Use of synthetic AAV capsids in gene therapy for muscle and central nervous system disorders

Abstract

This invention relates to the use of recombinant porcine adeno-associated virus (AAV) vectors containing peptide-modified porcine AAV serotype 1 (AAVpo1) capsids in gene therapy for muscle and / or central nervous system (CNS) disorders, particularly neuromuscular diseases such as hereditary neuromuscular diseases.

Description

Technical Field

[0001] This invention relates to the use of a recombinant porcine adeno-associated virus (AAV) vector containing a peptide-modified porcine AAV serotype 1 (AAVpo1) capsid in gene therapy for muscle and / or central nervous system (CNS) disorders, particularly neuromuscular diseases such as hereditary neuromuscular diseases. Background Technology

[0002] Recombinant adeno-associated virus (rAAV or AAV) vectors are widely used in vivo ( in vivo Gene transfer is being performed, and clinical trials using AAV vectors to treat a variety of diseases are currently underway.

[0003] The AAV vector is a non-enveloped vector composed of a 20 nm diameter capsid and 4.7 kb of single-stranded DNA. The genome carries two genes, rep and cap, flanked by two palindromic regions called inverted terminal repeats (ITRs). The cap gene encodes three structural proteins that make up the AAV capsid: VP1, VP2, and VP3. VP1, VP2, and VP3 share a common C-terminus, the entire VP3. For reference, VP1 has a 735-amino acid sequence (GenBank YP_680426); VP2 (598 amino acids) begins at threonine 138 (T138), and VP3 (533 amino acids) begins at methionine 203 (M203).

[0004] Tissue specificity is determined by capsid serotype, and commonly used AAV serotypes isolated from humans (AAV2, 3, 5, 6) and non-human primates (AAV1, 4, 7-11) can transduce specific organs more effectively than other serotypes, such as AAV6, AAV8, AAV9, and AAV-rh74 in muscle tissue, and AAV2, AAV9, AAVrh10, AAVcy.10, AAV-PHP.B, AAV-PHP.EB, and clade F AAVHSC (such as AAVHSC7, AAVHSC15, and AAVHSC17) in nerve tissue.

[0005] However, all commonly used naturally occurring AAV serotypes and variants tested to date have a tendency to accumulate in the liver. This presents problems, particularly when AAV vectors are administered systemically. First, transgenes intended for expression in muscle may be hepatotoxic. Second, AAV vectors entering the liver reduce the amount of vector available to muscle or nerve tissue. Therefore, higher doses of AAV vectors are required. This increases the likelihood of inducing hepatotoxicity and the cost of vector production.

[0006] Furthermore, pre-existing immunity to AAV is a disadvantage of commonly used AVV vector serotypes isolated from humans and non-human primates, especially AAV2, which is seropositive in up to 80% of the human population, as well as other serotypes (Fu et al., Hum Gene Ther Clin Dev., 2017 Dec; 28(4): 187-196; Stanford et al., Res PractThromb Haemost., 2019, 3: 261-267°).

[0007] Recombinant AAV vectors have been generated using capsids derived from different porcine AAVs (AAVpo1, po2.1, po4 to 6) and administered systemically in mice. AAVpo1 was reported to have strong transgenic expression in all major skeletal muscle types, as well as poor transduction in other tissues, including complete detargeting from the liver. AAVpo2.1 also detargeted from the liver after peripheral administration, while AAVpo4 and AAVpo6 effectively transduced samples from all major organs, including the brain. Porcine AAV vectors are not cross-neutralized by antisera generated against all other commonly used AAVs or conjugated human IgGs (Bello et al., Gene Therapy, 2009, 16, 1320-1328. doi: 10.1038 / gt.2009.82; Bello et al., Sci Rep., 2014, 4, 6644, DOI: 10.1038 / srep06644; Tulalamba et al., Gene Therapy, 2019, doi.org / 10.1038 / s41434-019-0106-3; Puppo et al., PLOS ONE, 2013, 8, e59025; WO 2009 / 030025). In summary, this makes recombinant porcine AAV vectors, particularly liver-detargeted AAVpo1 and AAVpo2.1, attractive vectors for human gene therapy of muscle diseases. However, while the transgene expression levels in muscle obtained using recombinant porcine AAV vectors were high, they were still 2-3 times lower than those of AAV9, which is generally considered the gold standard for muscle-targeted gene therapy. Furthermore, AAVpo1 and AAVpo2.1 have been reported to have lower brain transduction efficiency.

[0008] Libraries of AAV capsid variants displaying short peptides on the surface of various AAV serotypes have been generated to screen gene therapy vectors with altered cell specificity and / or transduction efficiency (Börner et al., Molecular Therapy, April 2020, 28, 1017-1032; Kienle EC (Dissertation for the degree of Doctor of Natural Sciences, Combined Faculties for the Natural Sciences and for Mathematics of the Ruperto-Carola University of Heidelberg, Germany, 2014; WO2018 / 189244). Peptide-modified AAV1, 7-9, rh10, and DJ capsids have been reported to be effective in in vitro transduction of human T cell lines, primary human macrophages, hepatocytes, and astrocytes. Peptides sharing the motif NXXRXXX (SEQ ID NO: 12) are disclosed as enhancing in vitro transduction to multiple cell types in the presence of multiple AAV serotypes.

[0009] With the ability to effectively transduce different muscle groups and the central nervous system, AAV vectors that can be selectively and safely delivered systemically will be beneficial for gene therapy of many human diseases. Summary of the Invention

[0010] The inventors have used a recombinant porcine adeno-associated virus (AAV) vector containing a peptide-modified capsid protein from porcine AAV serotype 1 (AAVpo1) to deliver a targeted therapeutic gene via systemic administration in mice. Several optimal AAV vector serotypes commonly used for muscle (AAV8, AAV9) or central nervous system (CNS) transduction (AAV9, AAVrh10) were also tested for comparison. The inventors surprisingly found that the peptide-modified AAVpo1 vector advantageously achieved transgene expression levels in various muscle groups and the central nervous system (brain and spinal cord), at least comparable to, if not higher than, the AAV9 vector, while simultaneously detargeting the liver. Furthermore, this porcine AAV vector was not expected to be neutralized by pre-existing antibodies against common AAVs (human and non-human primate AAVs). For all the reasons mentioned above, the use of this peptide-modified AAVpo1 vector represents a more effective, selective, and potentially safer approach for gene therapy of muscle and / or CNS disorders, particularly neuromuscular diseases such as hereditary neuromuscular diseases. In some embodiments, the peptide-modified AAVpo1 vector is used to target nervous system cells or nervous system cells and muscle cells for the treatment of nervous system diseases and neuromuscular diseases, particularly hereditary nervous system diseases and hereditary neuromuscular diseases.

[0011] Therefore, one aspect of the present invention relates to a recombinant porcine adeno-associated virus (AAV) vector for gene therapy of muscle and central nervous system (CNS) disorders, comprising a peptide-modified capsid protein derived from porcine AAV serotype 1; particularly nervous system disorders and neuromuscular disorders affecting the nervous system, such as CNS disorders and neuromuscular disorders affecting the CNS.

[0012] In some embodiments, the recombinant porcine AAV vector according to the invention for its use is characterized by a combination of detargeting and transgenic expression levels in different muscle groups, as well as in the brain and spinal cord, after systemic administration, particularly intravenous administration, which is at least equivalent to the AAV9 vector if not superior to it.

[0013] In some embodiments, the peptide-modified capsid protein comprises at least one peptide containing the sequence MPLGAAG (SEQ ID NO:2) or a variant containing only one or two amino acid mutations (insertions, deletions, substitutions) in the sequence, preferably containing one or two amino acid substitutions. In some preferred embodiments, the peptide comprises the sequence GMPLGAAGA (SEQ ID NO:3), or a variant containing up to four (1, 2, 3, or 4) amino acid mutations (insertions, deletions, substitutions) in the sequence, preferably containing only one or two amino acid deletions or substitutions, with the deletion located at the N- and / or C-terminus being advantageous. In some preferred embodiments, the sequence SEQ ID NO:2 or 3 or a variant thereof is side-joined with up to five amino acids at its N- and / or C-terminus, for example, GQR and GAA at its N- and C-terminus, respectively. In some more preferred embodiments, the peptide comprises or consists of the sequence GQRGMPLGAAGAQAA (SEQ ID NO:4).

[0014] In some embodiments, the peptide is inserted between residues N567 and S568 or between residues N569 and T570 of the capsid protein; the position is determined by comparison with SEQ ID NO:1. Preferably, the peptide is inserted between position N567 and S568, replacing all residues from positions 565-567 and 568-570, or the peptide is inserted between position N569 and T570, replacing all residues from positions 567-569 and 570-572; the position is determined by comparison with SEQ ID NO:1.

[0015] In some preferred embodiments, the peptide-modified AAVpo1 capsid protein comprises a sequence selected from the group consisting of: sequence SEQ ID NO:5 and sequences having at least 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO:5, comprising the peptide according to this disclosure, and a fragment corresponding to the VP2 or VP3 capsid protein.

[0016] In some implementations, the recombinant porcine AAV vector is a vector particle packaged with a target gene for treatment.

[0017] In some preferred embodiments, the target gene is operatively linked to a promoter that is functional in neurons and / or glial cells.

[0018] In some preferred embodiments, the target gene for treatment is selected from:

[0019] (i) Therapeutic genes;

[0020] (ii) Genes encoding therapeutic proteins or peptides, such as therapeutic antibodies or antibody fragments and genome editing enzymes; and

[0021] (iii) Genes encoding therapeutic RNA, such as interfering RNA, guide RNA for genome editing, and antisense RNA capable of exon skipping.

[0022] In some embodiments, the disease is a neuromuscular disease, preferably a hereditary neuromuscular disease. Preferably, the disease is a neuromuscular disease affecting the nervous system, and more preferably a hereditary neuromuscular disease affecting the nervous system.

[0023] In some embodiments, the hereditary neuromuscular disease is selected from the group consisting of: (i) myopathy, such as hereditary cardiomyopathy, metabolic myopathy, other myopathy, distal myopathy, muscular dystrophy, and congenital myopathy; and (ii) spinal muscular atrophy (SMAs) and motor neuron disease; preferably congenital myopathy and muscular dystrophy, and spinal muscular atrophy (SMAs) and motor neuron disease.

[0024] In some embodiments, the target gene for treatment is a functional version of a gene selected from the group that causes hereditary neuromuscular disorders: Duchenne muscular dystrophy, Becker muscular dystrophy, limb-girdle muscular dystrophy, myotonic dystrophy, myotubular myopathy, central nucleus myopathy, rod body myopathy, selenoprotein N-related myopathy, Pompe disease, glycogen storage disease III, spinal muscular atrophy, amyotrophic lateral sclerosis, or a therapeutic RNA targeting the gene that causes the disease.

[0025] In some implementations, the gene causing the hereditary neuromuscular disorder is selected from the group consisting of: DMD, CAPN3 DYSF, FKRP, ANO5, MTM1, DNM2, BIN1, ACTA1, KLHL40, KLHL41, KBTBD13, TPM3, TPM2, TNNT1, CFL2, LMOD3, SEPN1, GAA, AGL, SMN1 and ASAH1 Gene.

[0026] In some preferred embodiments, the hereditary neuromuscular disease is selected from the group consisting of: (i) myopathy, such as muscular dystrophy including congenital muscular dystrophy; (ii) spinal muscular atrophy (SMAs) and motor neuron disease; (iii) myotonic syndrome, particularly myotonic dystrophy type 1 and type 2; (iv) hereditary motor and sensory neuropathy; (v) hereditary paraplegia and hereditary ataxia; and (vi) congenital myasthenia gravis; preferably congenital myasthenia gravis, including muscular dystrophy, spinal muscular atrophy (SMAs), and motor neuron disease.

[0027] In some preferred embodiments, the target gene for treatment is a functional version of a gene selected from the group consisting of genes that cause hereditary neuromuscular disorders affecting the nervous system: Duchenne muscular dystrophy and Becker muscular dystrophy. DMD base because ); Limb-girdle muscular dystrophy ( DYSF and FKRP genes Myotonic dystrophy type 1 ( DMPK gene ) and Type 2 ( CNBP / ZNF9 gene ); Central nucleus myopathy ( DNM2 and BIN1 genes Pompe disease GAA gene ); Glycogen storage disease III ( AGL gene Spinal muscular atrophy ( SMN1 and ASAH1 genes Amyotrophic lateral sclerosis (ALS) SOD1, ALS2, SETX, FUS, ANG, TARDBP, FIG4, OPTN and others Hereditary paraplegia SPAST (SPG4) , SPG7 Other SPG Genes, such as SPG11 SPG20 and SPG21 ); Peroneal muscular atrophy, type 4B1 ( MTMR2 ), and congenital myasthenia gravis ( CHAT, AGRN ), or therapeutic RNA targeting the genes that cause the disease.

[0028] In some preferred embodiments, the gene causing the hereditary neuromuscular disorder affecting the nervous system is selected from the group consisting of: DMD, DYSF, FKRP, DNM2, BIN1, GAA, AGL, SMN1 and ASAH1 Gene.

[0029] In other preferred embodiments, the gene causing the hereditary neuromuscular disorder affecting the nervous system is selected from the group consisting of: FKTN, POMT1, POMT2, POMGNT1, POMGNT2, LMNA, ISPD, GMPPB, LARGE, LAMA2, TRIM32 and B3GALNT2 Gene.

[0030] In some embodiments, the recombinant porcine AAV vector is used for gene therapy of spinal muscular atrophy, and the vector comprises a peptide-modified capsid protein comprising the sequence SEQ ID NO:5 or a sequence having at least 95%, 96%, 97%, 98%, or 99% identity with the sequence, the sequence having at least 95%, 96%, 97%, 98%, or 99% identity with the sequence comprising a peptide of any one of SEQ ID NO:2-4, and the vector further packages a human SMN1 gene operatively linked to a promoter that is functional in neurons and / or glial cells.

[0031] In some embodiments, the recombinant porcine AAV vector according to this disclosure is administered systemically, preferably intravenously.

[0032] In some embodiments, the recombinant porcine AAV vector according to this disclosure is used to treat neuromuscular diseases. Detailed Implementation

[0033] Peptide-modified AAVpo1 vector

[0034] This invention relates to a recombinant adeno-associated virus (AAV) vector containing a peptide-modified porcine AAV serotype 1 capsid protein for gene therapy of muscle and nervous system disorders, such as muscle and central nervous system (CNS) disorders. The recombinant AAV vector containing the peptide-modified porcine AAV serotype 1 capsid protein can be used for gene therapy of diseases affecting only the nervous system (PNS and / or CNS) or affecting both the nervous system and muscles. Specifically, these diseases include central nervous system (CNS) diseases and neuromuscular diseases.

[0035] According to the invention, a porcine AAV serotype 1 (AAVpo1) vector (or a peptide-modified AAVpo1 vector) containing a peptide-modified capsid protein for its use binds to detargeting from non-target organs (particularly including the liver) and high transgene expression levels in target organs (i.e., the nervous system, such as the CNS; or the muscle and nervous system, such as the muscle and CNS).

[0036] As used herein, the term "detargeting" refers to reducing vector transduction and transgene expression in non-target organs to a minimum, preferably as close as possible to the detection limit. Compared to AAV8 and AAV9 vectors administered systemically at the same dose, the peptide-modified AAVpo1 vector of this disclosure (which is detargeted at the transduction level) advantageously contains at least 10-fold lower vector genome copy numbers per diploid genome. If a vector expressing human transgenes is used, the peptide-modified AAVpo1 vector of this disclosure (which is detargeted at the transgene expression level) advantageously contains protein levels derived from the vector that are lower than endogenous levels of the protein.

[0037] As used in this article, the term "muscle" refers to both cardiac muscle (i.e., the heart) and skeletal muscle.

[0038] As used in this article, the term "muscle cell" refers to myocytes, myotubes, myoblasts, and / or satellite cells.

[0039] As used in this article, the term “nervous system” refers to both the central (CNS) and peripheral (PNS) nervous systems.

[0040] As used herein, the term "central nervous system or CNS" refers to the brain, spinal cord, retina, cochlea, optic nerve and / or olfactory nerve and epithelium. As used herein, the term CNS cell refers to any cell in the CNS, including neurons and glial cells (oligodendrocytes, astrocytes, ependymal cells, microglia).

[0041] As used in this article, PNS refers to nerves and ganglia outside the brain and spinal cord.

[0042] As used herein, the term "systemic administration" refers to the route by which a substance (carrier) is delivered into the circulatory system, including enteral or parenteral administration. Parenteral administration includes injection, infusion, implantation, and others.

[0043] As used in this article, the term "AAV carrier" refers to AAV carrier particles.

[0044] As used herein, the term "porcine AAV vector or AAVpo1 vector" refers to an AAV vector containing porcine AAV serotype 1 capsid protein.

[0045] As used herein, the term AAV serotype includes both natural and artificial AAV serotypes, such as variants and hybrid capsids derived from natural AAV serotypes. An AAV serotype refers to a functional AAV capsid capable of transducing and expressing transgenes in a target organ.

[0046] As used in this article, “gene therapy for muscle and nervous system disorders, such as muscle and central nervous system (CNS) disorders” means “the use of gene therapy to treat muscle and nervous system disorders, such as muscle and central nervous system (CNS) disorders” or “the use of gene therapy to treat muscle and nervous system disorders, such as muscle and central nervous system (CNS) disorders”.

[0047] As used in this article, "or" means "and / or".

[0048] Neuromuscular disorders (NMD) are a very broad term encompassing a range of conditions that impair muscle function, either directly affecting voluntary muscles or indirectly affecting the peripheral nervous system or neuromuscular junctions. Neuromuscular diseases are a broadly defined group of disorders involving damage or dysfunction of peripheral nerves, muscles, or neuromuscular junctions. The site of damage can be in the cell body (i.e., amyotrophic lateral sclerosis [ALS] or sensory ganglion lesions), the axon (i.e., axonal peripheral neuropathy or brachial plexus neuropathy), Schwann cells (i.e., chronic inflammatory demyelinating polyradiculoneuropathy), the neuromuscular junction (i.e., myasthenia gravis or Lambert-Eaton syndrome), the muscle (i.e., inflammatory myopathy or muscular dystrophy), or any combination of these sites. Some neuromuscular diseases are also associated with central nervous system disorders, such as ALS.

[0049] As used herein, “neuromuscular disease or disorder affecting the nervous system” means a neuromuscular disease that includes damage to the nervous system. Such neuromuscular disease may further include muscle damage, such as secondary muscle damage resulting from primary nervous system injury.

[0050] In some embodiments, the peptide-modified AAVpo1 vector according to the invention, upon systemic administration, produces high transgene expression levels in target organs (i.e., the nervous system, such as the CNS; or the muscular and nervous system, such as the muscle and CNS) while simultaneously detargeting from the liver. Compared to a control AAVpo1 vector containing an unmodified capsid, the peptide-modified AAVpo1 vector advantageously increases transduction (vector copy number) in the nervous system (such as the CNS) or the muscular and nervous system (such as the muscle and CNS). Compared to a control AAVpo1 vector containing an unmodified capsid, the peptide-modified AAVpo1 vector preferably increases transgene expression levels in the muscular and nervous systems (e.g., the muscle and CNS) by at least two-fold, preferably three, four, five, or more times, particularly in skeletal muscle and the central nervous system. The transgene expression levels achieved by the peptide-modified AAVpo1 vector in different muscle types and nervous systems, such as different muscle types and CNS, are preferably at least on the same order of magnitude as (less than 1.5 times; i.e. equivalent to) those of the AAV8, AAV9, and AAVrh10 vectors.

[0051] Vector transduction and transgene expression were determined by systemic administration of the peptide-modified AAVpo1 vector in animal models (e.g., mouse models) well-known in the art and disclosed in the embodiments of this application. AAVpo1 vectors containing an unmodified capsid and optimal AAV vector serotypes (AAV2, AAV8, AAV9, AAVrh10, and / or others) typically used for muscle transduction were advantageously used for comparison. Vector transduction was determined by measuring the vector genome copy number per diploid genome using standard assays well-known in the art (e.g., real-time PCR assays disclosed in the embodiments of this application). Transgene expression was measured at the mRNA or protein level using standard assays well-known in the art, such as quantitative RT-PCR assays and quantitative Western blot analysis disclosed in the embodiments of this application.

[0052] In some embodiments, the peptide-modified AAVpo1 vector according to the invention for its use is detargeted from the liver and at least one other non-target organ (such as the spleen).

[0053] In some embodiments, the peptide-modified AAVpo1 vector according to the invention, when administered systemically, particularly intravenously, advantageously produces high transgene expression levels in various muscle groups, preferably including major muscle groups. The major skeletal muscle groups comprising the upper body are the abdominal muscles, pectoral muscles, deltoid muscles, trapezius muscles, latissimus dorsi muscles, erector spinae muscles, biceps, triceps, and diaphragm. The major skeletal muscle groups comprising the lower body are the quadriceps, hamstring muscles, gastrocnemius, soleus, and gluteal muscles. The muscles of the anterior lower leg are the tibialis anterior, extensor digitorum longus, extensor hallucis longus, peroneus longus, peroneus brevis, and peroneus tricuspidus. Examples of this application ( Figure 5 This demonstrates the ability of the peptide-modified AAVpo1 vector to produce high transgene expression levels in different muscle groups after systemic administration, showing high transgene expression levels in the tibialis (TA), extensor digitorum longus (EDL), quadriceps (Qua), gastrocnemius (Ga), soleus (Sol), triceps, biceps, and diaphragm muscles of mice intravenously injected with the peptide-modified AAVpo1 vector.

[0054] In some embodiments, the peptide-modified AAVpo1 vector according to the invention for its use is characterized by a combination of detargeting and transgenic expression levels in different muscle groups and in the brain and spinal cord, which, if not superior to, are at least equivalent to the AAV9 vector, after systemic administration, particularly intravenous administration.

[0055] AAVpo1 (GenBank accession number FJ688147, obtained July 24, 2016) contains a Cap gene (2977 bp) at positions 780 to 2930 of the viral genome sequence: VP1 CDS is located at positions 780 to 2930; VP2 CDS is from positions 1188 to 2930; and VP3 CDS is from positions 1329 to 2930. The AAVpo1 capsid protein (VP1) has a sequence obtained July 24, 2016, with GenBank accession number ACN42940.1 or SEQ ID NO:1. Hybridization vectors include, for example, vectors containing the AAVpo1 capsid and AAV2 rep proteins and / or AAV2 ITRs. AAVpo1 serotypes include the natural AAVpo1 serotypes listed above and any artificial variants or hybrids derived from said serotypes. This invention covers the use of AAVpo1 vectors modified with peptides derived from AAV capsid sequences having at least 95%, 96%, 97%, 98%, or 99% identity with the aforementioned AAVpo1 capsid sequence.

[0056] In some embodiments, the peptide-modified AAVpo1 capsid protein is derived from an AAV capsid sequence having at least 95%, 96%, 97%, 98%, or 99% identity with the sequence SEQ ID NO:1.

[0057] The term "identity" refers to the sequence similarity between two polypeptide molecules or two nucleic acid molecules. When positions in two compared sequences are occupied by the same bases or the same amino acid residues, the corresponding molecules are identical at that position. The percentage of identity between two sequences corresponds to the number of common matching positions in the two sequences divided by the number of positions compared and multiplied by 100. Typically, comparisons are made when two sequences are aligned to give the greatest possible identity. Identity can be calculated using, for example, the GCG (Genetic Computing Group, GCG Package Program Manual, 7th Edition, Madison, Wisconsin) stacking program or any sequence comparison algorithm such as BLAST, FASTA, or CLUSTALW.

[0058] The peptide preferably has up to 30 amino acids. In some preferred embodiments, the peptide has up to 25, 20 or 15 amino acids (i.e., 25, 24, 23, 22, 21, 20, 19, 18, 17, 16 or 15 amino acids).

[0059] In some embodiments, the peptide preferably has up to 30 amino acids and comprises or consists of the sequence MPLGAAG (SEQ ID NO:2) or a variant containing only one or two amino acid mutations (insertions, deletions, substitutions) in said sequence, preferably containing one or two amino acid substitutions in said sequence. In some preferred embodiments, the peptide comprises or consists of the sequence GMPLGAAGA (SEQ ID NO:3) or a variant containing up to four (1, 2, 3, or 4) amino acid mutations (insertions, deletions, substitutions) in said sequence, preferably containing only one or two amino acid deletions or substitutions in said sequence; said deletion is advantageously located at the N- and / or C-terminus. In some preferred embodiments, the sequence SEQ ID NO:2 or 3 as defined above, or a variant thereof, is side-joined with up to five (1, 2, 3, 4, 5) or more amino acids, such as GQR and QAA at its N- and C-terminus, respectively. Alternatively, the side-joined sequence may comprise or consist of alanine (A) residues. In some preferred embodiments, the peptide comprises or consists of the sequence GQRGMPLGAAGAQAA (SEQ ID NO:4).

[0060] The peptide-modified AAVpo1 capsid protein comprises at least one copy of the peptide inserted into the AAVpo1 capsid protein. Depending on the insertion site, the peptide may be inserted into VP1, VP1 and VP2 or VP1, VP2 and VP3. The peptide-modified AAVpo1 capsid protein may comprise up to five copies of the peptide, preferably one copy.

[0061] The peptide-modified AAVpo1 capsid protein according to the present invention comprises one or more peptides inserted at sites exposed on the surface of the AAV capsid. Sites on the AAV capsid exposed on the capsid surface that allow peptide insertion, i.e., sites that do not affect the assembly and packaging of the viral capsid, are well known in the art, including, for example, AAV capsid surface loops or antigen loops (Girod et al., Nat. Med., 1999, 5, 1052-1056; Grifman et al., Molecular Therapy, 2001, 3, 964-975); other sites are disclosed in Rabinowitz et al., Virology, 1999, 265, 274-285; Wu et al., J. Virol., 2000, 74, 8635-8647.

[0062] Specifically, according to the number in SEQ ID NO:1, at least one peptide is inserted into any one of positions N567, S568, N569, and T570 of the capsid protein, preferably between positions N567 and S568 or between positions N569 and T570. The insertion of the peptide may or may not result in the deletion of some residues before and / or after the peptide insertion site, preferably 1-3 (1, 2, 3) of the residues. In some embodiments, the peptide is inserted between positions N567 and S568, replacing all residues from positions 565-567 and 568-570. In some other embodiments, the peptide is inserted between positions N569 and T570, replacing all residues from positions 567-569 and 570-572. The positions are indicated by referring to the AAVpo1 capsid protein in SEQ ID NO:1; those skilled in the art will be able to readily locate the corresponding position in another AAVpo1 capsid protein sequence after comparison with SEQ ID NO:1.

[0063] In some preferred embodiments, the peptide-modified AAVpo1 capsid protein comprises a sequence selected from the group consisting of: sequence SEQ ID NO:5 and a sequence having at least 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:5, wherein the sequence having at least 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:5 comprises the peptide according to this disclosure, and a fragment thereof corresponding to the VP2 or VP3 capsid protein. VP2 corresponds to the amino acid sequence from K136 to the end of SEQ ID NO:5. VP3 corresponds to the amino acid sequence from M184 to the end of SEQ ID NO:5. In some preferred embodiments, the peptide-modified AAVpo1 capsid protein comprises sequence SEQ ID NO:5, or a fragment thereof corresponding to the VP2 or VP3 capsid protein.

[0064] The present invention also covers AAVpo1 VP1 and VP2 chimeric capsid proteins derived from peptide-modified AAVpo1 VP3 capsid proteins according to the present disclosure, wherein the VP1-specific N-terminal region and / or the VP2-specific N-terminal region are derived from another natural or artificial AAV serotype, preferably selected from another known AAVpo serotype, particularly AAVpo2.1 serotype. The present invention also covers AAVpo1 vectors with embedded peptide modifications, wherein the vector particles further comprise another AAV capsid protein derived from another natural or artificial AAV serotype, preferably selected from another known AAVpo serotype, particularly AAVpo2.1 serotype according to the present disclosure.

[0065] The genome of the peptide-modified AAVpo1 vector can be a single-stranded or self-complementary double-stranded genome (McCarty et al, Gene Therapy, 2003, Dec., 10(26), 2112-2118). Self-complementary vectors are generated by deleting a terminal dissociation site (trs) from one of the terminal repeat sequences of AAV. These modified vectors (whose replicated genome is half the length of the wild-type AAV genome) tend to package DNA dimers. The AAV genome is side-attached to ITRs. In certain embodiments, the AAV vector is a pseudotype vector, i.e., its genome and capsid are derived from a different serotype of AAV. In some preferred embodiments, the genome of the pseudotype vector is derived from AAV2.

[0066] The peptide-modified AAVpo1 vector for use according to this disclosure is produced using standard methods well-known in the art for the production of AAV vectors (Review in Aponte-Ubillus et al., Applied Microbiology and Biotechnology, 2018, 102: 1045-1054). In short, after co-transfection with an expression plasmid containing an AAV Rep and a capsid protein expression plasmid and a plasmid containing a recombinant AAV vector genome containing the target gene inserted into the expression cassette and flanked by AAV ITRs, cells are incubated for a sufficient time to allow the production of AAV vector particles, provided sufficient helper functions are present to allow the rAAV vector genome to be packaged into AAV capsid particles. Cells are then harvested, lysed, and the AAV vector particles are purified by standard purification methods such as affinity chromatography or iodixanol or cesium chloride density gradient ultracentrifugation.

[0067] The peptide-modified AAVpo1 vector particles typically package a therapeutic target gene. "Target gene for treatment," "gene for therapeutic purposes," "target gene," or "heterologous target gene" refers to a therapeutic gene or a gene encoding a therapeutic protein, peptide, or RNA. Therapeutic genes can be used in conjunction with genome editing enzymes.

[0068] A target gene is any nucleic acid sequence capable of modifying a target gene or target cellular pathway in cells of a target organ (i.e., the nervous system, such as the CNS; or muscle and / or the nervous system, such as muscle and CNS). Depending on the type of disease, the target organ may primarily comprise the nervous system, such as the CNS, or may also comprise muscle. In some specific embodiments, the target organ comprises at least the nervous system, such as the CNS. In some preferred embodiments, the target organ comprises both the nervous system and muscle, such as the CNS and muscle. For example, the gene may modify the expression, sequence, or regulation of the target gene or cellular pathway. In some embodiments, the target gene is a functional version of a gene or a fragment thereof. The functional version of the gene includes a wild-type gene, a variant gene (e.g., a variant belonging to the same family and other families), or a truncated version that at least partially retains the function of the encoded protein. The functional version of the gene can be used to replace or add gene therapy to replace a defective or nonfunctional gene in a patient. In other embodiments, the target gene is a gene that inactivates a dominant allele that causes an autosomal dominant genetic disease. The gene fragment can be used as a recombination template in combination with a genome editing enzyme.

[0069] Alternatively, the target gene may encode a target protein (e.g., antibody or antibody fragment, genome editing enzyme) or RNA for a specific application. In some embodiments, the protein is a therapeutic protein, including therapeutic antibodies or antibody fragments, or genome editing enzymes. In some embodiments, the RNA is therapeutic RNA.

[0070] In some embodiments, the sequence of the target gene is optimized for expression in treated individuals, preferably human individuals. Sequence optimization may include many changes in the nucleic acid sequence, including codon optimization, increased GC content, reduced number of CpG islands, reduced number of optional open reading frames (ARFs), and / or reduced number of splice donor and splice acceptor sites.

[0071] A target gene is a functional gene capable of producing a protein, peptide, or RNA encoded by a disease in target cells, particularly muscle cells and nervous system (CNS and / or PNS) cells, such as muscle cells and CNS cells. Depending on the type of disease, target cells may primarily comprise nervous system cells, such as CNS cells, or may further comprise muscle cells. In some specific embodiments, the target cells of the disease include at least nervous system cells, such as CNS cells. In some preferred embodiments, the target cells of the disease include both nervous system cells and muscle cells, such as CNS cells and muscle cells. In some embodiments, the target gene is a human gene. A peptide-modified AAVpo1 vector contains the target gene in a form expressible in target organ (i.e., nervous system, such as CNS; or muscle and / or nervous system, such as muscle and / or CNS) cells. In some specific embodiments, the target gene is in a form expressible at least in nervous system cells (such as CNS cells). In some preferred embodiments, the target gene is in a form expressible in both nervous system cells and muscle cells, such as CNS cells and muscle cells. Specifically, the target gene can be operatively linked to an appropriate regulatory sequence for transgene expression in target cells, tissues, or organs of an individual. Such sequences, well-known in the art, particularly include promoters and other regulatory sequences capable of further controlling said transgene expression, such as, but not limited to, enhancers, terminators, introns, silencers, especially tissue-specific silencers and microRNAs. The target gene is operatively linked to a pervasive, tissue-specific, or inducible promoter that is functional in cells of the target organ (i.e., muscle and / or the nervous system, such as muscle and / or CNS). In some specific embodiments, the target organ includes at least the nervous system, such as the CNS. In some preferred embodiments, the target organ includes both the nervous system and muscle, such as the CNS and muscle. In some specific embodiments, the target gene is operatively linked to a pervasive, tissue-specific, or inducible promoter that is functional in nervous system cells, such as neurons and / or glial cells; or in nervous system cells, such as neurons and / or glial cells, and in muscle cells. In some specific embodiments, the target gene is operatively linked to at least two promoters, at least one of which is a neuron- and / or glial cell-specific or inducible promoter that is functional in neurons and / or glial cells. In some specific embodiments, the target gene is operatively linked to at least two promoters, one of which is a neuron- and / or glial cell-specific or inducible promoter that is functional in neurons and / or glial cells and the other is a muscle-specific or inducible promoter that is functional in muscle cells.

[0072] The target gene can be inserted into an expression cassette, which also contains additional regulatory sequences as described above. Examples of ubiquitous promoters include the CAG promoter, phosphoglycerate kinase 1 (PGK) promoter, cytomegalovirus enhancer / promoter (CMV), SV40 early promoter, retroviral Rous sarcoma virus (RSV) LTR promoter, dihydrofolate reductase promoter, β-actin promoter, and EF1 promoter.

[0073] Muscle-specific promoters include, but are not limited to, desin (Des) promoter, muscle creatine kinase (MCK) promoter, CK6 promoter, α-myosin heavy chain (α-MHC) promoter, myosin light chain 2 (MLC-2) promoter, cardiac troponin C (cTnC) promoter, synthetic muscle-specific SpC5-12 promoter, and human skeletal muscle actin (HSA) promoter.

[0074] Promoters used in the nervous system (e.g., CNS expression) include promoters that drive pervasive expression and promoters that drive expression into neurons. Representative promoters driving pervasive expression include, but are not limited to: CAG promoters (including the cytomegalovirus enhancer / chicken β-actin promoter, the first exon and first intron of the chicken β-actin gene, and the splice acceptor of the rabbit β-globin gene); PGK (phosphoglycerate kinase 1) promoter; β-actin promoter; EF1a promoter; and CMV promoter. Representative promoters driving expression into neurons include, but are not limited to, the promoter of calcitonin gene-related peptide (CGRP), a known motor neuron-derived factor. Other neuron-selective promoters include promoters of choline acetyltransferase (ChAT), neuron-specific enolase (NSE), synaptic proteins, Hb9, and pervasive promoters including neuronal restriction silencing elements (NRSE). Representative promoters driving selective expression in glial cells include the promoter of the glial fibrillary acidic protein gene (GFAP).

[0075] For expression in muscle cells (skeletal muscle and cardiomyocytes), the target gene is advantageously under the control of the desmin promoter, particularly the human desmin promoter (Raguz et al., Dev. Biol., 1998, 201, 26-42; Paulin D&Li Z, Exp. Cell. Res., 2004, Nov 15;301(1):1-7). For expression in skeletal muscle cells, the target gene is advantageously under the control of the desmin promoter, particularly the human desmin promoter, and also contains a miR208a target sequence that inhibits expression in cardiomyocytes (i.e., in the heart; Roudault et al., Circulation, 2013, 128, 1094-104. doi: 10.1161 / CIRCULATIONAHA.113.001340).

[0076] The RNA is advantageously complementary to the target DNA or RNA sequence or binds to the target protein. For example, the RNA is interfering RNA, such as shRNA, microRNA, guide RNA (gRNA) used in conjunction with Cas enzymes or similar enzymes for genome editing, antisense RNA capable of exon jumping, such as modified small nuclear RNA (snRNA), or long non-coding RNA. Interfering RNA or microRNA can be used to regulate the expression of target genes associated with muscle or nervous system diseases (such as muscle or CNS diseases). In some embodiments, the disease is a nervous system disease, such as a CNS disease. According to this embodiment, the target gene is in nervous system cells, such as CNS and / or PNS cells, particularly including neurons and / or glial cells. In some other embodiments, the disease is a disease of both the nervous system and muscles, such as a disease of both the CNS and muscles. According to another embodiment, the target gene is present at least in nervous system cells, such as CNS and / or PNS cells, particularly including neurons and / or glial cells; the target gene may be substantially in nervous system cells, such as CNS and / or PNS cells, particularly including neurons and / or glial cells; or it may be in both nervous system cells and muscle cells, such as CNS and / or PNS cells, particularly including neurons and / or glial cells and muscle cells. Guide RNA, complexed with Cas enzymes or similar enzymes for genome editing, can be used to modify the sequence of the target gene, particularly to correct the sequence of mutated / defective genes or to modify the expression of target genes involved in diseases, particularly muscle or nervous system disorders, such as muscle or central nervous system (CNS) disorders. Antisense RNA capable of exon skipping is particularly used to correct reading frames and restore the expression of defective genes with disrupted reading frames. In some embodiments, the RNA is therapeutic RNA.

[0077] The genome editing enzyme according to the present invention is any enzyme or enzyme complex capable of modifying a target gene or target cellular pathway, particularly in muscle cells and / or nervous system cells, such as in muscle cells and / or CNS cells. In some embodiments, the target gene is at least in nervous system cells, such as CNS and / or PNS cells, particularly including neurons and / or glial cells; the target gene may be substantially in the nervous system, such as CNS and / or PNS cells, particularly including neurons and / or glial cells; or it may be in both nervous system cells and muscle cells, such as CNS and / or PNS cells, particularly including neurons and / or glial cells and muscle cells. In some specific embodiments, the target gene is in nervous system cells, such as CNS and / or PNS cells, particularly including neurons and / or glial cells. In some other specific embodiments, the target gene is in both nervous system cells and muscle cells, such as CNS and / or PNS cells, particularly including neurons and / or glial cells and muscle cells. For example, the genome editing enzyme can modify the expression, sequence, or regulation of the target gene or cellular pathway. Genome editing enzymes are advantageously engineered nucleases, such as, but not limited to, macronucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), Cas enzymes from the CRISPR-Cas system, and similar enzymes. Genome editing enzymes, particularly engineered nucleases (such as Cas enzymes) and similar enzymes, can be functional nucleases that generate double-strand breaks (DSBs) or single-strand DNA breaks (gap enzymes, such as Cas9(D10A)) at target genomic loci and are used for site-specific genome editing applications, including but not limited to: gene correction, gene substitution, gene knock-in, gene knockout, mutagenesis, chromosomal translocation, and chromosomal deletion. For site-specific genome editing applications, genome editing enzymes, particularly engineered nucleases (such as Cas enzymes) and similar enzymes, can be used in combination with a homologous recombination (HR) matrix or template (also known as a DNA donor template) that modifies the target genomic loci through homologous recombination induced by double-strand breaks (DSBs). Specifically, the HR template can introduce the target transgene into the target genomic locus or repair mutations in the target genomic locus, preferably repairing mutations in abnormal or defective genes that cause muscle or nervous system disorders (such as muscle or central nervous system (CNS) disorders). In some embodiments, the disease is a neurological disease, such as a CNS disease. In some other embodiments, the disease is both a neurological and muscular disease, particularly such as CNS and muscular diseases. Alternatively, genome editing enzymes, such as Cas enzymes and similar enzymes, can be engineered into nuclease-deficient forms and used as DNA-binding proteins in various genome engineering applications, such as, but not limited to, transcriptional activation, transcriptional repression, epigenome modification, genome imaging, DNA or RNA pull-down, etc.

[0078] In some implementations, peptide-modified AAVpo1 vector particles containing a target gene for treatment are packaged and targeted to skeletal muscle cells and / or neurons.

[0079] An example of a preferred vector according to the invention for its use is an AAVpo1 vector comprising a peptide-modified capsid protein comprising the sequence SEQ ID NO:5 or a sequence having at least 95%, 96%, 97%, 98%, or 99% identity with said sequence, said sequence having at least 95%, 96%, 97%, 98%, or 99% identity comprising a peptide of any one of SEQ ID NO:2-4. The vector further packages a therapeutic target gene operatively linked to a desmin promoter, preferably a human desmin promoter, and ultimately further operatively linked to a miR208a target sequence. This first vector can be used to express the target gene in muscle (bone and heart; expression cassette without miR208a target sequence) or only in skeletal muscle (expression cassette containing miR208a target sequence), but not in the liver after systemic administration, particularly intravascular administration.

[0080] Another example of a preferred vector according to the invention for its use is an AAVpo1 vector comprising a peptide-modified capsid protein comprising the sequence SEQ ID NO:5 or a sequence having at least 95%, 96%, 97%, 98%, or 99% identity with said sequence, said sequence having at least 95%, 96%, 97%, 98%, or 99% identity comprising a peptide of any one of SEQ ID NO:2-4, said vector further packaging a target gene for therapeutic use, said gene being operatively linked to a CAG promoter, and preferably further comprising a human β-globin polyadenylation signal. This second vector can be used to express the target gene in the muscular and nervous systems, including the heart, for example, after systemic administration, particularly intravascular administration, in the muscles and CNS, including the heart, but not in the liver.

[0081] Another example of a preferred vector according to the invention for its use is the AAVpo1 vector, which comprises a peptide-modified capsid protein containing the sequence SEQ ID NO:5 or a sequence having at least 95%, 96%, 97%, 98%, or 99% identity with said sequence, said sequence having at least 95%, 96%, 97%, 98%, or 99% identity with said sequence comprising a peptide of any one of SEQ ID NO:2-4. The vector further packages a target gene for therapeutic use, said gene being operatively linked to a promoter functional in neurons and / or glial cells. The promoter may be a ubiquitous promoter, such as CAG or other promoters, a tissue-specific promoter, or an inducible promoter functional in neurons and / or glial cells. In some specific embodiments, the promoter is a neuron and / or glial cell-specific or inducible promoter functional in neurons and / or glial cells. This third vector can be used for systemic administration, particularly intravascular administration, to express the target gene in the nervous system, but not in the liver.

[0082] Another example of a preferred vector according to the invention for its use is an AAVpo1 vector comprising a peptide-modified capsid protein comprising the sequence SEQ ID NO:5 or a sequence having at least 95%, 96%, 97%, 98%, or 99% identity with said sequence, said sequence having at least 95%, 96%, 97%, 98%, or 99% identity with said sequence comprising a peptide of any one of SEQ ID NO:2-4, said vector further packaging a target gene for therapeutic use, said gene being operatively linked to a promoter or combination of promoters functional in muscle cells and neurons and / or glial cells. This fourth vector can be used to express the target gene in the muscular and nervous systems, including the heart, for example, after systemic administration, particularly intravascular administration, in the muscular and central nervous systems, including the heart, but not in the liver. The promoter can be a ubiquitous promoter, such as CAG or other promoters, a tissue-specific promoter or an inducible promoter, or a combination of said promoters, including a first promoter functional in muscle cells and a second promoter functional in neurons and / or glial cells. In some specific implementations, the target gene is operatively linked to at least two promoters, one of which is a neuron and / or glial cell-specific or inducible promoter that is functional in neurons and / or glial cells, and the other is a muscle-specific or inducible promoter that is functional in muscle cells.

[0083] Gene therapy for muscle and nervous system disorders (such as muscle and CNS disorders)

[0084] The peptide-modified AAVpo1 vector according to this disclosure is used for gene therapy of muscle and / or nervous system diseases or disorders (e.g., muscle and / or CNS diseases or disorders). In some embodiments, the peptide-modified AAVpo1 vector according to the invention is used for gene therapy of diseases affecting at least the nervous system (e.g., the CNS), said diseases may primarily affect the nervous system (e.g., the CNS) or may affect both the nervous system and muscles (e.g., the CNS and muscles). For example, the disease may primarily affect the nervous system, and primary damage to the nervous system may lead to secondary damage to the muscles. In some specific embodiments, the peptide-modified AAVpo1 vector according to this disclosure is used for gene therapy of nervous system diseases, particularly CNS diseases. In some other specific embodiments, the peptide-modified AAVpo1 vector according to this disclosure is used for gene therapy of nervous system and muscle diseases, such as CNS and muscle diseases, particularly neuromuscular diseases affecting at least the nervous system (CNS and / or PNS).

[0085] The peptide-modified AAVpo1 vector according to this disclosure is preferably used in the form of a pharmaceutical composition comprising a therapeutically effective amount of peptide-modified AAVpo1 vector particles, preferably packaged as peptide-modified AAVpo1 vector particles of a therapeutic target gene according to this disclosure.

[0086] Gene therapy can be performed through gene transfer, gene editing, exon skipping, RNA interference, trans-splicing, or any other genetic modification of any coding or regulatory sequence in a cell, including sequences contained in the cell nucleus, mitochondria, or as symbiotic nucleic acids, such as, but not limited to, viral sequences contained in cells.

[0087] The two main types of gene therapy are as follows:

[0088] - Therapies designed to provide functional replacement genes for defective / abnormal genes: This is replacement or supplemental gene therapy;

[0089] - Therapies aimed at gene or genome editing: In this case, the goal is to provide cells with the necessary tools to correct the sequence or modify the expression or regulation of defective / abnormal genes in order to express functional genes or suppress abnormal genes (inactivate them): This is gene editing therapy.

[0090] In add-on gene therapy, the target gene can be a functional version of a gene that is defective or mutated in the patient, such as in a genetic disease. In this case, the target gene will restore the expression of the functional gene.

[0091] Gene or genome editing uses one or more target genes, for example:

[0092] (i) Genes encoding therapeutic RNAs as defined above, such as interfering RNAs like shRNA or microRNA, guide RNAs (gRNAs) used in combination with Cas enzymes or similar enzymes, or antisense RNAs capable of exon jumping, such as modified small nuclear RNAs (snRNAs); and

[0093] (ii) Genes encoding genome editing enzymes as defined above, such as engineered nucleases like macronucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), Cas enzymes, or similar enzymes; or combinations of these genes, or fragments of functional versions of genes used as recombination templates, as described above.

[0094] Gene therapy is used to treat various inherited (genetic) or acquired diseases or disorders affecting the structure or function of the muscles and / or nervous system, such as muscles and / or the CNS, including skeletal muscle or cardiac muscle, brain, or spinal cord. These diseases can be caused by trauma, infection, degeneration, structural or metabolic defects, tumors, autoimmune diseases, stroke, or others. In some embodiments, gene therapy is used to treat inherited (genetic) or acquired diseases or disorders affecting at least the nervous system (PNS and / or CNS), particularly the CNS, including the structure or function of the brain and / or spinal cord. The disease may primarily affect the nervous system (PNS and / or CNS), particularly the CNS, including the brain and / or spinal cord, or may further affect muscles, including skeletal muscle and / or cardiac muscle. In some specific embodiments, the disease is a neurological disease, particularly a CNS disease and / or a PNS disease; the CNS disease may affect the brain and / or spinal cord. In some other specific embodiments, the disease is a disease of the nervous system (PNS and / or CNS) and muscles, such as a disease of the CNS and muscles; the disease affects the nervous system, such as the brain and / or spinal cord, and further affects muscles, such as skeletal muscle and / or cardiac muscle. As used herein, nervous system and muscle diseases include diseases with secondary muscle involvement or injury, particularly those resulting from primary involvement or injury of the nervous system (especially the CNS). Therefore, the nervous system and muscle diseases disclosed herein differ from muscle diseases characterized by primary muscle injury or involvement.

[0095] In some implementations, gene therapy is used to treat neurological disorders, particularly CNS diseases, especially hereditary neurological disorders. CNS diseases include, for example, Alzheimer's disease, Parkinson's disease, frontotemporal dementia, and others.

[0096] Examples of mutated genes in hereditary neurological disorders are listed in the table below, which can be targeted by gene therapy using the pharmaceutical compositions of the present invention:

[0097] Hereditary neurological disorders

[0098]

[0099] Other examples of mutated genes in hereditary neurological disorders that can be targeted by gene therapy using the pharmaceutical compositions of the present invention are genes causing spinal muscular atrophy (SMAs) & motor neuron disease; hereditary motor and sensory neuropathy; hereditary paraplegia and hereditary ataxia; listed in the table below. In some specific embodiments, the neurological disease is selected from the group consisting of spinal muscular atrophy (SMAs) SMN1, ASAH1 Genes); Amyotrophic Lateral Sclerosis (ALS) SOD1, ALS2 SETX, FUS, ANG, TARDBP, FIG4, OPTN And others); hereditary paraplegia ( SPAST (SPG4), SPG7 and others SPG Genes, such as SPG11, SPG20 and SPG21 Especially SPAST (SPG4) and SPG7) and peroneal muscular atrophy, type 4B1 ( MTMR2 In some preferred embodiments, the gene is selected from the group consisting of: SMN1, ASAH1, DNM2, MTMR2 and SPAST Genes. In some other preferred embodiments, the genes are selected from the group consisting of: SOD1, ALS2, SETX, FUS, ANG, TARDBP, FIG4 and OPTN .

[0100] In some embodiments, gene therapy is used to treat neuromuscular diseases, particularly human hereditary neuromuscular disorders. Examples of mutated genes in hereditary neuromuscular disorders are listed in the table below, including hereditary muscle disorders that can be targeted by gene therapy using the pharmaceutical compositions of the present invention:

[0101] Muscle dystrophy

[0102]

[0103]

[0104] Congenital muscular dystrophy

[0105]

[0106] Congenital myopathy

[0107]

[0108] Distal myopathy

[0109]

[0110] Other myopathy

[0111]

[0112] Myotonia syndrome

[0113]

[0114] Ion channel muscle diseases

[0115]

[0116] Malignant hyperthermia

[0117]

[0118] Metabolic myopathy

[0119]

[0120] Hereditary cardiomyopathy

[0121]

[0122]

[0123]

[0124] Congenital myasthenia gravis

[0125]

[0126] Spinal muscular atrophy (SMAs) & motor neuron disease

[0127]

[0128]

[0129] Hereditary motor and sensory neuropathy

[0130]

[0131]

[0132] Hereditary paraplegia

[0133]

[0134]

[0135] Other neuromuscular disorders

[0136]

[0137] Hereditary ataxia

[0138]

[0139]

[0140] Any of the genes listed above can be targeted in alternative gene therapy, where the target gene is a functional version of a defective or mutated gene.

[0141] Alternatively, the genes listed above can be used as targets for gene editing. Gene editing is used to correct the sequence of mutated genes or modify the expression or regulation of defective / abnormal genes, thereby enabling the expression of functional genes in muscle cells. In this case, the target gene is selected from those that encode therapeutic RNA, such as interfering RNA, guide RNA for genome editing, and antisense RNA capable of exon skipping, where the therapeutic RNA targets genes from the aforementioned list. Tools such as CRISPR / Cas9 can be used for this purpose.

[0142] Therefore, by providing the correct version of the gene in the muscle cells and / or nervous system (PNS and / or CNS) cells of affected patients, particularly in the muscle cells and CNS cells of affected patients, this could contribute to the effective treatment of the disease.

[0143] In some implementations, the target gene for gene therapy (additional gene therapy or gene editing) is a gene that causes one of the neuromuscular diseases listed above, preferably selected from the group consisting of: (i) myopathy, such as hereditary cardiomyopathy, metabolic myopathy, other myopathy, distal myopathy, muscular dystrophy, and congenital myopathy; (ii) spinal muscular atrophy (SMAs) and motor neuron disease; (iii) myotonic syndrome, particularly myotonic dystrophy type 1 and type 2; congenital myasthenia gravis; hereditary motor and sensory neuropathy; hereditary paraplegia and hereditary ataxia, particularly congenital myopathy and muscular dystrophy, as well as spinal muscular atrophy (SMAs) and motor neuron disease.

[0144] In some specific implementations, the target gene for gene therapy (additional gene therapy or gene editing) is a gene that causes one of the neuromuscular diseases listed above, preferably selected from the group consisting of Duchenne muscular dystrophy and Becker muscular dystrophy. DMD Genetic), limb-girdle muscular dystrophy (LGMDs) CAPN3, DYSF, FKRP, ANO5 Genes and other factors), spinal muscular atrophy ( SMN1, ASAH1 Genes) and amyotrophic lateral sclerosis (ALS) SOD1, ALS2, SETX, FUS, ANG, TARDBP, FIG4, OPTN and others), myotubular myopathy ( MTM1 Genes), central nucleus myopathy ( MTM1, DNM2, BIN1 Genes), rod body myopathy ( ACTA1, KLHL40, KLHL41, KBTBD13 Genes), selenoprotein N-related myopathy ( SEPN1 Genetic factors, congenital myasthenia gravis ( ColQ, CHRNE, RAPSN, DOK7, MUSK Genetics), Pompe disease ( GAA Gene), Glycogen Storage Disease III (GSD3) AGL Genetic predisposition to myotonia type 1 (myotrophic lateral sclerosis) DMPK (gene) and type 2 ( CNBP / ZNF9 gene Hereditary paraplegia SPAST ) and peroneal muscular atrophy, type 4B1 ( MTMR2 In some preferred embodiments, the target gene is selected from the group consisting of: DMD, CAPN3 DYSF, FKRP, ANO5, MTM1, DNM2, BIN1, ACTA1, KLHL40, KLHL41, KBTBD13, TPM3, TPM2, TNNT1, CFL2, LMOD3, SEPN1, GAA, AGL, SMN1 and ASAH1 Gene.

[0145] In some preferred embodiments, the target gene for gene therapy (additional gene therapy or gene editing) is a gene that causes one of the neuromuscular diseases listed above that affects at least the nervous system, preferably selected from the group consisting of: (i) myopathy, such as muscular dystrophy, including congenital muscular dystrophy; (ii) spinal muscular atrophy (SMAs) and motor neuron diseases; (iii) myotonic syndromes, particularly myotonic dystrophy type 1 and type 2; (iv) hereditary motor and sensory neuropathy; (v) hereditary paraplegia and hereditary ataxia; and (vi) congenital myasthenia gravis syndromes, particularly muscular dystrophy, including congenital muscular dystrophy, congenital myasthenia gravis syndrome, and spinal muscular atrophy (SMAs) and motor neuron diseases.

[0146] In some preferred embodiments, the target gene for gene therapy is a gene that causes myopathy affecting at least the nervous system, such as muscular dystrophy, including congenital muscular dystrophy affecting at least the nervous system, selected from the group consisting of: FKTN, POMT1, POMT2, POMGNT1, POMGNT2, LMNA, ISPD, GMPPB, LARGE, LAMA2, TRIM32 and B3GALNT2 .

[0147] In some other preferred embodiments, the target gene for gene therapy is a gene that causes myopathy (e.g., congenital myasthenia gravis, such as congenital myasthenia gravis) that affects at least the nervous system, selected from the genes that cause congenital myasthenia gravis listed in the table above.

[0148] In some other preferred embodiments, the target gene for gene therapy (additional gene therapy or gene editing) is a gene that causes one of the neuromuscular diseases listed above that affect at least the nervous system, preferably selected from the group consisting of Duchenne muscular dystrophy and Becker muscular dystrophy. DMD Genetic), limb-girdle muscular dystrophy (LGMDs) (D YSF, FKRP Spinal muscular atrophy ( SMN1, ASAH1 Genes) and amyotrophic lateral sclerosis (SOD1, ALS2, SETX, FUS ANG, TARDBP, FIG4, OPTN And others), central nucleus myopathy ( DNM2, BIN1Genetics), Pompe disease ( GAA Gene), Glycogen Storage Disease III (GSD3) AGL Genetic predisposition to myotonia type 1 (myotrophic lateral sclerosis) DMPK (gene) and type 2 ( CNBP / ZNF9 Genes); Hereditary paraplegia ( SPAST (SPG4), SPG7 Other SPG Genes, such as SPG11, SPG20 and SPG21 ;in particular SPAST (SPG4) and SPG7 ); Peroneal muscular atrophy, type 4B1 ( MTMR2 ); and congenital myasthenia gravis syndromes, such as congenital myasthenia gravis ( CHAT, AGRN Gene).

[0149] In some further preferred embodiments, the target gene is selected from the group consisting of: DMD, DYSF, FKRP, DNM2, BIN1, GAA, AGL, SMN1 and ASAH1 Gene.

[0150] In some preferred embodiments, the peptide-modified AAVpo1 vector according to this disclosure is used to target motor neurons to treat motor neuron diseases. The target gene can be any of the genes listed in the table above associated with spinal muscular atrophy (SMAs) and motor neuron diseases. Motor neuron diseases include amyotrophic lateral sclerosis (ALS), progressive bulbar palsy (PBP), pseudobulbar palsy, progressive muscular atrophy (PMA), primary lateral sclerosis (PLS), spinal muscular atrophy (SMA), and monosomy muscular atrophy (MMA), as well as some rare variants similar to ALS.

[0151] Muscular dystrophy is caused by the protein dystrophin. DMD A series of X-linked muscle diseases caused by pathogenic variants of the gene. Muscular dystrophy diseases include Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), and DMD-associated dilated cardiomyopathy.

[0152] Limb-girdle muscular dystrophy (LGMDs) is a group of disorders clinically similar to diabetic muscular dystrophy (DMD), but occurs in both sexes due to autosomal recessive and autosomal dominant inheritance. LGMDs are caused by mutations in genes encoding inotropic proteins and other proteins associated with the muscle cell membrane that interact with dystrophin. The term LGMD1 refers to the genotype showing dominant (autosomal dominant) inheritance, while LGMD2 refers to the type with autosomal recessive inheritance. Pathogenic variants (LGMD1A to LGMD1G; LGMD2A to LGMD2W) at more than 50 loci have been reported. Caloplasmosis (LGMD2A) is caused by… CAPN3 Caused by gene mutations, more than 450 pathogenic agents have been described. Genes that play a role in the LGMD phenotype include: anoctamin 5 ( ANO5 ), vascular epicardial material ( BVES ), Calpain 3 ( CAPN3 ), caveolin 3 ( CAV3 CDP-L-ribitol pyrophosphorylase A ( CRPPA ), dystroglycan 1 ( DAG1 ), desmin ( DES ), DnaJ heat shock protein family ( Hsp40 Homologous, subfamily B, member 6 ( DNAJB6 ), dysferlin DYSF ), fukutin-related protein ( FKRP )、fukutin( FKT GDP-mannose pyrophosphorylase B ( GMPPB ), heterogeneous nucleoribonucleoprotein D-like ( HNRNPDL ), containing LIM zinc finger domain 2 ( LIMS2 ), lain A:C( LMNA ), muscle contractile protein ( MYOT ), reticulin ( PLEC ), protein O-glucosyltransferase 1 ( PLOGLUT1 ), protein O-linked mannose N-acetylglucosamine aminotransferase 1 (β1, 2-) POMGNT1 ), protein O-mannose kinase ( POMK ), protein O-mannosyltransferase 1 ( POMT1 ), protein O-mannosyltransferase 2 ( POMT2 ), inositol α ( SGCA ), inositol β ( SGCB ), myoglobin δ ( SGCD ), inositol γ ( SGCG ), myosin-cap ( TCAP ), transporter protein 3 (TNPO3), torsin 1A interacting protein ( TOR1AIP1 ), trafficking protein particle complex 11 ( TRAPPC11 ), containing triple motif 32 ( TRIM 32 ) and titin ( TTN The main contributing genes to the LGMD phenotype include CAPN3, DYSF, FKRP and ANO5(Babi Ramesh Reddy Nallamilli et al., Annals of Clinical and Translational Neurology, 2018, 5, 1574-1587.).

[0153] Dysferlin is associated with neurological disorders including multiple sclerosis (Hochmeister et al., J. Neuropathol. Exp. Neurol., 2006 Sep; 65(9): 855-65), Alzheimer's disease (Galvin et al., Acta Neuropathol., 2006 Dec; 112(6): 665-71), and choreiform movements (Takahashi T, et al., Mov. Disord., 2006, Sep; 21(9): 1513-5).

[0154] Spinal muscular atrophy is a disease caused by surviving motor neurons 1 ( SMN1 Hereditary disorders caused by gene mutations are characterized by weakness and emaciation (atrophy) of the muscles used for movement. ASAH1 Gene mutations lead to SMA-PME (spinal muscular atrophy with progressive myoclonic epilepsy).

[0155] X-linked myotubular myopathy is a disease caused by myotubularin (… MTM1 A hereditary disorder caused by a gene mutation that affects the muscles used for movement (skeletal muscles) and occurs almost exclusively in men. The symptoms are characterized by muscle weakness (myopathy) and decreased muscle tone (hypotonia).

[0156] Pompe disease is a genetic disorder caused by a mutation in the acid alpha-glucosidase (GAA) gene. Mutations in the GAA gene prevent acid alpha-glucosidase from effectively breaking down glycogen, causing this sugar to accumulate in lysosomes at toxic levels. This accumulation damages organs and tissues throughout the body, particularly muscles, leading to the progressive signs and symptoms of Pompe disease.

[0157] Glycogen storage disease III (GSD3) is an autosomal recessive metabolic disorder caused by amylase-α-1,6-glucosidase and 4-α-glucosyltransferase, which encode glycogen debranching enzymes. AGL These mutations are caused by homozygous or compound heterozygous mutations in the gene and are associated with abnormal glycogen accumulation with short outer chains. Clinically, GSD III patients present with hepatomegaly, hypoglycemia, and growth retardation in infancy or early childhood. Muscle weakness in IIIa patients is mild in childhood but becomes more severe in adulthood; some patients develop cardiomyopathy.

[0158] Genome-wide association studies will BIN1 The locus was identified as a major regulator of genetic risk for Alzheimer's disease (AD) (Voskobiynyk et al., eLife doi: 10.7554 / eLife.57354; July 13, 2020). Hereditary spastic paraplegia (HSPs) is a rare group of inherited neurological disorders characterized by extensive clinical and genetic heterogeneity. Spasticity of the lower limbs, associated with the first motor neurons, is the core symptom of all HSPs. Genes contributing to HSPs include at least 79. SPG Gene. SPG7 and SPAST Mutations in this gene are a common cause of hereditary spastic paraplegia (HSP) (Review in Lallemant-Dudek P). et al. Fac. Rev., 2021, Mar 10;10:27).

[0159] A non-limiting example of a vector for gene therapy of myotubular myopathy is the AAVpo1 vector, which comprises a peptide-modified capsid protein containing the sequence SEQ ID NO:5 or a sequence having at least 95%, 96%, 97%, 98%, or 99% identity with said sequence, said sequence having at least 95%, 96%, 97%, 98%, or 99% identity with said sequence comprising a peptide of any one of SEQ ID NO: 2-4, wherein the vector is further packaged with a human desmin promoter operatively linked to the human desmin promoter. MTM1 The vector contains the gene and is further operatively linked to the miR208a target sequence. This vector can be used to express the target gene in skeletal muscle after systemic administration (e.g., intravascular injection), but not in the liver.

[0160] Another non-limiting example of a vector for gene therapy of spinal muscular atrophy is the AAVpo1 vector, which comprises a peptide-modified capsid protein containing the sequence SEQ ID NO:5 or a sequence having at least 95%, 96%, 97%, 98%, or 99% identity with said sequence, said sequence having at least 95%, 96%, 97%, 98%, or 99% identity with said sequence comprising a peptide of any one of SEQ ID NO:2-4, wherein the vector is further packaged with a human being operatively linked to a CAG promoter. SMN1 The vector contains a gene, and preferably further includes a human β-globin polyadenylation signaling unit. This vector can be used to express the target gene in the muscular and nervous systems, including the heart, particularly in the muscular and CNS systems, but not in the liver after systemic administration (e.g., intravascular injection).

[0161] The pharmaceutical compositions of the present invention, comprising peptide-modified AAVpo1 carrier particles with reduced hepatophilicity, can be administered to patients with concurrent liver degeneration such as fibrosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, viral or toxic hepatitis, or underlying genetic disorders that induce liver degeneration.

[0162] In the context of this invention, a therapeutically effective dose means a dose sufficient to reverse, alleviate or inhibit the development of the disorder or condition to which the term applies, or to reverse, alleviate or inhibit the development of one or more symptoms of the disorder or condition to which the term applies.

[0163] The determination and adjustment of an effective dose depends on a variety of factors, such as the composition used, the route of administration, the physical characteristics of the individual under consideration, such as sex, age and weight, concurrent medications, and other factors that a medical professional would recognize.

[0164] In various embodiments of the present invention, the pharmaceutical composition comprises a pharmaceutically acceptable carrier and / or excipient.

[0165] "Pharmaceutically acceptable carriers" are carriers that, when properly administered to mammals, particularly humans, will not produce adverse reactions, allergic reactions, or other adverse effects. Pharmaceutically acceptable carriers or excipients are non-toxic solid, semi-solid, or liquid fillers, diluents, encapsulating materials, or any type of formulation adjuvant.

[0166] Preferably, the pharmaceutical composition comprises an excipient that is pharmaceutically acceptable for an injectable formulation. It may be, in particular, an isotonic sterile saline solution (monophosphate or disodium phosphate, sodium chloride, potassium chloride, calcium chloride or magnesium chloride, or a mixture thereof), or a dry, particularly lyophilized composition that, when added to sterile water or physiological saline as appropriate, can be formulated into an injectable solution.

[0167] Suitable drug forms for injection include sterile aqueous solutions or suspensions. Solutions or suspensions may contain additives that are compatible with the viral vector and do not prevent viral vector particles from entering target cells. In all cases, the form must be sterile and must be fluid to achieve ease of injection. It must be stable under production and storage conditions and must be protected against contamination by microorganisms such as bacteria and fungi. Examples of suitable solutions are buffers, such as phosphate-buffered saline (PBS) or lactated Ringer's solution.

[0168] The present invention also provides a method for treating muscle or nervous system disorders, particularly muscle or CNS disorders according to the present disclosure, comprising administering to a patient a therapeutically effective amount of the pharmaceutical composition as described above. More preferably, the present invention provides a method for treating muscle and nervous system disorders, particularly muscle and CNS disorders according to the present disclosure.

[0169] The present invention also provides the use of the pharmaceutical composition according to the present disclosure in the preparation of a medicament for treating muscle or nervous system disorders, particularly muscle or CNS disorders according to the present disclosure; preferably muscle and nervous system disorders, particularly muscle and CNS disorders according to the present disclosure.

[0170] As used herein, the term "patient" or "individual" refers to a mammal. Preferably, the patient or individual according to the invention is a human.

[0171] In the context of this invention, the term “treatment” as used herein means reversing, alleviating or inhibiting the development of the disorder or condition to which the term applies, or reversing, alleviating or inhibiting the development of one or more symptoms of the disorder or condition to which the term applies.

[0172] The pharmaceutical compositions of the present invention are typically administered according to known methods at doses and time periods that effectively induce therapeutic effects in patients.

[0173] Administration can be systemic, local, or a combination of systemic and local administration. Systemic administration is preferably parenteral, such as subcutaneous (SC), intramuscular (IM), intravenous (IV), or intra-arterial administration; intraperitoneal (IP); intradermal injection, or other methods. Local administration is preferably intracerebral, intraventricular, intracisional, and / or intrathecal administration. Administration can be, for example, by injection or perfusion. In some preferred embodiments, parenteral administration is preferred, and intravascular administration is preferred, such as intravenous (IV) or intra-arterial administration. In some other preferred embodiments, administration is intracerebral, intraventricular, intracisional, and / or intrathecal administration, alone or in combination with parenteral administration, preferably intravascular administration. In some other preferred embodiments, administration is parenteral, preferably intravascular administration alone or in combination with intracerebral, intraventricular, intracisional, and / or intrathecal administration.

[0174] Unless otherwise stated, the practice of this invention will employ conventional techniques within the scope of this art. These techniques are fully explained in the literature.

[0175] The invention will now be illustrated by way of the following non-limiting embodiments with reference to the accompanying drawings, in which: Attached Figure Description

[0176] Figure 1 Changes in body weight over time in Mtm1-KO mice treated with various AAV vectors expressing hMTM1. AAVpo1 (KO-AAVpo1), AAVpo1A1 (KO-AAVpo1A1), AAV8 (KO-AAV8), AAV9 (KO-AAV9), and AAVrh10 (KO-AAVrh10) were used. Untreated wild-type (WT-PBS) and Mtm1-KO (KO-PBS) mice served as controls.

[0177] Figure 2 Muscle weight of Mtm1-KO mice treated with various AAV vectors expressing hMTM1: AAVpo1 (KO + AAVpo1), AAVpo1A1 (KO + AAVpo1A1), AAV8 (KO + AAV8), AAV9 (KO + AAV9), and AAVrh10 (KO + AAVrh10). Untreated wild-type (WT + PBS) and Mtm1-KO (KO + PBS) mice served as controls. TA: Tibialis anterior; EDL: Extensor digitorum longus; Quadriceps; Ga: Gastrocnemius; Sol: Soleus; Triceps; Biceps; Diaphragm; Heart. Statistical analysis was performed using one-way ANOVA, followed by Tukey's multiple comparison test. ; ; ; $P<0.05 vs. KO + AAV9; $$ P<0.01 vs. KO + AAV9; $$$ P<0.001 vs. KO + AAV9).

[0178] Figure 3 ： Vector copy number (VCN) in the muscle of Mtm1-KO mice treated with various AAV vectors expressing hMTM1: AAVpo1 (KO + AAVpo1), AAVpo1A1 (KO + AAVpo1A1), AAV8 (KO + AAV8), AAV9 (KO + AAV9), and AAVrh10 (KO + AAVrh10). Untreated wild-type mice (WT-PBS) served as controls. TA: Tibialis anterior; EDL: Extensor digitorum longus; Quadriceps; Ga: Gastrocnemius; Sol: Soleus; Triceps; Biceps; Diaphragm; Heart. Statistical analysis was performed using one-way ANOVA followed by Tukey's multiple comparison test. ; ; ; $P<0.05 vs. KO + AAV9; $$ P<0.01 vs. KO + AAV9).

[0179] Figure 4 Vector copy number (VCN) in organs of Mtm1-KO mice treated with various AAV vectors expressing hMTM1: AAVpo1 (KO + AAVpo1), AAVpo1A1 (KO + AAVpo1A1), AAV8 (KO + AAV8), AAV9 (KO + AAV9), and AAVrh10 (KO + AAVrh10). Statistical analysis was performed using one-way ANOVA, followed by Tukey's multiple comparison test. ; ; ; $P<0.05 vs. KO + AAV9; $$P<0.01 vs. KO + AAV9; $$$P<0.001 vs. KO + AAV9).

[0180] Figure 5 ： hMTM1 mRNA levels in the muscles of Mtm1-KO mice treated with various AAV vectors expressing hMTM1. AAVpo1 (KO + AAVpo1), AAVpo1A1 (KO + AAVpo1A1), AAV8 (KO + AAV8), AAV9 (KO + AAV9), AAVrh10 (KO + AAVrh10). MTM1 mRNA levels are expressed relative to expression in KO + AAV8. TA: Tibialis anterior; EDL: Extensor digitorum longus; Quadriceps; Ga: Gastrocnemius; Sol: Soleus; Triceps; Biceps; Diaphragm; Heart. Statistical analysis was performed using one-way ANOVA followed by Tukey's multiple comparison test. ; ; ; $P<0.05 vs. KO + AAV9; $$ P<0.01 vs. KO + AAV9; $$$ P<0.001 vs. KO + AAV9).

[0181] Figure 6 hMTM1 mRNA levels in organs of Mtm1-KO mice treated with various AAV vectors expressing MTM1. AAVpo1 (KO + AAVpo1), AAVpo1A1 (KO + AAVpo1A1), AAV8 (KO + AAV8), AAV9 (KO + AAV9), AAVrh10 (KO + AAVrh10). hMTM1 mRNA levels are expressed relative to expression in KO + AAV8. Statistical analysis was performed using one-way ANOVA, followed by Tukey's multiple comparison test. ; ; ;$ P<0.05 vs. KO + AAV9; $$$ P<0.001 vs. KO + AAV9).

[0182] Figure 7 hMTM1 protein levels in the muscle of Mtm1-KO mice treated with various AAV vectors expressing hMTM1. AAVpo1 (KO + AAVpo1), AAVpo1A1 (KO + AAVpo1A1), AAV8 (KO + AAV8), AAV9 (KO + AAV9), and AAVrh10 (KO + AAVrh10). Untreated wild-type (WT + PBS) and Mtm1-KO (KO + PBS) mice served as controls. GAPDH was used as an internal control.

[0183] Figure 8 : with 5×10 13 Immunolocalization of SMN protein in spinal neurons of C57BL / 6 mice injected with AAVpo1A1-SMN1 vector (vg / kg). SMN protein was fused with HA tag and detected using anti-HA antibody. Neurons were labeled with anti-NeuN antibody. Arrows indicate motor neurons expressing HA-SMN. Scale bar = 200µm (left) or 50µm (right).

[0184] Example

[0185] Materials and methods

[0186] The previously described tubulin gene (Mtm1In constitutive knockout of KO mouse strains (Buj-Bello et al., PNAS, 2002, 99, 15060-5. doi: 10.1073 / pnas.212498399; Al-Qusairi, et al., PNAS, 2009, 106, 18763-8. doi: 10.1073 / pnas.0900705106), porcine AAVpo1A1 capsid (the nucleotide sequence of the protein encoding SEQ ID NO:5, SEQ ID NO:13, contains the peptide of SEQ ID NO:4, replacing all residues 567-569 and 570-572 of the AAVpo1 capsid protein in SEQ ID NO:1) was compared with serotypes 8, 9, rh10, and po1 (Bello et al., Gene Therapy, 2009, 16, 1320-1328). doi: 10.1038 / gt.2009.821). These vectors were generated using a triple transfection method with HEK 293 cells and carried human desmin expression controlled by the human desmin promoter (1 kb) and miR208a target sequence. MTM1 The expression cassettes were also evaluated in C57BL / 6 mice, where expression cassettes of human SMN fused with HA tag sequences were controlled by the CAG promoter (Raguz et al., Dev.Biol., 1998, 201, 26-42; Paulin D&Li Z, Exp. Cell. Res., 2004, Nov 15; 301(1): 1-7; Roudault et al., Circulation, 2013, 128, 1094-104. doi: 10.1161 / CIRCULATIONAHA.113.001340). The AAVpo1A1 and AAV9 capsids were also evaluated in C57BL / 6 mice, where expression cassettes of human SMN fused with HA tag sequences were controlled by the CAG promoter (Meyer et al, Molecular Therapy, 2015, 23. doi: 10.1038 / mt.2014.210).

[0187] In 3-week-old mutant mice, a single intravenous dose of 2×10⁻⁶ was administered. 13 Various MTM1 expression vectors were administered at vg / kg, and tissues were harvested and frozen in nitrogen 4 weeks post-injection. As a control, in Mtm1 KO and wild-type littermate male mice were injected with PBS. C57BL / 6 mice received 8×10 PBS at 4 weeks of age. 12 Tissue was collected after 3 weeks with a dose of vg / kg of AAV9 or AAVpo1A1 vector.

[0188] The number of vector genomes per diploid genome was quantified from 32 ng of total DNA using a LightCycler 480 thermal cycler (Roche) via TaqMan real-time PCR. The titin gene was normalized using the following primers and probes: 5'- AAAACGAGCAGTGACGTGAGC -3'(positive; SEQ ID NO:6), 5'- TTCAGTCATGCTGCTAGCGC -3' (reverse; SEQ ID NO:7) and 5'- TGCACGGAAGCGTCTCGTCTCAGTC -3' (probe; SEQ ID NO: 8). Used for vector genome ( MTM1 The primers for amplification are: 5'- TTGGTTGTCCAGTTTGGAGTCTACT -3'(positive; SEQ ID NO:9), 5'- CCGTCACTGCAATGCACAAG -3' (reverse; SEQ ID NO:10) and 5'- ATATCAAGCTCGTTTTGAC -3' (probe; SEQ ID NO: 11). Used for vector genome ( SMN1 The primers for amplification are: 5'- CAGTGCAGGCTGCCTATCAG -3'(positive; SEQ ID NO:15), 5'- TGTGGGCCAGGGCATTAG -3'(reverse; SEQ ID NO:16), 5'- AAGTGGTGGCTGGTGTG -3' (probe; SEQ ID NO: 17). Used for vector genome ( SMN1 The other primers used for amplification are: 5'- GCTGCCTCCATTTCCTTCTG -3'(positive; SEQ ID NO:18), 5'- ACATACTTCCCAAAGCATCAGCAT -3'(reverse; SEQ ID NO:19), 5'- CACCACCTCCCATATGTCCAGATTCTCTTG -3'(probe; SEQ ID NO: 20).

[0189] Quantification of total RNA from 350 ng of reverse transcribed RNA using the RevertAid H negative reverse transcriptase kit (Thermo Scientific) MTM1 Transcript levels. Next, cDNA levels were amplified by qPCR using a LightCycler 480 thermal cycler (Roche). Normalization was performed on the RPLLP0 gene using primers and probes: 5'- CTCTGGAGAAACTGCTGCCT -3'(positive; SEQ ID NO:21), 5'- CTGCACATCACTCAGAATTTCAA -3' (reverse; SEQ ID NO:22) and 5'- AGGACCTCACTGAGATTCGGGATATGC -3'(probe; SEQ ID NO: 23).

[0190] Proteins were extracted and analyzed by NuPAGE 4–12% Bis-Tris gel electrophoresis and Western blotting. A polyclonal antibody against human myotubule protein (Abnova) was used to probe the membrane. A mouse monoclonal antibody specific to GAPDH (Merck Millopore) was used as an internal control. Detection was performed using secondary antibodies (donkey anti-goat 800 or goat anti-mouse 680 (Invitrogen)) and an Odyssey infrared imaging system (LI-COR Biotechnology Inc.).

[0191] For immunostaining of vector-derived HA-SMN, C57BL / 6 mice were injected with a single dose of 5 × 10⁻⁶. 13 Four weeks after administration of AAVpo1A1 vector at vg / kg, the children were euthanized via intraperitoneal injection of anesthesia (10 mg / kg toluidine, 100 mg / kg ketamine), followed by intracardiac perfusion with PBS and then 4% paraformaldehyde (PFA). Tissue was isolated and fixed after incubation in 4% PFA. The spinal cord was then incubated in PBS-sucrose solution (30%). Serial coronary cryogenic sections of the lumbar spinal cord were processed, blocked with mouse IgG blocking solution (Invitrogen), stained with rabbit anti-HA primary antibody (Sigma-Aldrich) for anti-HA labeling (hSMN), and stained with mouse anti-NeuN primary antibody (Sigma-Aldrich). Detection was performed using fluorescently bound secondary antibodies (goat anti-rabbit Alexa Fluor 488 and goat anti-mouse Alexa Fluor 594 (Invitrogen)). Sections were fixed with FluoroMount-G medium + DAPI, and images were taken with axioscan Z1 (Zeiss).

[0192] result

[0193] The AAV vectors expressing MTM1 (AAVpo1, AAVpo1A1, AAV8, AAV9, AAVrh10) were used at a rate of 2 × 10⁻⁶. 13 Mtm1-KO mice were intravenously injected with a dose of vg / kg. Starting two weeks post-injection, the weights of treated KO and WT mice were similar, while untreated KO mice began to lose weight after 6 weeks of age. Figure 1 Skeletal muscles, such as the tibialis anterior (TA), quadriceps (Qua), gastrocnemius (Ga), and triceps (Tri), in mutant mice from the AAVpo1 and AAVpo1A1 treatment groups were heavier than those in the AAV8 treatment group. Figure 2 ).

[0194] Quantification based on vector genome in skeletal muscle ( Figure 3 and 4 The AAVpo1A1 vector transduces most skeletal muscles as efficiently as the AAV8 vector. Interestingly, the AAVpo1A1 vector exhibits low transduction levels in organs such as the heart, liver, spleen, kidney, lung, and brain.

[0195] RT-qPCR analysis was performed on different muscles and organs. MTM1 Expression of transgenes ( Figure 5 and 6 Compared to AAV8, the AAVpo1A1 carrier showed higher activity in all skeletal muscles. MTM1 At the transcriptional level, while the transduction level was similar compared to the AAV9 vector, the transgene expression level reached a comparable level. Furthermore, administration of the AAVpo1A1 vector detargeted transgene expression in organs such as the liver and spleen, compared to what was observed after AAV8 vector delivery. MTM1 Transcriptional levels were much lower. Compared to the AAV8 group, mice treated with AAVpo1A1 showed higher levels of transgene expression in central nervous system regions (such as the cortex and spinal cord), and even higher levels of transgene expression in the spinal cord of mice treated with AAV9.

[0196] MTM1 protein expression in various muscles (gastrocnemius, triceps, and diaphragm) was analyzed by immunoblotting. Figure 7 Compared with AAV8 and AAVpo1 vectors, administration of the AAVpo1A1 vector resulted in higher levels of MTM1 protein in the skeletal muscle of mutant mice.

[0197] In 4-week-old C57BL / 6 mice, at 8×10 12 vg / kg intravenous injection expression SMN1 AAVpo1A1 and AAV9 vectors were used. Muscle and organs were collected after 3 weeks. The AAVpo1A1 vector transduced all skeletal muscle and heart of WT mice at similar levels. As previously reported... Mtm1 In -KO mice, administration of the AAVpo1A1 vector resulted in low transduction in the liver.

[0198] Transgenic expression was analyzed by RT-qPCR, and the results showed that after transduction with AAVpo1A1 and AAV9 vectors, transgenic expression in skeletal muscle was significantly reduced. SMN1 Transcriptional levels are similar. Compared to AAV9, AAVpo1A1-derived... SMN1 The levels of mRNA were low in the heart, liver, spleen, and kidneys. In the central nervous system, AAVpo1A1-derived mRNA... SMN1 Transcripts were present in all areas analyzed (cortex, cerebellum, and spinal cord), with slightly higher levels in the spinal cord.

[0199] To assess the cellular localization of SMN in the spinal cord, 5 × 10⁻⁶ cells were injected. 13 Four weeks after administration of vg / kg of the AAVpo1A1-SMN1 vector, immunofluorescence staining was performed using anti-HA and anti-NeuN antibodies. Figure 8 As shown, HA-SMN is expressed in neurons, particularly in large motor neurons located in the anterior horn of the spinal cord. The majority of motor neurons (mean 80%, range 72% to 94%, n=4 mice) were transduced with AAVpo1A1 and expressed the transgene.

[0200] In summary, this demonstrates the improved efficacy and tissue specificity of the AAVpo1A1 vector for targeted gene transfer in muscle and / or CNS, as it advantageously combines high transgene expression levels in skeletal muscle, brain, and spinal cord comparable to those of the AAV9 vector with vector-detargeted transgene expression in other organs such as the liver and spleen.

Claims

1. Use of a recombinant porcine adeno-associated virus (AAV) vector containing a peptide-modified porcine AAV serotype 1 capsid protein in the preparation of a medicament for gene therapy of neurological and neuromuscular disorders affecting the nervous system, wherein the peptide-modified porcine AAV serotype 1 capsid protein comprises the sequence shown in SEQ ID NO:

5.

2. Use of the recombinant porcine AAV vector according to claim 1, wherein the recombinant porcine AAV vector is characterized by a combination of detargeting and transgene expression levels in different muscle groups, as well as in the brain and spinal cord, after systemic administration, which is at least equivalent to the AAV9 vector if not superior to it.

3. Use of the recombinant porcine AAV vector according to claim 1 or 2, wherein the recombinant porcine AAV vector is a vector particle packaged with the therapeutically intended transgenic material.

4. Use of the recombinant porcine AAV vector according to claim 3, wherein the target transgene is operatively linked to a promoter that is functional in neurons and / or glial cells.

5. The use of the recombinant porcine AAV vector according to claim 3, wherein the therapeutic transgenic vector is selected from the group consisting of: (i) Therapeutic genes; (ii) Genes encoding therapeutic proteins or peptides; and (iii) Genes encoding therapeutic RNA.

6. Use of the recombinant porcine AAV vector according to claim 5, wherein the therapeutic protein or peptide is selected from the group consisting of therapeutic antibodies or antibody fragments and genome editing enzymes.

7. Use of the recombinant porcine AAV vector according to claim 5, wherein the therapeutic RNA is selected from the group consisting of interfering RNA, guide RNA for genome editing, and antisense RNA capable of exon skipping.

8. Use of the recombinant porcine AAV vector according to claim 1 or 2, wherein the neuromuscular disorder affecting the nervous system is a hereditary neuromuscular disorder affecting the nervous system.

9. Use of the recombinant porcine AAV vector according to claim 8, wherein the hereditary neuromuscular disorder affecting the nervous system is selected from the group consisting of: (i) spinal muscular atrophy and motor neuron disease; (ii) hereditary motor and sensory neuropathy; (iii) hereditary paraplegia and hereditary ataxia; and (iv) congenital myasthenia gravis.

10. Use of the recombinant porcine AAV vector according to claim 3, wherein the transgene of interest for therapy is a functional version of a gene selected from the group of genes causing inherited neuromuscular disorders affecting the nervous system: SMN1, ASAH1 SOD1, ALS2, SETX, FUS, ANG, TARDBP, FIG4, OPTN 、 SPAST, SPG7, MTMR2, CHAT, and AGRN a gene, or a therapeutic RNA targeting said gene causing inherited neuromuscular disorders affecting the nervous system.

11. Use of the recombinant porcine AAV vector according to claim 10, wherein the hereditary neuromuscular disorder affecting the nervous system is selected from the group consisting of: spinal muscular atrophy, amyotrophic lateral sclerosis, hereditary paraplegia, peroneal muscular atrophy, type 4B1, and congenital myasthenia gravis.

12. Use of the recombinant porcine AAV vector according to claim 3, wherein the therapeutically intended transgene is a human transgene operatively linked to a promoter that is functional in neurons and / or glial cells. SMN1 Gene.

13. Use of the recombinant porcine AAV vector according to claim 1 or 2, wherein the recombinant porcine AAV vector is administered via a systemic route; via an intracerebral, intraventricular, intracisional, and / or intrathecal route; or via a combination thereof.

Images