
[0066] B. Using the total DNA from step A as a template, perform PCR amplification using the primers and probes described above;
[0067] C. Preparation of standard products;
[0068] D. Selection of reaction system and reaction parameters;
[0069] E. Plotting the standard curve;
[0070] F. Conduct tests on specific samples.
[0071] Example 1: Determination of the lowest detection limit for quantitative real-time PCR:
[0072] a) Burkholderia cepacia (ATCC 25416) was inoculated in tryptic soybean liquid medium (TSB) and cultured for 48 hours. DNA was extracted from 1 mL of the bacterial culture.
[0073] b) DNA was extracted using the TaKaRa bacterial genomic DNA extraction kit and labeled using a digital PCR instrument. The DNA solution was serially diluted 10-fold: 0.4 copy / μL, 4.0 copy / μL, 4.0 × 10⁻⁶ copies / μL, and 4.0 × 10⁻⁶ copies / μL. 1 copy / μL, 4.0×10 2 copy / μL, 4.0×10 3 copy / μL, 4.0×10 4 copy / μL.
[0074] c) Quantitative real-time PCR was performed on DNA solutions of various concentrations, with a blank control set up using ribozyme-free water instead of template. PCR amplification was performed using an ABI real-time quantitative PCR instrument. The amplification system consisted of: 10 μL of 2×Premix Ex Taq, 250 nM each of forward and reverse primers, 125 nM of probe, 2 μL of template, and 20 μL of ribozyme-free water. Reaction conditions: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 60℃ annealing and extension for 30 s, for 40 cycles. Each sample was replicated in duplicate.
[0075] d) After quantitative real-time PCR, the Ct value for each concentration is obtained. This value corresponds to the cycle number at which the fluorescence signal is first detected. Figure 2 This indicates that the detection method established in this invention can accurately detect Burkholderia in samples, and the detection limit is 4.0 copy / μL.
[0076] Example 2: Limit of Detection (LOD) Determination for Quantitative Real-Time PCR (Enrichment):
[0077] a) Burkholderia cepacia (ATCC 25416) was used as the model bacterium for the limit of detection. Burkholderia cepacia was cultured in tryptic soy peptone broth for 48 hours, and after 10-fold serial dilutions, the bacterial concentration at each dilution was obtained by plate counting: 7.8 × 10⁻⁶. -1 CFU / mL, 7.8 CFU / mL, 7.8×10 1 CFU / mL, 7.8×10 2 CFU / mL, 7.8×10 3 CFU / mL, 7.8×10 4 CFU / mL. Enrichment cultures of all concentrations were incubated at 30°C for 5 hours.
[0078] b) Genomic DNA was extracted from bacterial suspensions of different concentrations using the TaKaRa bacterial genomic DNA extraction kit;
[0079] c) PCR amplification was performed using an ABI real-time quantitative PCR instrument, with the amplification system and reaction conditions as described above. Two replicates were performed for each sample.
[0080] d) After quantitative real-time PCR, the Ct value for each concentration is obtained. This value corresponds to the cycle number at which the fluorescence signal is first detected. Figure 3 This indicates that the detection method established in this invention can accurately detect Burkholderia in samples, and the detection limit is 7.8 CFU / mL.
[0081] Example 3 Specificity Experiment
[0082] Positive strains: 8 species and 18 strains of BCCs; negative strains: 3 non-BCC strains within the Burkholderia genus, and 24 strains of other genera (see Table 1). PCR amplification was performed using an ABI real-time quantitative PCR instrument, with the reaction system and conditions as described above, and a blank control was set up. The results showed that specific amplification signals were detected only in the BCCs reaction tubes, while no fluorescence signal accumulation was observed in the other reaction tubes, indicating that this method has good specificity. Figure 4 ).
[0083] Table 1. Information on specific experimental strains. All isolates were identified by whole-genome sequencing.
[0084] Serial number Number Species Classification Strain number 1 SB0041 BCC ATCC 25416 2 SB0042 BCC ATCC BAA-245 3 SB0043 BCC ATCC BAA-247 4 SB0064 BCC CICC23882 5 SB0065 BCC CCTCC AB2014336 6 BJ2020689 BCC Isolate 7 BJ2020672 BCC Isolate 8 BJ2020421 BCC Isolate 9 BJ2020558 BCC Isolate 10 BJ2020584 BCC Isolate 11 BJ2020507 BCC Isolate 12 BJ2020629 BCC isolates 13 BJ20201065 BCC isolates 14 BJ2020490 BCC isolates 15 BJ2020567 BCC isolates 16 BJ2020361 BCC isolates 17 BJ2020362 BCC isolates 18 BJ2020492 BCC isolates 19 SB0004 CMCC(B)28001 20 SB0012 ATCC 17802 21 SB0013 ATCC 14028 22 SB0014 ATCC 13124 23 SB0015 ATCC 13525 24 SB0017 ATCC 25923 24 SB0020 =ATCC19115 26 SB0021 ATCC 29212 27 SB0023 CMCC(B)44102 28 SB0030 CMCC(B)10104 29 SB0031 CMCC(B)64941 30 SB0033 ATCC 21059 31 SB0035 =ATCC 29544 32 SB0038 CMCC(B)63501 33 SB0044 Non-BCC JCM 5492 34 SB0045 JCM5969 35 SB0050 JCM11652 36 SB0052 JCM11455 37 SB0054 JCM12372 38 SB0055 JCM2831 39 SB0056 JCM15909 40 SB0058 JCM1132 41 SB0059 CMCC10104 42 SB0068 Non-BCC CGMCC1.3360 43 SB0069 Non-BCC DSM25160 44 SB0070 CGMCC1.3145 45 BJ20200606 isolates
[0085] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the appended claims.
Claims
1. A primer probe design method for fluorescent quantitative PCR detection of BCC, characterized in that, 1) Prepare the genome for screening BCC species-specific DNA fragments as a positive set, containing 871 genomes, covering all 23 BCC species; non-BCC species genomes as a negative set, containing 19183 genomes, covering 13708 species and 3092 genera; 2) Based on the BCC positive set genome, use RUCS software to screen the core conservative sequence, and then design the amplification primer according to the core conservative sequence. The parameter setting is: product length 120-200 bp, k-mer setting 20; 3) Verification of core conservative sequence and amplification primer Use software mfeprimer v3.2.4 to verify the primer, and the verification database includes 1127 positive genomes containing all 23 BCC species, and 61927 negative genomes containing 11481 species covering 2807 genera; 4) Taqman probe design, simulate extracting the corresponding amplification product in all BCC genomes, set kmer to 15-35bp, and count the kmer with 0 mismatch number for all positive amplification products and >=1 mismatch number for negative amplification products as probe sequence, thereby obtaining the probe sequence; 5) Evaluation of amplification primer and probe, use Wilson method to calculate the specificity and sensitivity index of primer, primer+probe, and primer+probe+length filter; The core conservative sequence obtained in step 2) is shown as SEQ ID No. 1; According to the core conservative sequence, the forward amplification primer sequence is CAAGGTCGAGGAAGGCAAGAA, as shown in SEQ ID No. 2; The reverse amplification primer sequence is CCGGGCACAACCTTTTCTTTG, as shown in SEQ ID No.
3. The probe sequence obtained in step 4) is TACTGAGCGCCTGACGCAG, as shown in SEQ ID No.
4.
2. The primer probe design method of claim 1, wherein, According to in-silico verification in step 5), the sensitivity reaches 99.82, CI 99.36-99.95, and the specificity reaches 100.00, CI 99.99-100.
00.
3. The primer probe design method of claim 1, wherein, 4. A primer and fluorescent probe combination for fluorescent quantitative PCR detection of BCC, characterized in that, The forward amplification primer sequence is CAAGGTCGAGGAAGGCAAGAA, as shown in SEQ ID No. 2; The reverse amplification primer sequence is CCGGGCACAACCTTTTCTTTG, as shown in SEQ ID No. 3; The fluorescent probe sequence is TACTGAGCGCCTGACGCAG, as shown in SEQ ID No.
4. Use the primer and fluorescent probe combination according to claim 4, wherein the forward amplification primer sequence is CAAGGTCGAGGAAGGCAAGAA, as shown in SEQ ID No. 2; 5. A kit for detecting BCC based on the technique of quantitative fluorescence PCR, characterized by, The reverse amplification primer sequence is CCGGGCACAACCTTTTCTTTG, as shown in SEQ ID No.
3. The fluorescent probe sequence is TACTGAGCGCCTGACGCAG, as shown in SEQ ID No. 4; the 5 end of the fluorescent probe is labeled with a fluorescent group, and the 3 end is labeled with a quenching group.
6. The kit of claim 5, wherein The fluorescent group is FAM, and the quenching group is BHQ1.
7. The kit of claim 5, wherein A control probe is provided, which is labeled with a fluorescent group VIC at the 5 end and a quenching group BHQ1 at the 3 end; the sequence is CTTGCTCGCGTAATTAATGACAAGACGC, as shown in SEQ ID No.
5.
8. The kit of claim 5, wherein PCR buffer, Taq enzyme, dNTPs, Mg 2+ solution.
9. The kit of claim 5, wherein Standard positive templates, negative templates and control amplification templates are provided, the positive template is a standard positive plasmid constructed, the negative template is sterilized double distilled water, and the sequence of the control amplification template is shown in SEQ ID No. 6.
Citation Information
Patent Citations
Specific detection target of BCC (Burkholderia cepacia complex) and constant-temperature rapid detection method
CN113699257A
Insertion sequence from a virulent isolate of Burkholderia cepacia, and diagnostic and identification procedures based thereon
US6171789B1