Phytogenic additive and application thereof in promoting growth and combating coccidiosis and / or necrotic enteritis

Abstract

The present disclosure provides a method of reducing, preventing or treating an intestinal infection, preventing or treating a disease associated with protozoan parasite of the genus Eimeria, inhibiting an oocyst sporulation of a protozoan parasite or preventing a sporozoite invasion or reproduction, preventing or treating coccidiosis, promoting growth performance, controlling, treating and / or preventing necrotic enteritis in a subject, comprising administering to the subject an effective amount of a composition comprising a Crassocephalum rabens (CR), a bioactive extract thereof (CRE), an active ingredient(s) contained in a CR (CR_API) or CRE (CRE_API), a combination of two or more of a CR, a CRE, a CR_API and a CRE_API, or one or more of a-linolenic acid, citric acid, lactic acid, mannitol, palmitic acid, aspartic acid and 1-monomyristin.

Description

PATENTAttorney Docket No. G4590-20900PCTPHYTOGENIC ADDITIVE AND APPLICATION THEREOF IN PROMOTING GROWTH AND COMBATING COCCIDIOSIS AND / OR NECROTIC ENTERITISPRIORITY INFORMATION

[0001] This application claims benefit of and priority to U. S. Provisional Patent Application No.63 / 725,964, filed November 27, 2024, the contents of which is incorporated by reference in its entirety.FIELD OF THE INVENTION

[0002] The present disclosure relates generally to a phytogenic field. Particularly, the present disclosure relates to an herbal plant, an extract thereof or an active ingredient(s) contained therein and methods for providing the same in promoting growth and preventing or treating coccidiosis and / or necrotic enteritis in poultry.BACKGROUND OF THE INVENTION

[0003] Coccidiosis has become one of the most severe contagious parasite intestinal diseases in the poultry industry worldwide, causing reduced feed intake, digestive disorders, growth retardation, hemorrhagic diarrhea, and in severe cases, even death. Coccidiosis is caused by a protozoan parasite of the genus Eimeria. Currently, seven species of Eimeria with different pathogenicity have been identified from chickens, i.e. Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria brunelli, Eimeria necalrix, Eimeria praecox, and Eimeria mitis (Tewari, A. K., andB. R. Maharana. 2011. Control of poultry coccidiosis: changing trends. J. Parasit. Dis.35:10-17). Chicken Eimeria also increases the susceptibility of the host to other pathogens, of which Clostridium perfringens is commonly co-infected with some Eimeria species to cause necrotic enteritis (Williams, R. B., R. N. Marshall, R. R. La Ragione, and J. Catchpole. 2003. A new method for the experimental production of necrotic enteritis and its use for studies on the relationships between necrotic enteritis, coccidiosis and anticoccidial vaccination of chickens. Parasitol. Res. 90:19-26), while perturbing the integrity of the normal gut microbiota, resulting in the proliferation of pathogenic bacteria, which affects chicken growth (Huang, G., X. Tang, F. Bi, Z. Hao, Z. Han, J. Suo, S. Zhang, S. Wang, C. Duan, Z. Yu, F. Yu, Y. Yu, Y. Lv, X. Suo, and X. Liu. 2018. Eimeria tenella infection perturbs the chicken gut microbiota from the onset of oocyst shedding. Vet. Parasitol. 258:30-37). Moreover, coccidiosis costs the global poultry industry more than US$13 billion annually, including losses during production and costs for prophylaxis and treatment (Blake, D. P, J. Knox, B. Dehaeck, B. Huntington, T. Rathinam, V. Ravipati, S.PATENTAttorney Docket No. G4590-20900PCTAyoade, W. Gilbert, A. O. Adebambo, I. D. Jatau, M. Raman, D. Parker, J. Rushton and E M. Tomley. 2020. Re-calculating the cost of coccidiosis in chickens. Veterinary Research, 51:1-14.).

[0004] Accordingly, many commercially available anticoccidial drugs and vaccines have been used to prevent and control coccidiosis; however, they are still inadequate for curbing the disease (Qaid, M. M., S. I. Al-Mufarrej, M. M. Azzam, M. A. Al-Garadi, H. H. Albaadani, I. A. Alhidary, and R. S. Aljumaah. 2021. Anti-coccidial effect ofRumex nervosus leaf powder on broiler chickens infected with Eimeria tenella oocyst. Animals. 11:167-183). Recently, issues such as delays in chemical drug discovery, drug resistance and drug residues have led to the development of safe and effective anticoccidial herbal medicines and phytochemicals (Muthamilselvan, T., T. F. Kuo, Y. C. Wu, and W. C. Yang. 2016. Herbal remedies for coccidosis control: a review of plants, compounds, and anticoccidial actions. Evid. Based. Complement. Alternat. Med. 2016:2657981). The increasing issue of drug-resistant strains of Eimeria species still occurs and thus there is an unmet need to develop a substitute and an alternative approach to the conventional coccidiostat in the poultry industry.

[0005] Moreover, necrotic enteritis (NE), a widespread disease in domestic animals, particularly in domestic fowls, is caused by Clostridium perfringens leading to the development of necrotic lesions in the gut wall, and thereby poor growth performance and even increased mortality. The presence of specific pathogenic C. perfringens strains, infection by other pathogens particularly coccidia, nutritional status of birds, feed formula, stress conditions by flock density, thermal stress, poor ventilation, and high litter moisture in the environments, and even genetic selection are complicated with NE development, contributing to its severity and prevalence of outbreak (Timbermont L, Haesebrouck F., Ducatelle R, Van Immerseel F. Necrotic enteritis in broilers: an updated review on the pathogenesis. Avian Pathiol. 2011. 40, 341-347). The clinical sign of NE is very short and normally infected chicks showed severe depression and suffered acute death within hours. Moreover, a sudden increase in flock mortality would be observed under a severe outbreak. Under subclinical illness of NE, chronic damages on the intestinal mucosal layer tends to impair digestion and absorption, and thus results in poor growth performance (Kaldhusdal M., Schneitz C, Hof shagen M., Skjerve E. Reduced incidence of Clostridium perfringens- associated lesions and improved performance in broiler chickens treated with normal intestinal bacteria from adult fowl. Avian Dis. 2001. 45, 149-156). The intestinal damage even can allow the bacterial infiltration leading to colonization in the liver and cholangiohepatitis. In birds under NE development, gross lesions in the infection sites and a large segment of the small intestine with a thinner wall and filled with gas were usually observed. Subclinical cases typically show ulcersPATENTAttorney Docket No. G4590-20900PCTwith faint color exudate materials adhering on the depressed mucosal surface. In overt clinical NE cases, some of pronounced mucosal necrotic lesions are extended to in a large part along the small intestine and manifested with a yellow-brown pseudomembrane (Olkowski A. A., Wojnarowicz C., Chinio-Trejo M., Drew M. D. Responses of broiler chickens orally challenged with Clostridium perfringens isolated from field cases of necrotic enteritis. Res Vet. Sci. 2006. 81, 99-108).SUMMARY OF THE INVENTION

[0006] In the present disclosure, it is found that a phytogenic additive supports an animal’s health and prevents or treats diseases. For example, Crassocephalum rabens (CR) or a bioactive extract thereof (CRE) and an active ingredient(s) contained in the CR (CR API) or CRE (CRE API), and / or Alpinia zerumbet (AL), a bioactive extract thereof (ALE) or an active ingredient(s) contained in a AL or a ALE (AL API) for use as a feed or feed additive or supplement in poultry is provided.

[0007] Crassocephalum rabens for controlling intestinal infection

[0008] In one aspect, the present disclosure provides a method of reducing, preventing or treating an intestinal infection in a subject, comprising administering to the subject an effective amount of a composition comprising a CR, a bioactive CRE, an active ingredient(s) contained in a CR (CR API) or a CRE (CRE API), or a combination of two or more of a CR, a CRE, a CR-API and a CRE API. In one embodiment, the method further decreases the occurrence of intestinal infection. In some embodiments, the intestinal infection is associated with at least one protozoan microorganism selected from the group consisting of Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria brunetti, Eimeria necatrix, Eimeria praecox, Eimeria mitis or any combination thereof.

[0009] In one aspect, the present disclosure provides a method of preventing or treating a disease associated with protozoan parasite of the genus Eimeria in a subject, comprising administering to the subject an effective amount of a composition comprising a CR, a CRE, an active ingredient(s) contained in a CR (CR API) or a CRE (CRE API), or a combination of two or more of a CR, a CRE, a CR-API and a CRE API. In some embodiments, the Eimeria is selected from the group consisting of Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria brunetti, Eimeria necatrix, Eimeria praecox, Eimeria mitis or any combination thereof.

[0010] In one aspect, the present disclosure provides a method of inhibiting an oocyst sporulation of a protozoan parasite or preventing a sporozoite invasion or reproduction in a subject, comprising administering to the subject an effective amount of a composition comprising a CR, a CRE, anPATENTAttorney Docket No. G4590-20900PCTactive ingredient(s) contained in a CR (CR API) or a CRE (CRE API), or a combination of two or more of a CR, a CRE, a CR-API and a CRE API.

[0011] In another aspect, the present disclosure provides a method of preventing or treating cocci diosis in a subject, comprising administering to the subject an effective amount of a composition comprising a CR, a CRE, an active ingredient(s) contained in a CR (CR API) or a CRE (CRE API), or a combination of two or more of a CR, a CRE, a CR-API and a CRE API.

[0012] In another aspect, the present disclosure provides a method of promoting growth performance of a subject, comprising administering to the subject an effective amount of a composition comprising a CR, a CRE, an active ingredient(s) contained in a CR (CR API) or a CRE (CRE API), or a combination of two or more of a CR, a CRE, a CR-API and a CRE API. In one embodiment, a body weight gain of the poultry is restored. In at least one embodiment of the present disclosure, primary metabolome in the poultry is modulated. In some embodiments, the promotion of growth performance involves enhancing methionine utilization and dissipating less energy for uric acid synthesis for nitrogenous waste excretion and increasing a level of organic acids and / or a level of tyrosine, decreasing a level of hypoxanthine.

[0013] In another aspect, the present disclosure provides a method of controlling, treating and / or preventing necrotic enteritis in a subject, comprising administering to the subject an effective amount of a composition comprising a CR, a CRE, an active ingredient(s) contained in CR (CR API) or CRE (CRE API), or a combination of two or more of a CR, a CRE, a CR-API and a CRE API.

[0014] In another aspect, the present disclosure provides a method of reducing, preventing or treating an intestinal infection, preventing or treating a disease associated with protozoan parasite of the genus Eimeria, inhibiting an oocyst sporulation of a protozoan parasite or preventing a sporozoite invasion or reproduction, preventing or treating coccidiosis and / or necrotic enteritis, and / or promoting growth performance of a subject, comprising administering to the subject an effective amount of a composition comprising one or more of a-linolenic acid, citric acid, lactic acid, mannitol, palmitic acid, aspartic acid and 1-monomyristin. In one embodiment, a body weight gain of the poultry is restored. In at least one embodiment of the present disclosure, primary metabolome in the poultry is modulated. In some embodiments, the promotion of growth performance involves enhancing methionine utilization and dissipating less energy for uric acid synthesis for nitrogenous waste excretion and increasing a level of organic acids and / or a level of tyrosine, decreasing a level of hypoxanthine.PATENTAttorney Docket No. G4590-20900PCT

[0015] In some embodiments, the active ingredient(s) in the CR described herein comprises one or more of the following components: a-linolenic acid, citric acid, lactic acid, mannitol and palmitic acid.

[0016] In at least one embodiment, the CR has one or more of the following characteristics: about 45% to about 80%, about 45% to about 75%, about 45% to about 70%, about 45% to about 65%, about 45% to about 60%, about 45% to about 55%, about 45% to about 50%, about 50% to about 80%, about 50% to about 75%, about 50% to about 70%, about 50% to about 65%, about 50% to about 60%, about 50% to about 55%, about 55% to about 80%, about 55% to about 75%, about 55% to about 70%, about 55% to about 65%, about 55% to about 60%, about 60% to about 80%, about 60% to about 75%, about 60% to about 70%, about 60% to about 65%, about 65% to about 80%, about 65% to about 75%, about 65% to about 70%, about 70% to about 80% or about 70% to about 75% of a-linolenic acid and about 55% to about 20%, about 55% to about 25%, about 55% to about 30%, about 55% to about 35%, about 55% to about 40%, about 55% to about 45%, about 55% to about 50%, about 50% to about 20%, about 50% to about 25%, about 50% to about 30%, about 50% to about 35%, about 50% to about 40%, about 50% to about 45%, about 45% to about 20%, about 45% to about 25%, about 45% to about 30%, about 45% to about 35%, about 45% to about 40%, about 40% to about 20%, about 40% to about 25%, about 40% to about 30%, about 40% to about 35%, about 35% to about 20%, about 35% to about 25%, about 35% to about 30% of citric acid in relative amount;about 25% to about 65%, about 25% to about 60%, about 25% to about 55%, about 25% to about 50%, about 25% to about 45%, about 25% to about 40%, about 25% to about 35%, about 25% to about 30%, about 30% to about 65%, about 30% to about 60%, about 30% to about 55%, about 30% to about 50%, about 30% to about 45%, about 30% to about 40%, about 30% to about 35%, about 30% to about 65%, about 30% to about 60%, about 30% to about 55%, about 30% to about 50%, about 30% to about 45%, about 30% to about 40%, about 30% to about 35%, about 35% to about 65%, about 35% to about 60%, about 35% to about 55%, about 35% to about 50%, about 35% to about 40%, about 40% to about 65%, about 40% to about 60%, about 40% to about 55%, about 40% to about 50%, about 40% to about 45%, about 45% to about 65%, about 45% to about 60%, about 45% to about 55%, about 45% to about 50%, about 50% to about 65%, about 50% to about 60%, about 50% to about 55%, about 55% to about 65% or about 55% to about 60% of citric acid and about 75% to about 35%, about 75% to about 40%, about 75% to about 45%, about 75% to about 50%, about 75% to about 50%, about 75% to about 55%, about 75% to about 60%, about 75% to about 65%, about 75% to about 70%, about 70% to about 35%, about 70% to aboutPATENTAttorney Docket No. G4590-20900PCT40%, about 70% to about 45%, about 70% to about 50%, about 70% to about 55%, about 70% to about 60%, about 70% to about 65%, about 65% to about 35%, about 65% to about 40%, about 65% to about 45%, about 65% to about 50%, about 65% to about 55%, about 65% to about 60%, about 60% to about 35%, about 60% to about 40%, about 60% to about 45%, about 60% to about 50%, about 60% to about 55%, about 55% to about 35%, about 55% to about 40%, about 55% to about 45%, about 55% to about 50%, about 50% to about 35%, about 50% to about 40%, about 50% to about 45%, about 45% to about 35% or about 45% to about 40% of lactic acid in relative amount;about 30% to about 70%, about 30% to about 65%, about 30% to about 60%, about 30% to about 55%, about 30% to about 50%, about 30% to about 45%, about 30% to about 40%, about 30% to about 35%, about 35% to about 70%, about 35% to about 65%, about 35% to about 60%, about 35% to about 55%, about 35% to about 50%, about 35% to about 45%, about 35% to about 40%, about 40% to about 70%, about 40% to about 65%, about 40% to about 60%, about 40% to about 55%, about 40% to about 50%, about 40% to about 45%, about 45% to about 70%, about 45% to about 65%, about 45% to about 60%, about 45% to about 55%, about 45% to about 50%, about 50% to about 70%, about 50% to about 65%, about 50% to about 60%, about 50% to about 55%, about 55% to about 70%, about 55% to about 65%, about 55% to about 60%, about 60% to about 70% or about 60% to about 65% of citric acid and about 70% to about 30%, about 70% to about 35%, about 70% to about 40%, about 70% to about 45%, about 70% to about 50%, about 70% to about 55%, about 70% to about 60%, about 70% to about 65%, about 65% to about 30%, about 65% to about 35%, about 65% to about 40%, about 65% to about 45%, about 65% to about 50%, about 65% to about 55%, about 65% to about 50%, about 60% to about 30%, about 60% to about 35%, about 60% to about 40%, about 60% to about 45%, about 60% to about 50%, about 60% to about 55%, about 55% to about 30%, about 55% to about 35%, about 55% to about 40%, about 55% to about 45%, about 55% to about 50%, about 50% to about 30%, about 50% to about 35%, about 50% to about 40%, about 50% to about 45%, about 45% to about 30%, about 40% to about 35% or about 35% to about 30% of mannitol in relative amount;about 35% to about 75%, about 35% to about 70%, about 35% to about 65%, about 35% to about 60%, about 35% to about 55%, about 35% to about 50%, about 35% to about 45%, about 35% to about 40%, about 40% to about 75%, about 40% to about 70%, about 40% to about 65%, about 40% to about 60%, about 40% to 55%, 40% to 50%, about 40% to about 45%, about 45% to about 75%, about 45% to about 70%, about 45% to about 65%, about 45% to about 60%, about 45% to about 55%, about 45% to about 50%, about 50% to about 75%, about 50% to about 70%, aboutPATENTAttorney Docket No. G4590-20900PCT50% to about 65%, about 50% to about 60%, about 50% to about 55%, about 55% to about 75%, about 55% to about 70%, about 55% to about 65%, about 55% to about 60%, about 60% to about 75%, about 60% to about 70%, about 60% to about 65%, about 65% to about 75%, or about 65% to about 70% of lactic acid and about 65% to about 25%, about 65% to about 30%, about 65% to about 35%, about 65% to about 40%, about 65% to about 45%, about 65% to about 50%, about 65% to about 55%, about 65% to about 60%, about 60% to about 25%, about 60% to about 30%, about 60% to about 35%, about 60% to about 40%, about 60% to about 45%, about 60% to about 50%, about 60% to about 55%, about 55% to about 25%, about 55% to about 30%, about 55% to about 35%, about 55% to about 40%, about 55% to about 45%, about 55% to about 50%, about 50% to about 25%, about 50% to about 30%, about 50% to about 35%, about 50% to about 40%, about 50% to about 45%, about 45% to about 25%, about 45% to 30%, about 45% to about 35%, 45% to about 40%, about 40% to about 25%, about 40% to about 30%, about 40% to about 35%, about 35% to about 25%, about 35% to about 30% or about 30% to about 25% of mannitol in relative amount; andabout 1% to about 25%, about 1% to about 20%, about 1% to about 15%, about 1% to about 10%, about 1% to about 5%, about 5% to about 25%, about 5% to about 20%, about 5% to about 15%, about 5% to about 10%, about 10% to about 25%, about 10% to about 20%, about 10% to about 15%, about 15% to about 25%, about 15% to about 20% or about 20% to about 25% of a-linolenic acid and about 99% to about 75%, about 95% to about 75%, about 90% to about 75%, about 85% to about 75%, about 80% to about 75%, about 99% to about 80%, about 95% to about 80%, about 90% to about 80%, about 85% to about 80%, about 99% to about 85%, about 95% to about 85%, about 90% to about 85%, about 99% to about 90%, about 95% to about 90% or about 99% to about 95% of palmitic acid in relative amount.

[0017] In a further embodiment, the CR has one or more of the following characteristics:• a ratio of a-linolenic acid to citric acid of 1.66 to 1 or less in relative amount;• a ratio of citric acid to lactic acid of 0.79 to 1 or less in relative amount;• a ratio of citric acid to mannitol of 0.94 to 1 or less in relative amount;• a ratio of lactic acid to mannitol of 1.19 to 1 or less in relative amount; and• a ratio of a-linolenic acid to palmitic acid of 0.086 to 1 or less in relative amount.

[0018] In some embodiments, the active ingredient(s) in the CRE described herein comprises one or more of the following components: a-linolenic acid, aspartic acid, mannitol, 1-monomyristin and lactic acid.

[0019] In at least one embodiment, the CRE has one or more of the following characteristics:PATENTAttorney Docket No. G4590-20900PCTabout 1% to about 25%, about 1% to about 20%, about 1% to about 15%, about 1% to about 10%, about 1% to about 5%, about 5% to about 25%, about 5% to about 20%, about 5% to about 15%, about 5% to about 10%, about 10% to about 25%, about 10% to about 20%, about 10% to about 15%, about 15% to about 25%, about 15% to about 20% or about 20% to about 25% of aspartic acid and about 99% to about 75%, about 95% to about 75%, about 90% to about 75%, about 85% to about 75%, about 80% to about 75%, about 99% to about 80%, about 95% to about 80%, about 90% to about 80%, about 85% to about 80%, about 99% to about 85%, about 95% to about 85%, about 90% to about 85%, about 99% to about 90%, about 95% to about 90% or about 99% to about 95% of a-linolenic acid in relative amount;about 65% to about 99%, about 65% to about 95%, about 65% to about 90%, about 65% to about 85%, about 65% to about 80%, about 65% to about 75%, about 65% to about 70%, about 70% to about 99%, 70% to 95%, 70% to about 90%, about 70% to 85%, about 70% to about 75%, about 75%, about 99%, about 75% to about 90%, about 75% to about 85%, about 75% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 85% to about 99%, about 85% to about 95%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% of mannitol and about 35% to about 1%, about 35% to about 5%, about 35% to about 10%, about 35% to about 15%, about 35% to about 20%, about 35% to about 25%, about 35% to about 30%, about 30% to about 1%, about 30% to about 5%, about 30% to about 10%, about 30% to about 15%, about 30% to about 20%, about 30% to about 25%, about 25% to about 1%, about 25% to about 5%, about 25% to about 10%, about 25% to about 15%, about 25% to about 20%, about 20% to about 1%, about 20% to about 5%, about 20% to about 10%, about 20% to about 15%, about 15% to about 1%, about 15% to about 5%, about 15% to about 10%, about 10% to about 1% or about 10% to about 5% of aspartic acid in relative amount;about 40% to about 80%, about 45% to about 80%, about 50% to about 80%, about 55% to about 80%, about 60% to about 80%, 65% to about 80%, about 70% to about 80%, about 75% to about 80%, about 40% to about 75%, about 45% to about 75%, about 50% to about 75%, about 55% to about 75%, about 60% to about 75%, about 65% to about 75%, about 70% to about 75%, about 40% to about 70%, about 45% to about 70%, about 50% to about 70%, 55% to about 70%, 60% to about 70%, about 65% to about 70%, about 40% to about 65%, about 50% to 65%, about 55% to about 65%, about 55% to about 60%, about 40% to about 60%, about 45% to about 60%, about 50% to about 60%, about 55% to about 60%, about 40% to about 55%, about 45% to about 55%, about 45% to about 50% or about 40% to about 45% of a-linolenic acid and about 60% to about 20%, about 60% to 25%, about 60% to about 30%, about 60% to about 35%, about 60% to aboutPATENTAttorney Docket No. G4590-20900PCT40%, about 60% to about 45%, about 60% to about 50%, about 60% to about 55%, about 55% to about 20%, about 55% to about 25%, about 55% to about 30%, about 55% to about 35%, about 55% to about 40%, about 55% to about 50%, about 50% to about 20%, about 50% to about 25%, about 50% to about 30%, about 50% to 35%, 50% to about 40%, about 50% to about 45%, 45% to about 20%, about 45% to about 25%, about 45% to about 30%, 45% to about 35%, about 45% to about 40%, about 40% to about 20%, about 40% to about 25%, about 40% to about 30%, about 40% to about 35%, about 35% to about 20%, about 35% to about 25%, about 35% to about 30%, 30% to about 20%, about 30% to 25% or about 25% to about 20% of mannitol in relative amount; about 0.1% to about 20%, about 0.5% to about 20%, about 1% to about 20%, about 5% to about 20%, about 10% to about 20%, about 15% to about 20%, about 0.1% to about 15%, about 0.5% to about 15%, about 1% to about 15%, about 5% to about 15%, about 10% to about 15%, about 0.1% to about 10%, about 0.5% to about 10%, about 1% to about 10%, about 5% to about 10%, about 0.1% to about 5%, about 0.5% to about 5%, about 1% to about 5%, about 0.1% to about 1%, about 0.5% to about 1% or about 0.1% to about 0.5% of aspartic acid and about 99.9% to about 80%, about 99.9% to about 85%, about 99.9% to about 90%, about 99.9% to about 95%, about 95% to about 80%, about 95% to about 85%, about 95% to about 90%, about 90% to about 80%, about 90% to about 85%, about 85% to about 80% of 1-monomyristin in relative amount; and about 70% to about 99.9%, about 75% to about 99.9%, about 80% to about 99.9%, about 85% to about 99.9%, about 90% to about 99.9%, about 95% to about 99.9%, about 70% to about 95%, about 75% to about 95%, about 80% to about 95%, about 85% to about 95%, about 90% to about 95%, about 70% to about 90%, about 75% to about 90%, about 80% to about 90%, about 85% to about 90%, about 70% to about 85%, about 70% to about 80% or about 70% to about 75% of lactic acid and about 30% to about 0.1%, about 30% to about 0.5%, about 30% to about 1%, about 30% to about 5%, about 30% to about 10%, about 30% to about 15%, about 30% to about 20%, about 30% to 25%, about 25% to about 0.1%, about 25% to about 0.5%, about 25% to about 1%, about 25% to about 5%, about 25% to about 10%, about 25% to about 15%, about 25% to about 20%, about 20% to about 0.1%, about 20% to 0.5%, about 20% to about 1%, about 20% to about 5%, about 20% to about 10%, about 20% to about 15%, about 15% to about 0.1%, about 15% to about 0.5%, about 15% to about 1%, about 15% to about 5%, about 15% to about 10%, about 10% to about 0.1%, about 10% to about 0.5%, about 10% to about 1%, about 10% to about 5%, about 5% to about 0.1%, about 5% to about 0.5%, about 5% to about 1%, about 1% to about 0.1%, about 1% to about 0.5% or about 0.5% to about 0.1% of aspartic acid in relative amount.

[0020] In a further embodiment, the CRE has one or more of the following characteristics:PATENTAttorney Docket No. G4590-20900PCT• a ratio of aspartic acid to a-linolenic acid of 0.088 to 1 or less in relative amount;• a ratio of mannitol to aspartic acid of 7.27 to 1 or less in relative amount;• a ratio of a-linolenic acid to mannitol of 1.56 to 1 or less in relative amount;• a ratio of aspartic acid to 1-monomyristin of 0.035 to 1 or less in relative amount; and• a ratio of lactic acid to aspartic acid of 8.69 to 1 or less in relative amount.

[0021] In one embodiment, the subject described herein is poultry. In some embodiment, the poultry is a chicken, a duck, a turkey, a quail, an ostrich or a goose. In a further embodiment, the poultry is a chicken.

[0022] In some embodiments, the protozoan parasite described herein is Eimeria acervulina, Eimeria lenella. Eimeria maxima, Eimeria brunelli, Eimeria necalrix, Eimeria praecox o Eimeria mitis or any combination thereof.

[0023] In one embodiment, the intestinal infection is caused by Clostridium perfringens.

[0024] In some embodiments, the composition described herein is in a powder form (e.g., a dried powder) or a liquid form (e.g., aqueous solution, oil suspension), or a granule form.

[0025] In one embodiment, the composition described herein is used as an additive (such as a feed additive) or a supplement (such as a feed supplement).

[0026] In one embodiment, the CRE is an alcoholic CRE. In a further embodiment, the CRE is an ethanolic CRE. In another further embodiment, the CRE is an about 50% to 99.5% ethanol CRE. Preferably, the CRE is an about 70% ethanol CRE.

[0027] Alpinia z erumbet for controlling intestinal infection

[0028] In one aspect, the present disclosure provides a method of controlling, reducing, preventing or treating an intestinal infection in a subject, comprising administering to the subject an effective amount of a composition comprising an AL, a bioactive ALE, an active ingredient(s) contained in AL (AL API) or ALE (ALE API), or a combination of two or more of an AL, an ALE, an AL-API and an ALE API.

[0029] In one embodiment, the method further decreases the occurrence of intestinal infection.

[0030] In one embodiment, the intestinal infection is caused by Clostridium perfringens. In one embodiment, the intestinal infection causes necrotic enteritis. In a further embodiment, the intestinal infection is associated with necrotic enteritis caused by Clostridium perfringens infection.

[0031] In some embodiments, the method can alleviate intestinal injury, improve its integrity and villus morphology, suppress local and systemic inflammation, improve intestinal mucosal integrityPATENTAttorney Docket No. G4590-20900PCTfor nutrient digestion and absorption, and / or preclude pathogen colonization and infiltration into the circulation.

[0032] In another aspect, the present disclosure provides a method of controlling, treating and / or preventing necrotic enteritis in a subject, comprising administering to the subject an effective amount of an AL, a bioactive ALE, and an active ingredient(s) contained in AL (AL API) or ALE (ALE API), or a combination of two or more of an AL, an ALE, an AL-API and and an ALE API.

[0033] In another aspect, the present disclosure provides a method of promoting growth performance of a subject, comprising administering to the subject an effective amount of a composition comprising an AL, an ALE, an active ingredient(s) contained in an AL (AL API) or an ALE (ALE API), or a combination of two or more of an AL, an ALE, an AL API and an ALE (ALE API). In one embodiment, a body weight gain of the poultry is restored. In at least one embodiment of the present disclosure, primary metabolome in the poultry is modulated.

[0034] In another aspect, the present disclosure provides a method of reducing, preventing or treating an intestinal infection, preventing or treating necrotic enteritis, and / or promoting growth performance of a subject, comprising administering to the subject an effective amount of a composition comprising one or more of dihydro-5, 6-dehydrokavain (DDK), 5,6-dehydrokavain (DK), cardamonin and flavokawin B. In a further embodiment, the dihydro-5, 6-dehydrokavain (DDK), 5,6-dehydrokavain (DK), cardamonin and flavokawin B are in following relative amounts respectively:about 50% to about 90%, about 50% to about 85%, about 50% to about 80%, about 50% to about 75%, about 50% to about 70%, about 50% to about 65%, about 50% to about 55%, about 55% to about 90%, about 55% to about 85%, about 55% to about 80%, about 55% to about 75%, about 55% to about 70%, about 55% to about 65%, about 55% to about 60%, about 60% to about 90%, about 60% to about 85%, about 60% to about 80%, about 60% to about 75%, about 60% to about 70%, about 60% to about 65%, about 65% to about 90%, about 65% to about 85%, about 65% to about 80%, about 65% to about 75%, about 70% to about 90%, about 70% to about 85%, about 70% to about 80%, about 70% to about 75%, about 75% to about 90%, about 75% to about 85%, about 75% to about 80%, about 80% to about 90% or about 80% to about 85%;about 10% to about 45%, about 10% to about 40%, about 10% to about 35%, about 10% to about 30%, about 10% to about 25%, about 10% to about 20%, about 10% to about 15%, about 15% to about 45%, about 15% to about 40%, about 15% to about 35%, about 15% to about 30%, about 15% to about 25%, about 15% to about 20%, about 20% to about 45%, about 20% to about 40%, about 20% to about 35%, about 20% to about 30%, about 20% to about 25%, about 25% to aboutPATENTAttorney Docket No. G4590-20900PCT45%, about 25% to about 40%, about 25% to about 35%, about 25% to about 30%, about 30% to about 45%, about 30% to about 40%, about 30% to about 35%, about 35% to about 45%, about 35% to about 40%;about 0.5% to about 5%, about 0.5% to about 4%, about 0.5% to about 3%, about 0.5% to about 2%, about 0.5% to about 1%, about 1% to about 5%, about 1% to about 4%, about 1% to about 3%, about 1% to about 2%, about 1.5% to about 5%, about 1.5% to about 4%, about 1.5% to about 3%, about 1.5% to about 2%, about 2% to about 5%, about 2% to about 4.5%, about 2% to about 4%, about 2% to about 3.5%, about 2% to about 3.0%, about 2% to about 2.5%, about 2.5% to about 5%, about 2.5% to about 4%, about 2.5% to about 3%, about 3% to about 5%, about 3% to about 4%, about 3% to about 3.5%, about 3.5% to about 5%, about 3.5% to about 4.5%, about 3.5% to about 4%, about 4% to about 5% or about 4% to about 4.5%; andabout 8% to about 1%, about 6% to about 1%, about 4% to about 1%, about 2% to about 1%, about 6% to about 1%, about 6% to about 4%, about 6% to about 2%, about 6% to about 1%, about 4% to about 1%, about 4% to about 2%, about 4% to about 3%, about 4% to about 2%, or about 4% to about 1%, about 3% to about 2%, about 2% to about 1%, respectively.

[0035] In a further embodiment, the dihydro-5, 6-dehydrokavain (DDK), 5,6-dehydrokavain (DK), cardamonin and flavokawin B are in relative amounts of about 70.4%, about 24.2%, about 1.7% and about 3.7%, respectively.

[0036] In one embodiment, a body weight gain of the poultry is restored. In at least one embodiment of the present disclosure, primary metabolome in the poultry is modulated.

[0037] In another aspect, the present disclosure provides a method of reducing, preventing or treating an intestinal infection, preventing or treating necrotic enteritis, and / or promoting growth performance of a subject, comprising administering to the subject an effective amount of a composition comprising one or more of lactic acid, malic acid, nicotinic acid, palmitic acid, myoinositol, maltose and 1-monomyristin. In one embodiment, a body weight gain of the poultry is restored. In at least one embodiment of the present disclosure, primary metabolome in the poultry is modulated.

[0038] In some embodiments, the active ingredient(s) in AL or ALE described herein comprises one or more of the following components: lactic acid, malic acid, nicotinic acid, palmitic acid, myo-inositol, maltose and 1-monomyristin.

[0039] In at least one embodiment, the AL or ALE has one or more of the following characteristics: about 70% to about 99%, about 75% to about 99%, about 80% to about 99%, about 85% to about 99%, about 90% to about 99%, about 95% to about 99%, about 70% to about 95%, about 75% toPATENTAttorney Docket No. G4590-20900PCTabout 95%, about 80% to about 95%, about 85% to about 95%, about 90% to about 95%, about 70% to about 90%, about 75% to about 90%, about 80% to about 90%, about 85% to about 90%, about 70% to about 85%, about 70% to about 80% or about 70% to about 75% of lactic acid and about 30% to about 1%, about 30% to about 5%, about 30% to about 10%, about 30% to about 15%, about 30% to about 20%, about 30% to 25%, about 25% to about 1%, about 25% to about 5%, about 25% to about 10%, about 25% to about 15%, about 25% to about 20%, about 20% to about 1%, about 20% to about 5%, about 20% to about 10%, about 20% to about 15%, about 15% to about 1%, about 15% to about 5%, about 15% to about 10%, about 10% to about 1%, about 10% to about 5% or about 5% to about 1% of malic acid in relative amount;about 0.05% to about 5%, about 0.05% to about 1%, about 0.05% to about 0.5%, about 0.05% to about 0.1%, about 0.1% to about 5%, about 0.1% to about 1%, about 0.1% to about 0.5%, about 0.5% to about 5%, about 0.5% to about 1% or about 1% to about 5% of malic acid and about 99.95% to about 95%, about 99.95% to about 99%, about 99.95% to about 98%, about 99.95% to about 97%, about 99.95% to about 96%, about 99.9% to about 95%, about 99.9% to about 96%, about 99.9% to about 97%, about 99.9% to about 98% or about 99.9% to about 99% of nicotinic acid in relative amount;about 0.01% to about 1%, about 0.01% to about 0.5%, about 0.01% to about 0.1%, about 0.05% to about 1%, about 0.05% to about 0.5%, about 0.05% to about 0.1%, about 0.1% to about 1%, about 0.1% to about 0.5%, about 0.5% to about 1% of malic acid and about 99.99% to about 99%, about 99.98% to about 99%, about 99.97% to about 99%, about 99.96% to about 99%, about 99.95% to about 99%, about 99.94% to about 99%, about 99.93% to about 99%, about 99.92% to about 99% or about 99.91% to about 99% of palmitic acid in relative amount;about 80% to about 99.5%, about 85% to about 99.5%, about 90% to about 99.5%, about 95% to about 99.5%, about 85% to about 99.5%, about 85% to about 95%, about 85% to about 90%, about 90% to about 99.5% or about 95% to about 99.5% of 1-monomyristin and about 20% to about 0.5%, about 20% to about 1%, about 20% to about 5%, about 20% to about 10%, about 20% to about 15%, about 15% to about 0.5%, about 15% to about 1%, about 10% to about 5%, about 10% to about 10%, about 10% to about 0.5%, about 10% to about 1%, about 10% to about 5%, about 5% to about 0.5%, about 5% to about 1% or about 1% to about 0.5% of malic acid in relative amount;about 0.2% to about 20%, about 0.5% to about 20%, about 1% to about 20%, about 5% to about 20%, about 10% to about 20%, about 15% to about 20%, about 0.2% to about 15%, about 0.5% to about 15%, about 0.5% to about 10%, about 0.5% to about 5%, about 0.5% to about 1%, aboutPATENTAttorney Docket No. G4590-20900PCT0.2% to about 10%, about 0.5% to about 10%, about 1% to about 10%, about 5% to about 10%, about 0.2% to about 5%, about 0.2% to about 1% or about 0.2% to about 0.5% of malic acid and about 99.8% to about 80%, about 99.5% to about 80%, about 99% to about 80%, 95% to 80%, about 85% to about 80%, about 99.8% to about 85%, about 99.5% to about 85%, about 90% to about 85%, about 99.8% to about 90%, about 99.5% to about 90% or about 95% to about 90% of myo-inositol in relative amount; andabout 30% to about 70%, about 30% to about 65%, about 30% to about 60%, about 30% to about 55%, about 30% to about 50%, about 30% to about 45%, about 30% to about 40%, about 30% to about 35%, about 35% to about 70%, about 35% to about 65%, about 35% to about 60%, about 35% to about 55%, about 35% to about 50%, about 35% to about 45%, about 35% to about 40%, about 40% to about 70%, about 40% to about 65%, about 40% to about 60%, about 40% to about 55%, about 40% to about 50%, about 40% to about 45%, about 45% to about 70%, about 45% to about 65%, about 45% to about 60%, about 45% to about 55%, about 45% to about 50%, about 50% to about 70%, about 50% to about 65%, about 50% to about 60%, about 50% to about 55%, about 55% to about 70%, about 55% to about 65%, about 55% to about 60%, about 60% to about 70% or about 60% to about 65% of maltose and about 70% to about 30%, about 70% to about 35%, about 70% to about 40%, about 70% to about 45%, about 70% to about 50%, about 70% to about 55%, about 70% to about 60%, about 70% to about 65%, about 65% to about 30%, about 65% to about 35%, about 65% to about 40%, about 65% to about 45%, about 65% to about 50%, about 65% to about 55%, about 65% to about 50%, about 60% to about 30%, about 60% to about 35%, about 60% to about 40%, about 60% to about 45%, about 60% to about 50%, about 60% to about 55%, about 55% to about 30%, about 55% to about 35%, about 55% to about 40%, about 55% to about 45%, about 55% to about 50%, about 50% to about 30%, about 50% to about 35%, about 50% to about 40%, about 50% to about 45%, about 45% to about 30%, about 40% to about 35% or about 35% to about 30% of myo-inositol in relative amount.

[0040] In a further embodiment, the AL or ALE has one or more of the following characteristics:• a ratio of lactic acid to malic acid of 6.61 to 1 or less in relative amount;• a ratio of malic acid to nicotinic acid of 0.0055 to 1 or less in relative amount;• a ratio of malic acid to palmitic acid of 0.00097 to 1 or less in relative amount;• a ratio of 1-monomyristin to malic acid of 23.19 to 1 or less in relative amount;• a ratio of malic acid to myo-inositol of 0.020 to 1 or less in relative amount; and• a ratio of maltose to myo-inositol of 0.92 to 1 or less in relative amount.PATENTAttorney Docket No. G4590-20900PCT

[0041] In one embodiment, the subject described herein is poultry. In some embodiment, the poultry is a chicken, a duck, a turkey, a quail, an ostrich or a goose. In a further embodiment, the poultry is a chicken.

[0042] In some embodiments, the composition described herein is in a powder form (e.g., a dried powder) or a liquid form (e.g., aqueous solution, oil suspension), or a granule form.

[0043] In one embodiment, the composition described herein is used as an additive (such as a feed additive) or a supplement (such as a feed supplement).

[0044] In one embodiment, the ALE is an alcoholic ALE. In a further embodiment, the ALE is an ethanolic ALE. In another further embodiment, the ALE is about 50% to 99.5% ethanol ALE. Preferably, the ALE is about 70% ethanol ALE.BRIEF DESCRIPTION OF THE DRAWINGS

[0045] FIGs. 1A-1B The viability assay of E. tenella sporozoites after CRE treatment. (1A) Trypan blue exclusion was used for identifying the alive or dead sporozoites after treatment. The white scale bars in the pictures represent length of 10 pm. (IB) The survival rates calculated according live counts of treated sporozoites were presented as box plot. Statistical differentiation was conducted by Mann-Whitney U tests. Significance effects are marked with asterisks (*P < 0.05).

[0046] FIGs.2A-2C The effects of CRE treatment on inhibition of / :. tenella sporozoites invasion. Three study models: (2A) pretreated-sprozoite invasion activity assay, (2B) infection activity in pre-exposure cells, and (2C) infection activity in post-exposure cells were utilized to evaluate the phytogenic effects. The genome copies of invaded sporozoites were quantified by real-time PCR. All data were presented as box plots. Statistical differentiation was conducted by Mann-Whitney U tests. Significance effects are marked with asterisks (*P < 0.05).

[0047] FIGs. 3A-3C The effects of restoration of related body weight gain after CR or CRE treatment on chickens challenged with E. acervunila (3 A), E. tenella (3B) or E. maxima (3C). All data were presented as box plots. Statistical differentiation was conducted by Mann-Whitney U tests. Significance effects are marked with asterisks (*P < 0.05; ** P < 0.01).

[0048] FIGs. 4A-4C The effects of lesion scores reduction after CR or CRE treatments on chickens challenged with E. acervunila (4A), E. tenella (4B) or E. maxima (4C). All data were presented as box plots. Statistical differentiation was conducted by Mann-Whitney U tests. Significance effects are marked with asterisks (*P < 0.05; ** P< 0.01).

[0049] FIGs. 5A-5C The effects of decrease of oocysts excretion after CR or CRE treatments on chickens challenged with E. acervunila (5 A), E. tenella (5B) or E. maxima (5C). All data werePATENTAttorney Docket No. G4590-20900PCTpresented as box plots. Statistical differentiation was conducted by Mann-Whitney U tests. Significance effects are marked with asterisks (*P < 0.05).

[0050] FIGs. 6A-6B Primary metabolomics analyses of chicken sera with or without challenging with A. tenella, and the effect of phytogenic supplementation of CR and anti-cocci dial drug AMP on the primary metabolism in chickens with E. tenella infection. (6A) PLS-DA analysis of sera primary metabolites in healthy (control) chickens and chickens infected with E. tenella (vehicle); (6B) PLS-DA analysis of sera primary metabolites in vehicle-, AMP-, and CR-treated E. tenella-challenged chicken.

[0051] FIGs. 7A-7B Primary metabolomics analyses of chicken sera with or without challenging with E. acervulina, and the effect of phytogenic supplementation of CR and anti-coccidial drug AMP on the primary metabolism in chickens with E. acervulina infection. (7 A) PLS-DA analysis of sera primary metabolites in healthy (control) chickens and chickens infected with E. acervulina (vehicle); (7B) PLS-DA analysis of sera primary metabolites in vehicle-, AMP-, and CR-treated E. acervuHna-ch& WQni Q chicken.

[0052] FIG. 8 Dietary supplementation of phytogenies derived from A. zerumbet improves intestinal integrity of broilers under C. perfringens infection. Starting at age of 0 to 35 days, chickens were provided with the standard diets w / o supplementation of AL-H or Kemin CLOSTAT®. Chicks were orally dosed with 2 x 108CFU / mL C. perfringens at age of 18 and 20 days for necrotic enteritis (NE) development. At age of 28 days, 4 chicks of group were orally dosed with 2.2 mg / ml FITC-dextran by gavaging. Two hours after gavaging, blood samples were collected for intestinal integrity analysis by measuring FITC permeable in the circulation. Means with different superscript letters within the same NE status are significantly different among treatments (P < 0.05 by Tukey multiple comparison test, n = 8). *; significant effects by C. perfringens challenge for NE development (P < 0.05 by / -test, n = 8).

[0053] FIGs. 9A-9B Effects of dietary supplementation of phytogenies derived from A. zerumbet on intestinal leukocyte infiltration of broilers challenged with C. perfringens. Starting at age of 0 to 35 days, chickens were provided with the standard diets w / o supplementation of AL-H or Kemin CLOSTAT®. Chicks were orally dosed with 2 x 108CFU / mL C. perfringens at age of 18 and 20 days for necrotic enteritis (NE) development. The jejunal and ileal part of intestine samples collected at age of 28 days were used for leukocyte count determination by H& E staining (upper panel, reprehensive images, lower panel, statistical results). Means with different superscript letters within the same part of intestine are significantly different among treatments (P < 0.05 by Tukey multiple comparison test, n = 4).PATENTAttorney Docket No. G4590-20900PCT

[0054] FIGs. 10A-10B Effects of dietary supplementation of phytogenies derived from A. zerumbet on ileal macrophage infiltration of broilers challenged with C. perfringens. Starting at age of 0 to 35 days, chickens were provided with the standard diets w / o supplementation of AL-H or Kemin CLOSTAT®. Chicks were orally dosed with 2 x 108CFU / mL C. perfringens at age of 18 and 20 days for necrotic enteritis (NE) development and thereafter sampled at 28 and 35 days for tissue collection. The ileal part of intestine samples collected at age of 28 days were used for macrophage staining using an avian-specific mouse monoclonal antibody (clone KUL01) (upper panel, reprehensive images, lower panel, statistical results). Means with different superscript letters within the same part of intestine are significantly different among treatments (P < 0.05 by Tukey multiple comparison test, n = 4). *; significant effects by C. perfringens challenge for NE development (P < 0.05 by / -test, n = 4).

[0055] FIG. 11 Effects of dietary supplementation of phytogenies derived from A. zerumbet on intestinal slgA concentrations of broilers challenged with C. perfringens. Starting at age of 0 to 35 days, chickens were provided with the standard diets w / o supplementation AL-H or Kemin CLOSTAT®. Chicks were orally dosed with 2 x 108CFU / mL C. perfringens at age of 18 and 20 days for necrotic enteritis (NE) development and thereafter sampled at 28 and 35 days for tissue collection. Samples collected at age of 28 days were used for secretory immunoglobulin A (slgA) concentration determination by commercial ELISA kits. *; significant effects by C. perfringens challenge for NE development (P < 0.05 by / -test, n = 4). Means with different superscript letters within the same NE status are significantly different among treatments (P < 0.05 by Tukey multiple comparison test, n = 4).

[0056] FIG. 12 Effects of dietary supplementation of phytogenies derived from A. zerumbet on serum IL-ip concentrations of broilers challenged with C. perfringens. Starting at age of 0 to 35 days, chickens were provided with the standard diets w / o supplementation of AL-H or Kemin CLOSTAT®. Chicks were orally dosed with 2 x 108CFU / mL C. perfringens at age of 18 and 20 days for necrotic enteritis (NE) development. At day 18 (before C. perfringens challenge), 21, and 28, the same 4 birds were used for blood sample collection to monitor serum IL-1 [3 levels by a commercial ELISA kit. *; significant effects by C. perfringens challenge for NE development (P < 0.05 by / -test, n = 4). Means with different superscript letters (a, b, c) within the same time point are significantly different among treatments (P < 0.05 by Tukey multiple comparison test, n = 4). Means with different superscript letters (x, y, z) within the same treatment are significantly different among time points (P < 0.05 by Tukey multiple comparison test, n = 4).PATENTAttorney Docket No. G4590-20900PCT

[0057] FIG. 13 Effects of dietary supplementation of phytogenies derived from A. zerumbet on bacterial killing of leukocytes in broilers challenged with C. perfringens. Starting at age of 0 to 35 days, chickens were provided with the standard diets w / o supplementation of AL-H or Kemin CLOSTAT®. Chicks were orally dosed with 2 x 108CFU / mL C. perfringens at age of 18 and 20 days for necrotic enteritis (NE) development. At age of 32 days, 4 birds of each group were used for blood collection for heterophil and monocyte isolation through discontinuous gradient centrifugation using commercial Histopaque®1077 and 1119, respectively. Freshly prepared heterophils or monocytes were incubated with opsonized Salmonella typhimurium (ST clone number #15721) at 41°C with for 1 h in a well of microplate at 1:2 ratio (5 x 105cells: 1x106CFUs of ST) in duplicates. Bacterial viability was then determined colorimetrically by WST-8 / CCK8 kit. Means with different superscript letters within the same leukocyte type are significantly different among treatments (P < 0.05 by Tukey multiple comparison test, n = 4). *; significant effects by C. perfringens challenge for NE development (P < 0.05 by / -test, n = 4).

[0058] FIG. 14 ALE and AL-API inhibit C. perfringens growth. ALE (0.5 mg / mL) or AL API (5 mg / mL) were sprayed onto TSC agar plate before inoculating the plate with C. prefringen (4.87 x 103CFU / plate). The culture plates were incubated at 35 °C for overnight, then bacterial colonies were counted. *: Significant difference vs. vehicle, +: Significant difference between two different dose treatments of the same extract (P < 0.05).

[0059] FIG. 15 Effects of dietary supplementation of phytogenies derived from C. rabens on intestinal integrity of broilers challenged with C. perfringens. Starting at age of 0 to 35 days, chickens were provided with the standard diets w / o supplementation of phytogenies CRE-H, CR, or Kemin CLOSTAT® (a commercial probiotic). Chicks were orally dosed with C. perfringens (in 1 mL of 2 x 108CFU / mL) at age of 18 and 20 days for necrotic enteritis (NE) development. At age of 28 days, 4 chicks of group were orally dosed with 2.2 mg FITC-dextran (in 1 mL PBS) by gavage. Two h after gavage, blood samples were collected for intestinal integrity analysis by measuring FITC permeable in the circulation. Means with different superscript letters within the same NE status are significantly different among treatments (P < 0.05 by Tukey multiple comparison test, n = 8). *; significant effects by C. perfringens challenge for NE development (P < 0.05 by t-test, n = 8).

[0060] FIGs. 16A-16B Effects of dietary supplementation of phytogenies derived from C. rabens on intestinal leukocyte infiltration of broilers challenged with C. perfringens. Starting at age of 0 to 35 days, chickens were provided with the standard diets w / o supplementation of CRE-H, CR, or Kemin CLOSTAT®. Chicks were orally dosed with C. perfringens (in 1 mL of 2 x 108PATENTAttorney Docket No. G4590-20900PCTCFU / mL) at age of 18 and 20 days for necrotic enteritis (NE) development and thereafter sampled at 28 and 35 days fortissue collection. The jejunal and ileal part of intestine samples collected at age of 28 days were used for leukocyte count determination by H& E staining (panel A, reprehensive images, panel B, statistical results). Means with different superscript letters within the same part of intestine are significantly different among treatments (P < 0.05 by Tukey multiple comparison test, n = 4).

[0061] FIGs. 17A-17B Effects of dietary supplementation of phytogenies derived from C. rabens on ileal macrophage infiltration of broilers challenged with C. perfringens. Starting at age of 0 to 35 days, chickens were provided with the standard diets w / o supplementation of CRE-H, CR, or Kemin CLOSTAT®. Chicks were orally dosed with C. perfringens (in 1 mL of 2 × 108CFU / mL) at age of 18 and 20 days for necrotic enteritis (NE) development and thereafter sampled at 28 and 35 days for tissue collection. The ileal part of intestine samples collected at age of 28 days were used for macrophage staining using an avian-specific mouse monoclonal antibody (clone KUL01) (panel A, reprehensive images, panel B, statistical results). Means with different superscript letters within the same part of intestine are significantly different among treatments (P < 0.05 by Tukey multiple comparison test, n = 4). *; significant effects by C. perfringens challenge for NE development (P < 0.05 by Ltest, n = 48).

[0062] FIG. 18 Effects of dietary supplementation of phytogenies derived from C. rabens on intestinal slgA concentrations of broilers challenged with C. perfringens. Starting at age of 0 to 35 days, chickens were provided with the standard diets w / o supplementation of CRE-H, CR, or Kemin CLOSTAT®. Chicks were orally dosed with C. perfringens (in 1 mL of 2 x 108CFU / mL) at age of 18 and 20 days for necrotic enteritis (NE) development and thereafter sampled at 28 and 35 days for tissue collection. Samples collected at age of 28 days were used for secretory immunoglobulin A (slgA) concentration determination by commercial ELISA kits. Means with different superscript letters within the same NE status are significantly different among treatments (P < 0.05 by Tukey multiple comparison test, n = 4). *; significant effects by C. perfringens challenge for NE development (P < 0.05 by Ltest, n = 4).

[0063] FIG. 19 Effects of dietary supplementation of phytogenies derived from C. rabens on serum IL-ip concentrations of broilers challenged with C. perfringens. Starting at age of 0 to 35 days, chickens were provided with the standard diets w / o supplementation of CRE-H, CR, or Kemin CLOSTAT®. Chicks were orally dosed with C. perfringens (in 1 mL of 2 × 108CFU / mL) at age of 18 and 20 days for necrotic enteritis (NE) development. At day 18 (before Clostridium perfringens challenge), 21, and 28, the same 4 birds were used for blood sample collection toPATENTAttorney Docket No. G4590-20900PCTmonitor serum IL-ip levels by a commercial ELISA kit. Means with different superscript letters (a, b, c) within the same time point are significantly different among treatments (P < 0.05 by Tukey multiple comparison test, n = 4). Means with different superscript letters (x, y, z) within the same treatment are significantly different among time points (P < 0.05 by Tukey multiple comparison test, n = 4).

[0064] FIG. 20 Effects of dietary supplementation of phytogenies derived from C. rctbens on bacterial killing of leukocytes in broilers challenged with C. perfringens. Starting at age of 0 to 35 days, chickens were provided with the standard diets w / o supplementation of CRE-H, CR, or Kemin CLOSTAT®. Chicks were orally dosed with C. perfringens (in 1 mL of 2 x 108CFU / mL) at age of 18 and 20 days for necrotic enteritis (NE) development. At age of 32 days, 4 birds of each group were used for blood collection for heterophil and monocyte isolation through discontinuous gradient centrifugation using commercial Histopaque®1077 and 1119, respectively. Freshly prepared heterophils or monocytes were incubated with opsonized Salmonella Typhimurium (ST, clone number #15721) at 41 °C with for 1 h in a well of microplate at 1:2 ratio (5 x 105cells: 1 x 106CFUs of ST) in duplicates. Bacterial viability was then determined colorimetrically by WST-8 / CCK8 kit. Means with different superscript letters within the same leukocyte type are significantly different among treatments (P < 0.05 by Tukey multiple comparison test, n = 4). *; significant effects by C. perfringens challenge for NE development (P < 0.05 by / -test, n = 4).

[0065] FIGs. 21A-21B Effect of dietary supplementation of phytogenies derived from C. rabens on the primary metabolome in chickens challenged with C. perfringens. (21 A) PLS-DA analysis of sera primary metabolites in control (healthy) birds and birds challenged with C. perfringens (NE). (2 IB) PLS-DA analysis of sera primary metabolites in vehicle, CRE-H, CR, and CLOSTA® fed broiler with NE.

[0066] FIGs. 22A-22E CRE and CR API effectively inhibit oocyst sporulation of five Eimeria species. A total of 1,000 oocysts from five Eimeria species were co-cultured with CRE, CR-API, amprolium (AMP), and vehicle (PBS), respectively in 48-well plates with gentle shaking at room temperature for 48 h. The AMP- and vehicle-treated groups were used as positive control and negative control. All assays were performed in triplicate. After incubation, the number and percentage of sporulated oocysts in each treatment group was measured by McMaster egg counting technique to determine the sporulation index. The tests were performed in triplicate. Numbers with different letters in the same column represent significant differences (P < 0.05).PATENTAttorney Docket No. G4590-20900PCT

[0067] FIG. 23 CRE inhibits the growth of C. perfringen. C. perfringens at 5 x 104CFU / mL in liquid culture were incubated with CRE (0.98 to 500 pg / mL) in TSC broth and cultured anaerobically at 37°C for 18 h. Bacterial growth (%) was calculated as the ratio of the ODeoo of the treatment group to that of the non-treated group multiplied by 100. Data are presented as the mean ± SEM. One-way ANOVA tests were used for statistical analysis of differences between groups and P (***) < 0.001 is considered statistically significant.DETAILED DESCRIPTION OF THE INVENTION

[0068] The terminology herein is used to describe specific embodiments of the invention, but their usage does not delimit the invention, except as outlined in the claims. It is to be understood that both the foregoing general description and the following detailed description are examples and explanatory only and are not restrictive of the subject matter claimed in this application.

[0069] Terms such as “a”, “an” and “the” are not intended to refer to only a singular entity, but include the general class of which a specific example may be used for illustration.

[0070] In this application, the use of “or” means “and / or” unless stated otherwise.

[0071] The term “feed” refers to food given to domestic livestock, and pet (companion animal) food.

[0072] The term “poultry” described herein may be used with all types of poultry, including other livestock, such as ducks, and turkeys. In one embodiment, the poultry of the present disclosure is a chicken.

[0073] As used herein, the term “about” when referring to the numerical value is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, ±0.5%, or ±0.1% from the numerical value. Such variations in the numerical value may occur by, e.g., the experimental error, calculation errors, routine minor adjustments, the typical error in measuring or handling procedures for making ingredients, supplements, compositions, or formulations, the differences in the source, manufacture, or purity of starting materials or ingredients used in the present disclosure, or like considerations.

[0074] As used herein, the term “comprising” or “comprises” is used in reference to compositions, methods, and respective component s) thereof, which are included in the present disclosure, yet open to the inclusion of unspecified elements or steps, whether essential or not.

[0075] As used herein, the term “treatment” refers to the use of an effective agent to the poultry in need thereof with the purpose to cure, alleviate, relieve, remedy, ameliorate, reduce, or prevent the disease, the symptoms thereof, or the predispositions towards it.PATENTAttorney Docket No. G4590-20900PCT

[0076] As used herein, the term “preventing” or “prevention” refers to preventive or avoidance measures for a disease or symptoms or conditions of a disease, which include but are not limited to, applying or administering one or more active agents to the poultry which has not yet been diagnosed as the poultry suffering from the disease or the symptoms or conditions of the disease but may be susceptible or prone to the disease. The preventive measures of the present disclosure are provided to avoid, prevent, or postpone the occurrence of the disease or the symptoms or conditions of the disease.

[0077] As used herein, the phrase “an effective amount” refers to the amount of an active agent that is required to confer a desired preventive or therapeutic effect on the poultry in need thereof. Effective doses may vary, as recognized by those skilled in the art, depending on routes of administration, additional herbal ingredient usage, the possibility of co-usage with other phytogenic supplements, and the condition to be treated.

[0078] As used herein, the term “administering” or “administration” refers to the placement of an active agent into an animal by a method or route which results in at least partial localization of the active agent at the desired site to produce the desired effect. The active agent described herein may be administered by any appropriate route known in the art. For example, the feed composition of the present disclosure is administered to the animal by oral administration.

[0079] The term “relative amount” (or relative quantity or relative intensity) is used to compare values or express a quantity in proportion to another value.

[0080] The numeral ranges used herein are inclusive and combinable, any numeral value that falls within the numeral scope herein could be taken as a maximum or minimum value to derive the sub-ranges therefrom. For example, it should be understood that the numeral range “0.0001% to 99.9%” comprises any sub-ranges between the minimum value of 0.0001% to the maximum value of 99.9%, such as the sub-ranges from 10% to 90%, from 20% to 80%, from 30% to 70% and so on. In addition, a plurality of numeral values used herein can be optionally selected as maximum and minimum values to derive numerical ranges. For instance, the numerical ranges of 40% to 60%, 40% to 50%, and 50% to 60% can be derived from the numeral values of 40%, 50%, and 60%.

[0081] A CR, a CRE or a CR-API, or an AL, an ALE, an AL API or an ALE API, or its composition described herein can be made into a liquid or solid form. If it is a liquid, it can be made with a water, polyol (like glycerol, ethylene glycol, or propylene glycol), a salt (such as sodium chloride, sodium benzoate, or potassium sorbate), or a sugar or sugar derivative (like dextrin, glucose, sucrose, or sorbitol). For example, one version of the product is a liquid with aPATENTAttorney Docket No. G4590-20900PCTCR, a CRE or a CR-API or an AL, an ALE, an AL API or an ALE API, or its composition described herein and one or more formulating agents like water, glycerol, ethylene glycol, propylene glycol, sodium chloride, sodium benzoate, potassium sorbate, dextrin, glucose, sucrose, and sorbitol. This liquid can be sprayed onto animal feed after it has been made into pellets, or it can be added to the animals’ drinking water.

[0082] For example, a solid formulation could take the form of granules, spray-dried powder, or agglomerates. The formulating agent might include a variety of salts (organic or inorganic zinc, sodium, potassium, or calcium salts like calcium acetate, calcium benzoate, calcium carbonate, calcium chloride, calcium citrate, calcium sorbate, calcium sulfate, potassium acetate, potassium benzoate, potassium carbonate, potassium chloride, potassium citrate, potassium sorbate, potassium sulfate, sodium acetate, sodium benzoate, sodium carbonate, sodium chloride, sodium citrate, sodium sulfate, zinc acetate, zinc benzoate, zinc carbonate, zinc chloride, zinc citrate, zinc sorbate, zinc sulfate), starch, or a sugar or sugar derivative (such as sucrose, dextrin, glucose, lactose, sorbitol).

[0083] For example, the solid composition may be in granulated form in one embodiment. The granule may have a matrix structure with homogeneously mixed components. However, the granule typically consists of a core particle and one or more coatings, usually salt and / or wax coatings. Examples of waxes include polyethylene glycols, polypropylenes, Carnauba wax, Candelilla wax, beeswax, hydrogenated plant oil or animal tallow (such as hydrogenated ox tallow, hydrogenated palm oil, hydrogenated cotton seeds, and / or hydrogenated soybean oil), fatty acid alcohols, mono-glycerides and / or di-glycerides (such as glyceryl stearate, which is a mixture of stearic and palmitic acid), microcrystalline wax, paraffins, and fatty acids (such as hydrogenated linear long-chained fatty acids and their derivatives).

[0084] A CR, a CRE, a CR-API or a CRE API or an AL, an ALE, an AL API or an ALE API, or its composition can be added into feed or drinking water as an additive or a supplement, but is not limited thereto. That is, a CR, a CRE, a CR-API or a CRE API or an AL, an ALE, an AL API or an ALE API can be prepared in any form suitable for the feed composition based on the actual needs. In at least one embodiment of the present disclosure, the feed composition can be formulated in the form of non-dried, dried, crushed, or granulated. For example but not limited thereto, a CR, a CRE, a CR-API or a CRE API or an AL, an ALE, an AL API or an ALE APIcan be mixed with a liquid carrier suitable for the feed composition, or a CR, a CRE, a CR-API or a CRE API or an AL, an ALE, an AL API or an ALE API can be absorbed into a carrier material suitable for the feed composition.PATENTAttorney Docket No. G4590-20900PCT

[0085] Without intent to limit the scope of the disclosure, exemplary instruments, methods and their related results according to the embodiments of the present disclosure are given below. It is noted that titles or subtitles may be used in the examples for convenience of a reader, which in no way should limit the scope of the disclosure. Moreover, certain theories are proposed and disclosed herein; however, in no way they, whether they are right or wrong, should limit the scope of the disclosure so long as the disclosure is practiced according to the disclosure without regard for any particular theory or scheme of action.EXAMPLES

[0086] The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion. The present examples, along with the methods described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses which are encompassed within the spirit of the invention as defined by the scope of the claims will occur to those skilled in the art.I. Control of coccidiosis in chickens caused by protozoan parasites of the genus Eimeria

[0087] Materials and Methods

[0088] C. rabens plant materials and extracts

[0089] C. rabens plants grown in Changhua county area, Taiwan were harvested, dried and crushed into an appropriate size for experiments. The extracts of C. rabens were prepared from dried or fresh plant materials using an aqueous alcohol solution, such as 50 to 99.5% ethanol. The collected extracts were dried out under vacuum. The basic nutritional factors and C. rabens plants derived phytogenic supplements were analyzed by HPLC / mass spectrometry and / or GC / mass spectrometry.

[0090] Parasite samples preparation

[0091] Five field isolates of Eimeria species including E. tenella (isolate PT-Te002), E. acervulina (isolate TT-AcOO3), E. maxima (isolate TT-MaOO3), E. necatrix (isolate ML-NeOOl), and E. brunetti (isolate PT-Br002) were provided by Dr. Yi-Yang Lien (Department of Veterinary Medicine, NPUST, Taiwan). All parasites were routinely propagated in 3-week-old laying hens every 2 to 3 months to harvest the oocysts as previously described (Lien et al., Cloning and nucleotide sequencing of the second internal transcribed spacer of ribosomal DNA for three species of Eimeria from chickens in Taiwan. 2007. Vet. J. 173:184-9'). Feces containing Eimeria oocysts were incubated in 2.5% (w / v) K2CT2O7 at 28°C for 72 h to allow oocysts sporulation for inoculum preparation. The unsporulated oocysts from fresh feces of 7 days post-infected chickensPATENTAttorney Docket No. G4590-20900PCTwere purified by flotation method as previous description (Molan et al., Effect of pine bark {Pinus radiata) extracts on sporulation of coccidian oocysts. 2009. Folia. Parasitol. 56(1): 1-5). The excysted sporozoites were obtained from sporulated E. tenella oocysts as described by Dulski et al. (The purification of sporocysts and sporozoites from Eimeria tenella oocysts using Percoll density gradients. 1988. Avian Dis. 32: 235-239) with some modification. Briefly, the oocysts were broken by 1-mm and 3 -mm glass beads (Genechain Industrial, Taiwan), and further purified following the process of 50%-80% Perol I ™ (GE Healthcare, USA) gradient centrifugation. All purified oocysts and sporozoites were preserved with sterile PBS and stored at 4°C until use.

[0092] Cell culture

[0093] The Madin-Darby bovine kidney (MDBK) cells were provided by Dr. Ming-Chu Cheng (Department of Veterinary Medicine, NPUST, Taiwan) and routinely maintained in DMEM medium (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA), 25 mM D-glucose and 4 mM L-glutamine (Gibco, USA), and 100 U / mL penicillin / 100 pg / mL streptomycin antibiotics (Gibco, USA) at 37°C with 5% CO2.

[0094] Cell viability assay

[0095] Confluent MDBK cells in 96-well plates were treated with different concentrations of CRE at 37°C in 5% CO2 for 72 h. After that, each well was added 25 pL of MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) reaction reagent (5 mg / mL of stock, SIGMA, USA) and incubated for 4 h. Hundred pL of DMSO (Sigma, USA) was added into plate to stop the MTT reaction and dissolved the precipitated formazan crystals in each well. The absorption at 570 nm of each well was measured by SPECTROstar Nano spectrophotometer (BMG Labtech, Germany). Cell survival after treatment was calculated by following formula: viable cell number (%) = OD570 of treated cell culture / ODs7o of vehicle control x 100. All assays were performed in quadruplicate.

[0096] Oocysts sporulation assay

[0097] The sporulation levels of purified oocysts exposed to the CRE and CR API or CRE API were evaluated by in vitro assay as described by Molan et al. (Effect of pine bark {Pinus radiata) extracts on sporulation of coccidian oocysts. 2009. Folia. Parasitol. 56(1): 1-5) with some modifications. A total of 1,000 oocysts from five Eimeria species were co-cultured with CRE, CRAPI, amprolium (AMP), and vehicle (PBS), respectively in 48-well plates with gentle shaking at room temperature for 48 h. The AMP- and PBS-treated groups were used as positive control and negative control. All assays were performed in triplicate. After incubation, the number and percentage of sporulated oocysts in each treatment group was measured by McMaster egg countingPATENTAttorney Docket No. G4590-20900PCTtechnique to determine the sporulation index. The tests were performed in triplicate. Numbers with different letters in the same column represent significant differences (P < 0.05).

[0098] Sporozoites viability assay

[0099] The viable levels of Eimeria sporozoites treated with CRE were assessed by trypan blue exclusion method as described by Cha et al. (Effects of glass bead size, vortexing speed and duration on Eimeria acervulina oocyst excystation. 2014. Exp. Parasitol. 138: 18-24) with some modifications. Briefly, about 2 * 104sporozoites purified from sporulated E. tenella oocysts were incubated with PBS, AMP, and CRE at 37°C for 2 h, respectively. After then, the treated sporozoites were washed with PBS three times and collected by centrifugation at 1,000 x g for 10 min. Trypan blue solution (4%, v / v) was added into pelleted sporozoites, and the number of stained (dead) and unstained (alive) sporozoites were counted under microscope with hemocytometer. All treatments were performed in quadruplicate. Viability (survival %) of each treatment group was determined by following formula:Survival % = Number of total sporozoites

[0100] Sporozoite invasion and reproduction inhibition assays inMDBK Cells

[0101] The in vitro assays using MDBK cells as a parasite invasion target was carried out to investigate the CRE effect on the activities of E. tenella sporozoites. Three experimental models were used, as described below:

[0102] Model 1: Pretreated-sporozoite invasion activity assay

[0103] The E. tenella sporozoites were preincubated with CRE, AMP, or PBS at 37°C for 4 h before infection to MDBK cells. All treated sporozoites were washed with sterile PBS three times before re-suspension in DMEM with 2% FBS. For the invasion assay, the confluent MDBK cells in 96-well plates were inoculated with pre-treated sporozoites at MOT 0.1 and incubation at 37°C in 5% CO2 for 24 h. Uninfected MDBK monolayers were used as the negative control. All experimental groups were carried out in quadruplicate. After 24 h of incubation, the cultured media were replaced with fresh growth media, then re-incubation for another 24 h. At 48 h post-infection, the cells were collected by trypsinization with 0.25% trypsin-EDTA (Gibco, USA) and twice washed with sterile PBS. Then, the collected cells were subjected to total DNAs extraction using the DNeasy Blood & Tissue kit (Qiagen, Germany) following the manufacturer’s instructions.

[0104] Model 2: Infection activity in pre-exposure cells The MDBK monolayers were exposed to CRE, AMP or PBS and incubated at 37°C in 5% CO2 for 2 h. After incubation, the cells were washed with sterile PBS three times, followed by replenishing with fresh growth medium and inoculating with sporozoites at MOI 0.1 for 48 h. The cells were then collected by trypsinizationPATENTAttorney Docket No. G4590-20900PCTwith 0.25% Trypsin-EDTA (Gibco, USA) and washed with sterile PBS three times. The total DNA of collected cells were extracted using the DNeasy Blood & Tissue kit (Qiagen, Germany) following the manufacturer’s instructions.

[0105] Model 3: Infection activity in post-exposure cells After co-cultivation of MDBK cells and sporozoites at MOI 0.1 for 6 h at 37°C in 5% CO2, the culture media in wells were replaced with fresh medium containing CRE, AMP, or PBS for 4 h. Then the cells were washed three times with sterile PBS and cultured in fresh medium for 38 h. This model was used for assessing the reproduction inhibition activity of CRE on E. tenella after MDBK invasion by sporozoites. The cells were collected by trypsinization with 0.25% trypsin-EDTA (Gibco, USA) and washed with sterile PBS three times. The collected cells were subjected to total DNA extraction using the DNeasy Blood & Tissue kit (Qiagen, Germany) following the manufacturer’s instructions.

[0106] Quantification of sporozoites in MDBK cells by real-time qPCR assay

[0107] E. tenella sporozoites in infected MDBK cells were determined by absolute quantification of sporozoite genomic DNA copies by real-time qPCR assay. The RT-qPCR assays were performed according to protocols described by Taha el al. (In vitro infection of Madin-Darby bovine kidney (MDBK) cells with Eimeria acervulina sporozoites: quantitative analysis of parasite cellular invasion and replication using real-time polymerase chain reaction (PCR). 2021. Parasitol. Res. 120: 2689-93) with modifications. Briefly, the total 20 pL of reaction mixture containing 10 pL SYBR® Fast qPCR 2x Master Mix (KAPA Biosystem, Inc), 0.4 pL forward primer ITS-l-F: TGGAGGGGATTATGAGAGGA (10 pM stock), 0.4 pL reverse primer ITS-1-R: CAAGCAGCATGTAACGGAGA (10 p M stock), 1 pL template DNA and 8.2 pL PCR-grade water were applied to Lightcycler® 480 II system (Roche, Switzerland) using thermal cycling condition: 3 min at 95°C, followed by 40 cycles of 10 sec at 95°C, 20 sec at 62°C, 1 sec at 72°C. The melting curve program of the system was applied to create the dissociation curve involving a temperature range from 61°C to 95°C. The standard curve for absolute quantification was generated by serial dilution of cloned plasmid encoding ITS-1 gene fragment which was applied to RT-qPCR with parallel conditions.

[0108] Animal trials

[0109] The animal ethics of all in vivo experiments in this study were approved by the Institutional Animal Care and Use Committee (IACUC) of Laboratory Animal Center, National Pingtung University of Science and Technology of Taiwan with the authorized access number #NPUST- 110-062 and #NPUST-110-054. Three independent in vivo trials were conducted to determine the anticoccidial activities of CRE against E. acervulina, E. maxima, and E. tenella, respectively.PATENTAttorney Docket No. G4590-20900PCTBriefly, in each trial, a total of 72 one-day-old Leghorn male chicks were randomly divided into 6 groups with 4 replicated cages of 3 birds each. Two groups assigned for negative control group (unmedicated, unchallenged control, UUC) and infection control group (unmedicated, challenged control, UCC) were fed with standard chicken diets without any phytogenic supplement. The reference group were fed with amprolium (AMP 125) in standard diets and the CR treatment groups CR-L and CR-H contained 350 ppm to 1500 ppm of the phytogenic ingredients from C. rabens, calcium carbonate, mineral and com starch premix in the standard diets; and CRE treatment group was the standard diets contained 50 ppm to 150 ppm phytogenic ingredients from C. rabens, calcium carbonate, mineral and com starch premix.

[0110] The UUC, UCC, AMP group, and two treatment groups CR-L and CR-H were designed. Ad-lib feeding and watering during experimental period were offered to all chickens. At three-week chicken age, all groups except UUC were challenged with purified sporulated oocysts via oral route with a dose per bird of 1 x 105oocysts (E. acervunilla), 2 * 104oocysts (E. tens Ila) or 2.5 x io4oocysts (E maxima), respectively. The body weight and percentage of relative body weight gain before and after the challenge in tested chickens were measured. The survival rates were observed after oocyst inoculation until sacrifice to assess the anticoccidial effects. Chicken feces from each cage were collected at day 5 post-infection for E. acervuHna, or at day 6 postinfection for E. tenella and E. maxi ma. The number of oocysts per gram (OPG) of feces was calculated using McMaster egg counting method. All birds were sacrificed at 4 weeks of age (the 7th day after challenge), and gut samples were collected to assess lesions and scored following the index descriptions in Johnson and Reid (Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. 1970. Exp. Parasitol. 28: 30-6).[OHl] Data analysis

[0112] The data from in vitro assays and in vivo trials were presented using box lot graphic and described as mean ± SD formation. For oocysts sporulation assay, the sporulation rates were calculated by formula:Sporulation rate (%) = 100 x (sporulating oocysts / total number of counted oocysts).

[0113] The ACI calculation fulfilled with following formula as described by McManus et al. (Development of resistance to quinoline coccidiostats under field and laboratory conditions. 1968. J. Parasitol. 54:1190-3). The ACI of each group = %SR + %RWG - (10 x LS + 0.4 x ROPG), where the parameter SR is survival rate, RWG (%) is the relative weight gain between the trial group and the UUC group, LS is average lesion score, and ROPG is the related OPG of treated group and UCC group. The LS is average lesion score of each group, and ROPG is the relativePATENTAttorney Docket No. G4590-20900PCTOPG between the trial group and the UCC group. Individual parameter was obtained by calculation following formula below:nn / n / \ mn z Number of lived chickens after chllenqeSR (%) = 100 X ( - i - - - — YNumber of lived chickens before chllenge ”m z' zo / \ > i nn, average rBWG of treated group.KWLr (Vo) — WO X ( - - - average rBWG of UUC group ’ROPG—ravera3eof treated group' average OPG of JJCC group

[0114] Statistical analyses of experimental data were processed with SPSS Software v. 22.0 (IBM, USA) via comparing control groups and treated groups by Mann-Whitney U tests proceeding with the establishment of statistical significances using P < 0.05.

[0115] Primary metabolome analysis of chicken serum

[0116] Chicken serum samples (50 pL) were extracted with 80% methanol containing ribitol (0.2 mg / mL) as an internal standard vigorously and incubated in liquid nitrogen for 10 min, and repeated 3 times of the protocol. After centrifuging at 13,000 ×g for 10 min at 4°C, the supernatants were collected and dried in vacuum. The dried analytes were incubated with 20 pL methoxyamine (20 mg / mL in pyridine) at 30°C for 90 min and then derivatized with 100 pL N, O-bis(trimethylsilyl)trifluoroacetamide (BSTFA) containing 1% trimethylchlorosilane (TMCS) at 70°C for 120 min.

[0117] The primary metabolome of chicken serum samples from control (healthy animals without treatment), E. acervulina or E. Zc / rc / G-challenge (vehicle), AMP125, and CR-L groups were analyzed by gas chromatography / quadrupole time-of-flight mass spectrometry (GC / Q-TOF MS) (Agilent Technologies, USA) at the Metabolomics Core Facility, Agricultural Biotechnology Research Center, Academia Sinica, Taiwan. The derivatized samples (0.5 pL) were injected with helium as the carrier gas flow at 1 mL / min into an Agilent J& W DB-5ms column (30 m x 250 pm x 0.25 pm). The GC oven temperature ramp was maintained at 60°C for 1 min, then elevated to 325°C (10°C / min) and held constant for 10 min. The mass range was 50-600 Da, and the data were gathered in full scan mode. Mass spectra were compared against the NIST Chemistry WebBook (National Institute of Standard and Technology) and PubChem (National Center for Biotechnology Information). Peak heights of the mass (mass-to-charge ratio) fragments were normalized to the internal standard (ribitol) of each sample.

[0118] ResultsPATENTAttorney Docket No. G4590-20900PCT

[0119] I. A. CRE and CR API / CRE API suppress the oocyst sporulation and sporozoite activity of Eimeria

[0120] In vitro assays including sporulation inhibition assay, sporozoite viability and invasion suppression assay were conducted to evaluate the anti -cocci di al efficacy of CRE and CR APE As shown in Table 1, the sporulation of E. maxima oocysts was suppressed significantly by treatment of CRE at 60 pg / mL (Median: 28.5%, P < 0.05) which showed better inhibition effects than the competing groups treated with 125 ppm of AMP (43.7%). In addition, despite no significant difference compared with control groups (PBS, Median: 82.9%), the reduced sporulation levels of E. acerverlina oocysts (Median: 73.7%, P = 0.05) presented as lower as competing groups. The above results indicated that the CRE has similar activity of sporulation inhibition to commercial synthetic compound coccidiostat (AMP) on specific Eimeria species.Table 1. The effects of CRE treatment on Eimeria oocysts sporulation„ E. acervunila oocysts E. maxima oocystsiioups j.Median (%) P valueMe_ianP valuePBS 82.9 - 62.0AMP125 79.4 0.127 43.7 0.021*CRE60 73.7 0.05 2&5 0.021*The sporulation rates are presented median. Statistical differentiation wasconducted by Mann-Whitney U tests. Significance effects are markedwith asterisks (*P < 0.05). Minus mark is non-obtained.

[0121] Many biological extracts come from edible medicinal plants, including Bidens pilosa, Acalypha australis, and Curcuma longa, etc., were revealed their anticoccidial activities on different stages such as sporozoites, merozoites, or gametes of Eimeria life cycle. In this study, the direct toxicity of CRE to impair E. tenella sporozoite viability was carried out by trypan blue exclusion. Based on the valid staining status between alive and dead sporozoites (FIG. 1A), the viable sporozoites could be determined to estimate the survival rate after CRE-treatment. Our finding showed that CRE treatment significantly reduced live counts of sporozoites compared to no-treatment control (P < 0.05) (FIG. IB). In addition, there was no significant difference between survival rates of CRE-treatment and AMP -treatment groups suggesting that CRE was similarly effective to the commercial drug against Eimeria sporozoites.

[0122] The prevention and therapeutic effect of CRE against coccidiosis were evaluated by three models of invasion suppression assay with CRE administration at different stages. The performance with CRE pre-exposure of sporozoites or host cells in first and second model respectively were used for evaluation of prophylactic effects on initiate stage of infection. The third model was performed to estimate therapeutic approach of CRE on Eimeria reproduction stagePATENTAttorney Docket No. G4590-20900PCTafter sporozoites invaded the host cells. Quantitative real-time PCR assay revealed the invaded sporozoites genome copies of CRE-treated groups in all models were decreased significantly compared with control groups, indicating the effective suppression to Eimeria sporozoites activities by CRE (FIGs. 2A-2C). Notably, in response to the results in FIGs. 1A-1B, the direct toxicity caused by CRE to sporozoites should be the major modulation which results in the invasion suppression in Model 1. However, in contrast to other Models, the relative mild invasion inhibition activity showing in trial Model 1 demonstrated that the anticoccidial mechanisms of CRE might mainly assist the host cells by triggering cellular anti-parasite function. Collectively, these results indicate the dual anticoccidial properties of CRE including prophylactic and therapeutic characterizations as same as common commercial coccidiostats.

[0123] The studies of CRE and CR API in inhibiting sporulation of multiple Eimeria species were also conducted. FIGs. 22A-22E shows that CRE and CR API effectively inhibit sporulation of five Eimeria species.

[0124] I. B. Anticoccidial activity of CR and CRE in chicken coccidiosis induced by pathogenic Eimeria species

[0125] Because the infection of Eimeria is a systematic development that induced various pathogenic expression in host, the anticoccidial ability of the tested components should be estimated through multiple factors. For this reason, the anticoccidial index (ACI) has been designed and used for assessment of the anticoccidial activity of drugs or additives in avian medicine field (Ojimelukwe et al., Populations of Eimeria tenella express resistance to commonly used anticoccidial drugs in southern Nigeria. 2018. Int. J. Vet. Sci. Med. 6: 192-200'). The in vivo efficacy of chemically defined CR and CRE were evaluated by ACI score calculated based on four factors involving survival rates, related weight gain, lesion score and related OPG output, which obtained from animal trails. All chickens in this study were survival during feeding period until the day of sacrifice. As shown in FIGs. 3A-3C, treatment with CR-L and CRE on E. acervuline-and E. acervulina-mfected chickens represented no improvement on body weight after challenge, while treatment with CR-H a significant restoration of body weight on E. maxima-infected chickens was observed (FIG. 3C). These results demonstrated the ability of CR treatment to improve weight loss caused by E. maxima.

[0126] The gross gut lesion reduction in chickens fed with CR or CRE were examined at 5- or 6-day post challenge with different Eimeria spp. and presented in FIGs. 4A-4C. All the three treatment groups, CR-L, CR-H and CRE consistently and significantly showed lower lesionPATENTAttorney Docket No. G4590-20900PCTcompared to untreated control groups, suggesting the gut protection ability of either CR or CRE against different Eimeria spp.

[0127] In parallel, the oocyst excretion from infected chickens were also evaluated and presented in FIGs. 5A-5C. For E. acervulina- and E. tenella-infected chickens, all groups treated with CR or CRE showed remarkably decreased oocysts output, while only CR treatment in E. tnaxima-challenged chickens showed significantly lower OPG. These data revealed CR and CRE could obviously improve the outcome of oocysts shedding, indicating that asexual reproductions including sporogony, merogony, and oocysts development stages in Eimeria life cycle should be the putative targets of medication.

[0128] The putative coccidicidal efficiency of CR and CRE against examined Eimeria spp. were evaluated according to the criterion of ACI ranking method (Qaid et al., Anti-coccidial effect of Rumex nervosus leaf powder on broiler chickens infected with Eimeria tenella oocyst. 2021. Animals. 11: 167-83'). In Table 2, treatment with either CR or CRE showed higher anticoccidial ability inE. acerverlina- (ACI scores: 141-147) andE. tenella- (ACI scores: 138-154) challenged groups than the AMP competing group whose ACI scores were 130-132. The CR-H group enhanced the ACI score to 161 in the rank of “marked effective coccidicidal activity” (Qaid etal., Anti-coccidial effect of Rumex nervosus leaf powder on broiler chickens infected with Eimeria tenella oocyst. 2021. Animals. 11: 167-83). Interesting, CRE treatment showed highest ACI score against E. acervulina infection than the other two species of Eimeria. Taken together, these data suggest that CR and CRE possess the board-spectrum anticoccidial activity and could be further developed into novel coccidiostat.Table 2. The anticoccidial index (ACI) of animal experiments after treatments with CR or CREGroups ACI of E. acervunila ACI of E. tenella ACI of E. maxima UCC 98 112 130AMP 125 130 132 143CR-L 141 138 N / ACR-H 144 154 161CRE 147 138 N / AACI score below 120 represents an inactive anticoccidial activity, at 120 to 140 as mild or slight effect, at 140 to 160 as moderate effect and above 160 as marked anticoccidial ability (Qaid et al., 2021).

[0129] I. C. CR supplement regulates primary metabolism in Eimeria infected chickens

[0130] The potential impact of CR supplement on the primary metabolome in chicken infected with Eimeria spp. was evaluated using GC / Q-TOF MS. BothE. tenella andE. acervulina infection and respective CR treatment groups were investigated as the examples. The intensity of the totalPATENTAttorney Docket No. G4590-20900PCT93 distinct metabolites detected in chicken sera were quantified and subjected to the multivariate partial least squares discriminant analysis (PLS-DA). The score plot and loading plot of the detected serum primary metabolites in healthy chickens (control) vs. E. tenella- challenged chicken (vehicle) (FIG. 6A), and E. / c / rcZZa-challenged chicken (vehicle) vs. the challenged chickens treated with AMP 125 and CR-L, respectively (FIG. 6B) showed that healthy control group vs. vehicle group, and vehicle group vs. AMP group vs. CR groups can be distinguished and clustered into separate groups. The loading plots revealed some outlier metabolites which might have a role in chickens with E. tenella infection (FIG. 6A), or to be regulated in the treatment groups (FIG. 6B). The heatmap showed the individual metabolite levels in healthy chickens (control) set as 1, and the relative fold-change levels between 0.2- to 2.5-fold referring to those metabolites in E. tenella- challenged chickens (vehicle). At the right three columns of the heatmaps, the levels of metabolites in E. / c / rcZZa-challenged chickens were set as 1 and the relative fold-changes between 0.04- to 11-fold in AMP and CR treatment groups were shown. The 93 metabolites were separated into eight groups encompassed amino acids and their derivatives, carbohydrates, fatty acids, nucleotides, organic acids, sterols, urea cycle-related metabolites, and other metabolites not belonging to the aforementioned categories according to the detected metabolite and structural types. In overall, more than 21% identified metabolites in infected chicken sera were decreased < 0.67-fold, and more than 15% of the metabolites were increased > 1.5-fold relative to the healthy chickens, suggesting the impact of E. tenella infection in interfering primary metabolism of chickens.

[0131] Heatmap of the fold changes in metabolites related to E. tenella infection showed that among 23 amino acids or amino acid-derivatives detected, 74% of metabolite levels decreased after E. tenella infection including three main groups of amino acids, gluconeogenic amino acids (GAA) (alanine, glutamic acid, histidine, isoleucine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine), branched-chain amino acids (BCAA) (leucine, isoleucine, valine), and aromatic amino acids (AAA) (phenylalanine, tryptophan, tyrosine) (with the range from 0.2- to 0.9-fold of the control group). Avian coccidiosis infection is known to decrease amino acid digestibility due to decreased expression of amino acid transport systems in the small intestines of Eimeria infected broilers (Su et al., Expression of digestive enzymes and nutrient transporters in EZwerztz-challenged broilers. 2015. Experimental parasitology, 150, 13-21). Leucine is considered effective in stimulating muscle protein synthesis (Ospina-Rojas etal., High leucine levels affecting valine and isoleucine recommendations in low-protein diets for broiler chickens. 2020. Poult. Sci. 99(11): 5946-59), and tryptophan involves in the innate immunePATENTAttorney Docket No. G4590-20900PCTresponses during Eimeria infection (Lui et al., Construction and analysis of coexpression network to understand biological responses in chickens infected by Eimeria tenella. 2021. Front. Vet. Sci.8: 688684). In the A. tezze / Zrz-infected group, the intensity of leucine and tryptophan decreased 0.6-and 0.5-fold, respectively, compared to the healthy group, while both AMP treatment and CR treatment restored their intensities to 1.2-fold and 1.4-fold when compared to the challenged group.

[0132] In chickens, E. tenella challenge resulted in the decrease of xylitol (0.18-fold) compared to the healthy animals, which was restored by AMP and CR treatment (11- and 3-fold increase, respectively). Previous study indicated that feeding the xylitol diet prevent LPS- and Sephadex-stimulated chickens from body weight loss and food intake by reduction of inflammatory responses (Takahashi et al, Effect of dietary xylitol on growth and inflammatory responses in immune stimulated chickens. 1999. Br. Poult. Sci. 40(4):552-4). The restoration of xylitol levels in infected chickens might suggest the protective effect of AMP and CR in the animals against A. tenella. Pyrimidines are known as inconvertible compounds that serve as building materials for DNA and RNA in all living organisms (Sato et al., Structural and biochemical features of Eimeria tenella dihydroorotate dehydrogenase, a potential drug target. 2020. Genes (Basel). 11(12): 1468). E. tenella contains the pyrimidine salvage enzyme, which can help E. tenella salvage pyrimidine from uracil (McClarty et al., Pyrimidine metabolism by intracellular Chlamydiapsittaci. 1993. J. Bacteriol. 175(15): 4652-61). The uracil level was found increased after A. tenella infection (2.5-fold) compared to the control group. With AMP or CR feeding, the uracil level was decreased (0.5- and 0.8-fold) in A. tenella infected chickens.

[0133] On the other hand, A. tenella infection may lead to renal disease. In our study, significant accumulation of creatinine, urea, and uric acid involved in urea cycle were observed in the A. / czzcZZrz-infected group compared to the healthy chicken group (1.6-fold, 2.5- fold, and 1.2-fold, respectively). After treatment with AMP or CR, the relative levels of urea and uric acid decreased (0.6- to 0.8-fold) in the chickens, suggesting AMP and CR may have protective effect on A. tenella ’s devastation affecting renal function.

[0134] The comparative primary metabolomic data of healthy chickens (control) and A. rzcervz / Zzzzrz-infected chicken (vehicle), and the impact of AMP 125 or CR-L treatment on A. rzcervz / Zzzzrz-challenged chickens are shown in FIGs. 7A-7B. When compared to the healthy chicken group (control), most of the detected amino acid and their derivatives had no obviously change in A. rzcervz / Zzzzrz-challenged chickens, but they were moderately increased in the challenged chickens feeding with AMP or CR (1- to 2-fold).PATENTAttorney Docket No. G4590-20900PCT

[0135] In carbohydrate category, the expression levels of lyxose suppressed by E. acervulina infection (0.8-fold) were up-regulated by AMP and CR treatment (1.8- and 1.3-fold, respectively). Lyxose is a functional sugar which can be converted into D-xylulose via reverse isomerization reaction by microbial D-lyxose isomerases; lyxose has been used as the precursor for the synthesis of immune stimulant a-galactosylceramide and murine anti-cancer drugs. A previous study reported that mannitol functions as an endogenous carbon source for oocysts to sporulate outside the host. The level of mannitol in the E. acervuHna-cf\& Wen^.ed group was reduced 0.7-fold compared to the healthy chicken group which was increased in both the AMP- and CR-treated groups (3- and 5- fold, respectively), implying the inhibitory impact of CR against the oocyst sporulation of E. acervulina. Eimeria species infection caused oxidative damage to the host system. The main targets of reactive oxygen species (ROS) are unsaturated fatty acids (UFAs) in the membrane lipids. Several detected unsaturated fatty acids were significantly decreased in E. acervulina-infected chicken sera, such as arachidonic acid (AA) and docosahexaenoic acid (DHA) (0.6- and 0.5-fold, respectively). DHA is an anti-inflammatory co-3 fatty acid showing several health benefits which is also a substrate of resolvins and related compounds (e.g., protectins) to resolve the inflammatory responses. Notably, both AMP and CR treatment significantly elevated the level of DHA (1.4- to 1.6-fold) inacervulina-infected chicken.

[0136] Lactic acid, the product of anaerobic glycolysis, and pyruvic acid, the end product of glycolysis, are essential metabolites for energy supply, therefore, they have been designated as key criteria for assessing energy homeostasis. Lactic acid and pyruvic acid were both down-regulated by E. acervulina infection (0.9- and 0.7-fold, respectively) compared to healthy chickens. The reduction was reversed in E. acervulina infected chickens with AMP or CR treatment (1.5 - to 1.8-fold), suggesting both treatments restore the energy metabolism in chicken with E. acervulina infection.

[0137] I. D. Chemical compositions of bioactive phytogenic supplements CR and CRE

[0138] The chemical composition of the bioactive phytogenic supplement CR contains a-linolenic acid, citric acid, lactic acid, mannitol and palmitic acid, and they are in one or more of the following ratios:• a ratio of a-linolenic acid to citric acid of 1.66 to 1 or less• a ratio of citric acid to lactic acid of 0.79 to 1 or less• a ratio of citric acid to mannitol of 0.94 to 1 or less• a ratio of lactic acid to mannitol of 1.19 to 1 or less• a ratio of a-linolenic acid to palmitic acid of 0.086 to 1 or lessPATENTAttorney Docket No. G4590-20900PCT

[0139] The chemical composition of bioactive phytogenic supplement CRE contains a-linolenic acid, aspartic acid, mannitol, 1-monomyristin and lactic acid, and they are in one or more of the following ratios:• a ratio of aspartic acid to a-linolenic acid of 0.088 to 1 or less• a ratio of mannitol to aspartic acid of 7.27 to 1 or less• a ratio of a-linolenic acid to mannitol of 1.56 to 1 or less• a ratio of aspartic acid to 1-monomyristin of 0.035 to 1 or less• a ratio of lactic acid to aspartic acid of 8.69 to 1 or lessII. Improvement of growth performance in broilers with necrotic enteritis

[0140] Materials and Methods

[0141] Preparations of phytogenic samples from Alpinia zerumbet

[0142] A. zerumbet plants were grown and obtained from Huisun Experimental Forest Station and Naluo village of Hsinchu County, Taiwan. The above-ground parts of the plants were collected and dried which were stored at room temperature (20-25°C) and ventilated place. The basic nutritional factors and chemical fingerprints of A. zerumbet plant extracts were prepared by 50%-95% ethanol and subjected to HPLC / mass spectrometry or GC / mass spectrometry analysis. NMR spectrometry was carried out for determination of the structures of compounds identified in A. zerumbet.

[0143] Preparations of C. rabens plant materials and extracts

[0144] C. rabens plants were harvested, dried and crushed into an appropriate size for the following experiments. The total extracts of C. rabens were prepared from dried or fresh plant materials using an aqueous alcohol solution, such as 50% to 99.5% ethanol. The collected extracts were dried out under vacuum. The basic nutritional factors and chemical fingerprints of phytogenic supplements were analyzed by HPLC / mass spectrometry or GC / mass spectrometry.

[0145] Clostridium perfringens preparation

[0146] C. perfringens obtained from ATCC (13124™); a strain of type A isolate producing cpa toxin) was amplified in LB Broth according to the instruction manual and tittered by inoculating on tryptose sulphite cycloserine (TSC) agar plates.

[0147] Animal study

[0148] One-day-old ROSS 308 chicks (n = 360) from a local commercial hatchery were randomly divided into 7 groups; 2 dosages of C. perfringens challenge (0 and 1 x 108CFU at age of 18 and 20 days, respectively); AL-H group containing 0.1% phytogenic ingredients of zerumbet, com starch, minerals in the standard layer diet, and Kemin CLOSTAT® (0.1% of feed), a commercialPATENTAttorney Docket No. G4590-20900PCTPB6 Bacillus subtilis-based probiotic with 2.2 × 108CFU / g in dietary supplementation with 4 repetitions (4 pans per group and 10 birds per pan). At age of 18 and 20 days, birds were dosed with 1 mL C. perfringens (2 × 108CFU / mL) by oral gavage for NE development, and thereafter necropsied at 28 and 35 days for tissue collection. Chickens were provided with the standard diets and maintained on a photoschedule 16L / 8D with feed provided at 08:30 am and free access to feed and water throughout the experiment. All chicken husbandry and tissue collections were conducted in accordance with an approved animal care protocol by the Institutional Animal Care and Use Committee (IACUC, 110-056) of the National Chung Hsing University, Taiwan.

[0149] Tissue sample collection

[0150] At day 28 and 35, 2 chickens from each pan were necropsied by cervical dislocation and tissues (intestine and liver) and blood were collected. Upon necropsy, the intestine was immediately examined for lesion score evaluation. Four birds were selected for blood sample collection for serum IL- 10 determination at day 18 (before C. perfringens challenge), 21, and 28. Collected tissues were used for morphological, molecular, and biochemical analyses.

[0151] Intestinal lesion scoring, morphology, leukocyte infiltration, and permeability

[0152] The ileal part of intestine was graded for lesion scoring based on the typical 0-6-scale system (Shojadoost et al., The successful experimental induction of necrotic enteritis in chickens by Clostridium perfringens: a critical review. Vet. Res. 2012. 43: 74'). Sections of the middle line of duodenum and jejunum were used for villus height and crypt depth analysis, while sections of the middle line of jejunal and ileal part were used for evaluating leukocyte infiltration by H& E staining or immunostaining using an avian- specific mouse monoclonal antibody (clone KUL01, Abeam, Cambridge, UK) under microscopy imaging.

[0153] Fluorescein isothiocyanate dextran (FITC-dextran, MW 3-5 kDa; Sigma Aldrich Co., St. Louis, MO, USA) was used as a marker of paracellular transport and intestinal mucosal barrier functional analysis. At age of 28 days, birds were dosed with 2.2 mg FITC-dextran (in 1 mL PBS) by oral gavage. Blood samples were collected at 2 h after gavaging for FITC intensity determination to evaluate intestinal integrity by permeable FITC-dextran.

[0154] Serum IL- 1 (3 determination and intestinal slgA determination

[0155] Serum IL- 10 levels were measured by a commercial ELISA kit (Cat.# ECH0040, Wuhan Fine Biotech Co., Ltd., Wuhan, China). A 10 cm portion of the duodenum was used for intestinal washings and 1 ml of PBS was flushed in and out the duodenum lumen 5 times with a syringe to obtain the duodenum intestinal washings for secretory immunoglobulin A (slgA) determination.PATENTAttorney Docket No. G4590-20900PCTA chicken IgA ELISA Kit (Cat.# ab157691, Abeam, Cambridge, UK) was used for slgA measurement.

[0156] Primary metabolome analysis using gas chromatography / quadrupole time-of-flight mass spectrometry (GC / QTOF-MS)

[0157] The serum samples (50 pL each) from tested broilers were mixed with 80% methanol containing ribitol (0.2 mg / mL) as an internal standard, then vigorously vortexed and put in liquid nitrogen for 10 min, and the protocol was repeated for 3 times to remove protein fraction thoroughly. After centrifuging at 13,000 ×g for 10 min at 4°C, the supernatants were collected and dried in vacuum by SpeedVac (Labconco, USA). The dried analytes were incubated with 20 pL methoxyamine (20 mg / mL in pyridine) at 30°C for 90 min for reaction and then derivatized with 100 pL7V, O- bis(trimethylsilyl)trifluoroacetamide (BSTFA) containing 1% trimethylchlorosilane (TMCS) at 70°C for 120 min.

[0158] The primary metabolome of broiler serum samples from control, C. perfringens challenge, CR, CRE-H, and CLOSTA® groups were performed by GC / Q-TOF mass spectrometer (Agilent Technologies, USA) at the Metabolomics Core Facility, Agricultural Biotechnology Research Center, Academia Sinica, Taiwan. The derivatized samples (0.5 pL) were injected with helium as the carrier gas flow at 1 mL / min into an Agilent J& W DB-5ms column (30 m x 250 pm x 0.25 pm). The GC oven temperature ramp was maintained at 60°C for 1 min, then elevated to 325°C (10°C / min) and held constant for 10 min. The mass range was 50-600 Da and the data were gathered in full scan mode. Mass spectra were compared against the NIST Chemistry WebBook (National Institute of Standard and Technology) and PubChem (National Center for Biotechnology Information). Peak heights of the mass (mass-to-charge ratio) fragments were normalized to the internal standard (ribitol) of each sample.

[0159] Statistical analysis

[0160] Data were analyzed by one-way ANOVA, in which dietary inclusion of AL or CLOSTAT® were the classifying variable as indicated. Differences among means were tested using Tukey multiple comparison procedure. Differences because of C. perfringens challenge were tested by Student / -test. Values were expressed as means ± SEM. Mean differences were considered significant at P < 0.05. All statistical procedures were carried out using SPSS for Windows 13.0.

[0161] ALE and AL API or ALE API inhibit C. prefringen growth assay

[0162] ALE or AL API or ALE API were sprayed onto TSC agar plate before inoculating the plate with C. prefringen (4.87 x 103CFU / plate). The culture plates were incubated at 35°C forPATENTAttorney Docket No. G4590-20900PCTovernight, then bacterial colonies were counted. *: Significant difference vs. vehicle, +: Significant difference between two different dose treatments of the same extract (P < 0.05).

[0163] CRE inhibits C. prefringen growth assay

[0164] C. perfringens at 5 x 104CFU / mL in liquid culture were incubated with CRE (0.98 to 500 pg / mL) and cultured anaerobically at 37°C for 18 h. Bacterial growth (%) was calculated as the ratio of the ODeoo of the treatment group to that of the non-treated group multiplied by 100. Data are presented as the mean ± SEM. One-way ANOVA tests were used for statistical analysis of differences between groups and P (***) < 0.001 is considered statistically significant.

[0165] ResultsILA. Phytogenies derived from A. z erumbet

[0166] II. A.1 Growth performance of chickens under normal conditions or challenged with C. perfringens

[0167] The flock of chicks was separated into four treatment groups (n = 10 in each pan, 4 pans per treatment group) and grown for 35 days under normal conditions or challenged with C. perfringens at age of 18 and 20 days forNE development. The results showed that AL supplements exerted no significant effects on growth performances including body weight gain, feed intake, and feed conversion rate (FCR) in broilers under normal conditions (Table 3). When under C. perfringens infection, phytogenic AL-H and PB6 Bacillus subtilis-based probiotic CLOSTAT® supplementation significantly improved FCR by 5.7% and 5.1%, respectively when compared to the control (P < 0.05, Table 4). These results indicate that phytogenies derived from A. zerumbet used as a feed supplement improved growth performance of broilers under C. perfringens infection.Table 3. Effects of dietary supplementation of phytogenies derived from A. zerumbet on growth performance of broilers under normal conditions (no challenge).Control AL-HBW (g / bird) at age of 35 days 2039.9±45.1 2067.0±22.6Total feed intake (g / bird) 2904.9+38.5 2833 7+33 8FCR (feed conversion rate, 1.460+0.036 1.405+0.036feed intake / BW gain)Means with different superscript leters within the same row are significantly different (P < 0.05 by Tukey multiple comparison test). FCR; feed conversion rate: feed intake / BW gain.Table 4. Effects of dietary supplementation of phytogenies derived fromA. zerumbet on growth performance of broilers challenged with C. perfringens.Control+NE AL-H+NE CLOSTAT®+NEPATENTAttorney Docket No. G4590-20900PCTBW (g / bird) at age of 35 1988.4±38.5 2022.5±24.0 2068.2±28.7 daysTotal feed intake (g / bird) 2924.6+34.6a2821.9±24.5b2906.0+84.3abFCR (feed conversion rate, 1.512±0.031a1.431+0.024 b 1.439+0.017 bfeed intake / BW gain)Means with different superscript leters within the same row are significantly different (P < 0.05 by Tukey multiple comparison test).

[0168] II. A.2 Intestinal morphology of chickens under C. perfringens infection

[0169] The data in Table 5 show that challenge with C. perfringens significantly impaired Intestinal morphology including shorter villus heights (V), higher crypt depths (C), and thereby lower V / C ratios in the duodenum and / or jejunum (P < 0.05) (F FIG. 8). A differential effect on intestinal morphology by AL-H or CLOSTAT® was observed in birds infected by C. perfringens, in which AL-H had no significant effects on duodenal morphologies, but increased jejunal villus heights, lowered crypt depths, and promoted higher V / C ratios, while CLOSTAT® increased duodenal and jejunal villus heights and V / C ratios (P < 0.05, Table 5). The results suggested that parts of improved growth performances by AL, particularly in those birds infected by C. perfringens can be attributed to a better intestinal morphology.Table 5. Effects of dietary supplementation of phytogenies derived from A. zerumbet on intestinal morphology of broilers challenged with C. perfringens.Control Control+NE AL-H+NE CLOSTATS+NE DuodenumVillus height (V, pm) 1573.0±54.3a1246.1+94.2 b 1488.6±149.6ab1504.5+151.9abCrypt depth (C, pm) 207.9+7.5 b 217.8+9.8 b 269.2+18. la221.3+7.9 b V / C ratio 7.58+0.2335.70±0.17b5.68+0.88 b 6.79+0.943JejunumVillus height (V, pirn) 1397.7+24.2a739.3+10.1b1285.7+74.8a1421.5±95.7aCrypt depth (C, pm) 191.3+7.4 b 241.2+9.2 a 268.8+23.7a277.3+26.0aV / C ratio 7.04+0.32 a 3.07+0.08c4.92+0.58 b 5.24+0.506 Means with different superscript leters within the same row are significantly different (P < 0.05 by Tukey multiple comparison test, n = 4).

[0170] II. A.3 Intestinal integrity of chickens under normal conditions or challenged with C. perfringens

[0171] While under C. perfringens challenge, supplemental AL-H but not CLOSTZVT®, significantly decreased ileal lesion scores at age of 28 days (P < 0.05, Table 6) in chickens. AL-H supplementation also significantly suppressed intestinal permeability in birds infected by C. perfringens (P < 0.05, F FIG. 8), whereas CLOSTAT® exerted no effects on intestinalPATENTAttorney Docket No. G4590-20900PCTpermeability. Taken together in combination with the results of intestinal morphology (Table 5), AL supplementation apparently improved intestinal mucosal integrity for nutrient digestion and absorption, and may preclude pathogen colonization and infiltration into the circulation.Table 6. Effects of dietary supplementation of phytogenies derived from A. zerumbet on intestinal lesion score of broilers challenged with C. perfringensIleal lesion score Control+NE AL-H+NE CLOSTAT®+NEAt age of 28 days _ 2,58±0.20a_ 0,92±0.27b_ 2,50+0,26 aAt age of 35 days 1.75+0.36 2.08+0.30 2.17+0.67Means with different superscript leters within the same row are significantly different (P < 0.05 by Tukey multiple comparison test, n = 8).

[0172] II. A.4 Intestinal and systemic inflammation under C. perfringens challenge

[0173] Supplemental AL-H and CLOSTAT® alleviated intestinal inflammatory response in birds challenged with C. perfringens as shown by lower filtration by leukocytes and macrophages in the jejunum and / or ileum (P < 0.05, FIGs. 9A-9B and 10A-10B). The provocation of intestinal inflammation by C. perfringens was associated with increased intestinal slgA contents (Zhang et al., 2017, Dietary L-arginine inhibits intestinal Clostridium perfringens colonisation and attenuates intestinal mucosal injury in broiler chickens. Br. J. Nutr. 2017. 118, 321-332.') which was significantly attenuated by supplemental AL-H and CLOSTAT® (P < 0.05, FIG. 11). Surprisingly, AL-H supplementation even promoted intestinal slgA secretion under normal conditions (P < 0.05, FIG. 11), suggesting enhanced inn ate defense in mucosal immunity.

[0174] Dietary supplementation of AL-H or CLOSTAT® also significantly suppressed circulating IL-ip concentrations in birds at age of 21 and 28 days after challenge with C. perfringens at 18 days (P < 0.05, FIG. 12), suggesting that not only the intestine per se, but the systemic inflammatory status was relieved by supplemental AL-H and CLOSTAT®.

[0175] Challenge with C. perfringens increased the bactericidal activity in isolated peripheral heterophils, but not in monocytes (P < 0.05, FIG. 13). AL-H had no effects on the bactericidal activity of peripheral leukocytes, while CLOSTAT® supplementation significantly promoted bacterial killing activity in monocytes but suppressed the activity in heterophils (P < 0.05, FIG.13). Despite the differential effects depending on leukocyte type, the results suggest that AL supplementation may potentiate the functionality of innate immunity, such as leukocyte recruitment and their respiratory burst and phagocytic activity to eliminate pathogens infiltrated into the inflamed site.

[0176] II. A.5 Chemical compositions of the bioactive phytogenic supplement from A. zerumbetPATENTAttorney Docket No. G4590-20900PCT

[0177] The chemical compositions of bioactive phytogenic supplement AL-H contain dihydro- 5,6-dehydrokavain (DDK), 5,6-dehydrokavain (DK), cardamonin and flavokawin B; the content of each estimated as 70.4%, 24.2%, 1.7% and 3.7%. Other metabolites detected in AL-H includes lactic acid, malic acid, nicotinic acid, palmitic acid, myo-inositol, maltose and 1-monomyristin, and there are in one or more of the following ratios:• a ratio of lactic acid to malic acid of 6.61 to 1 or less• a ratio of malic acid to nicotinic acid of 0.0055 to 1 or less• a ratio of malic acid to palmitic acid of 0.00097 to 1 or less• a ratio of 1-monomyristin to malic acid of 23.19 to 1 or less• a ratio of malic acid to myo-inositol of 0.020 to 1 or less• a ratio of maltose to myo-inositol of 0.92 to 1 or less

[0178] II. A.6 Inhibition of C. perfringens growth

[0179] ALE and AL API effectively inhibited C. perfringen growth dose-dependently. At 0.5 mg / mL and 5 mg / mL treatment concentrations, ALE-treated group showed 58% and 35% living colonies, respectively, and AL_API-treated group showed 32% and 18% of living colonies, respectively, compared to the vehicle control group (100%) (FIG. 14). The AL API effect was superior to that of ALE effect against the bacterial growth.Phytogenies

[0180] B. Phytogenies derived from C. rabens

[0181] B.l Growth performance of chickens challenged with C. perfringens

[0182] The chicks were separated into four groups (n = 10 in each pan, 4 pans per treatment group) and grown for 35 days challenged with C. perfringens for NE development. Under C. perfringens infection, CRE-H, CR, and PB6 Bacillus subtilis-based probiotic CLOSTAT® supplementation significantly increased body weight and feed intake (P < 0.05, Table 1), when compared to the control group (P < 0.05, Table 1). Birds with CR supplementation even had higher BW than those with CLOSTAT® (P < 0.05, Table 1). Both CR and CLOSTAT® supplementation significantly improved FCR by 6% and 4.6%, respectively (P < 0.05, Table 7). These results indicate that phytogenies supplements CR and CRE promoted growth performance of broilers under C. perfringens infection.Table 7. Effects of dietary supplementation of phytogenies derived from C. rabens on growth performance of broilers challenged with C. perfringens._ Control+NE CRE-H+NE CR+NE CLOSTAT®+NEBW (g / bird) at 1988.4±38.5C2065.9±6.2 b 2162.1±22.7a2068.2±40.4bage of 35 daysPATENTAttorney Docket No. G4590-20900PCTFeed intake 2924.6±34.6b2926.6±12.9b fc3003.1±17.5a2906.0+84.3ab(g / bird)FCR 1.51+0.03131.45±0.0113b1.42±0.023b1.44±0.017bMeans with different superscript leters within the same row are significantly different (P < 0.05 by Tukey multiple comparison test, n = 4).

[0183] II. B.2 Intestinal morphology of chickens under C. perfringens infection

[0184] Challenge with C. perfringens significantly impaired Intestinal morphology as shown by shorter villus heights (V) but higher crypt depths (C), and thereby lower V / C ratios in the duodenum and / or jejunum (P < 0.05, Table 8). Dietary supplementation of CRE-H, CR, or CLOSTAT® significantly improved the morphologies to various degrees (P < 0.05, Table 8 / in which birds with CRE-H inclusion had higher duodenal and / or jejunal villus heights, lower crypt depths, and higher V / C ratios than those with CLOSTAT®, and even better than the healthy birds (P < 0.05, Table 8). The results indicate that the improved growth performance by CR or CRE, particularly on those birds under infection by C. perfringens, was partially attributed to better intestinal morphology or structural integrity.Table 8. Effects of dietary supplementation of phytogenies derived from C. rabens on intestinal morphology of broilers challenged with C. perfringens.Control Control+NE CRE-H+NE CR+NE CLOSTATS+NE DuodenumVillus height 1573.0+54.3b1246.1+94.2° 1901.6±52.1a1658.6+170.2 b 1504.5+151.9 b (V, pm)Crypt depth 207.9+7.5 217.8+9.8 210.3+6.0 229.6+23.5 221.3+7.9 (C, pm)V / C ratio 7.58+0.23 b 5.70±0.17c9.08+0.57 a 7.44+0.51 b 6.79+0.94bcJejunum Villus 1397.7±24.2a739.3+10.1 b 1438.6+29.031386.8+134.0a1421.5+95.7aheight (V, pm)Crypt depth 191.3+7.4 a 241.2+9.23155.6+5.5° 185.1±21.7b277.3±26.0a(C, pm)V / C ratio 7.04+0.32 b 3.07+0.08 d 9.27+0.19a7.57+0.31 b 5.24+0.50cSamples collected at age of 28 days were used for morphology examination by H& E staining. Means with different superscript leters within the same row are significantly different (P < 0.05 by Tukey multiple comparison test, n = 4).

[0185] II. B.3 Intestinal integrity of chickens under normal conditions or challenged with C. perfringensPATENTAttorney Docket No. G4590-20900PCT

[0186] In C. perfringens challenged chickens, when supplementation with CRE-H or CR, but not with CLOSTAT® significantly lowered ileal lesion scores at age of 28 and 35 days (P < 0.05, Table 3). Dietary CRE-H and CR supplementation significantly decreased intestinal permeability in birds under challenged by C. perfringens (P < 0.05, FIG. 15), while CLOSTAT® exerted no effects on intestinal permeability. Taken together the results of intestinal morphology (Table 9), CRE and CR supplementation apparently improved intestinal mucosal integrity for nutrient digestion and absorption, which may result in precluding pathogen colonization and infiltration into the circulation).Table 9. Effects of dietary supplementation of phytogenicsphytogenics derived from C. rabens on intestinal morphology of broilers challenged with C. perfringens.Control Control+NE CRE-H+NE CR+NE CLOSTATS+NE DuodenumVillus height 1573.0+54.3b1246.1±94.2C1901.6±52.1a1658.6+170.2 b 1504.5+151.9 b (V, pm)Crypt depth 207.9+7.5 217.8+9.8 210.3+6.0 229.6+23.5 221.3+7.9 (C, pm)V / C ratio 7.58+0.23 b 5.70±0.17c9.08+0.57 a 7.44+0.51 b 6.79+0.94bcJejunum Villus 1397.7±24.2a739.3+10.1 b 1438.6+29.031386.8+134.0a1421.5+95.7aheight (V, pm)Crypt depth 191.3+7.4 a 241.2+9.23155.6±5.5C185.1±21.7b277.3±26.0a(C, pm)V / C ratio 7.04+0.32 b 3.07+0.08 d 9.27+0.19a7.57+0.31 b 5.24+0.50cSamples collected at age of 28 days were used for morphology examination by H& E staining. Means with different superscript leters within the same row are significantly different (P < 0.05 by Tukey multiple comparison test, n = 4).

[0187] II. B.4 Intestinal and systemic inflammation under C. perfringens challenge

[0188] Supplemental CRE-H, CR, and CLOSTAT® suppressed intestinal inflammatory response in birds challenged with C. perfringens as shown by lower leukocyte and macrophage infiltration in the jejunum and / or ileum (P < 0.05, FIGs. 16A-16B and 17A-17B). The intestinal inflammation by C. perfringens challenge is associated with increased intestinal slgA content which was significantly atenuated in the CRE-H, CR, and CLOSTAT® supplementation groups (P < 0.05, FIG. 18). Surprisingly, CR supplement even promoted intestinal slgA secretion under normal conditions, suggesting enhanced innate defense in mucosal immunity. Dietary supplementation of CRE-H, CR, or CLOSTAT® also significantly decreased circulating IL-ip concentrations in birds at age of 21 and 28 days after challenged with C. perfringens at 18 days (P < 0.05, FIG. 19),PATENTAttorney Docket No. G4590-20900PCTsuggesting that not only the intestine per se, but the systemic inflammatory status was relieved by CR, CRE-H, and CLOSTAT®.

[0189] Challenge with C. perfringens in birds increased bactericidal activity in isolated peripheral heterophils, but not in monocytes (P < 0.05, FIG. 20). CRE-H and CLOSTAT® supplementation significantly promoted bacterial killing activity in monocytes, while supplemental CRE-H and CLOSTAT® suppressed the activity in heterophils (P < 0.05, FIG. 20). Despite the differential effects depending on leukocyte type, the results suggest that both phytogenic supplements may potentiate the functionality of inn ate immunity, such as leukocyte recruitment and their respiratory burst and phagocytic activity to eliminate pathogens infiltrated into the inflamed site.

[0190] II. B.5 Primary metabolome analysis of serum from broilers with C. perfringens challenge

[0191] The potential effect of CR, CRE-H, and CLOSTAT® supplementation on the serum primary metabolome of broilers challenged with C. perfringens was investigated using GC / Q-TOF MS. A total of 87 metabolites detected in serum were subjected to multivariate partial least squares discriminant analysis (PLS-DA) (FIGs. 21 A-21B). The results in FIG. 8A showed that the overall primary metabolites in control (healthy) birds and birds challenged with C. perfringens (NE) can be clustered into two distinct groups in the score plot. The loading plot further suggested that a-D-(+)-talopyranose, 2-hydroxybutanoic acid, and D-(-)-ribofuranose in the NE group, and D-allose, linoleic acid, oxalic acid in the control group as the outlier metabolites might have a significant biological role in both groups of chicken. Furthermore, the score plot (FIG. 2 IB) revealed that, under C. perfringens challenge, vehicle, CRE-H, CR, and CLOSTAT®-treated groups showed separated clusters, and some corresponding metabolite outliers can be observed in the loading plot (FIG. 2 IB), suggesting CRE-H, CR, and CLOSTAT® treatments could affect primary metabolism in C. perfringens infected broilers.

[0192] To further compare the fold-change of the metabolites between control vs. NE, and NE vs. CRE-H, CR, or CLOSTAT® group, the identified metabolites were categorized and grouped according to their chemical structures and functionalities, including amino acids / derivatives, carbohydrates, fatty acids, nucleotides, organic acids, sterols, urea cycle related metabolites, and others (the metabolites not belonging to the aforementioned categories). The fold-change of the intensities of metabolites in control birds (control) vs. C. perfringens challenged birds (NE), and the NE with vehicle vs. CRE-H, CR, or CLOSTAT® group were compared and the results are presented by heatmap. The lower and upper ranges of fold-change in the heatmap were set at (0 to 0.1-fold and 10-fold (and up), respectively. The data showed that the majority of metabolite levelsPATENTAttorney Docket No. G4590-20900PCTwere disrupted and decreased in chickens with NE, indicating that C. perfringens infection significantly affected primary metabolism in the animals. Among the 18 amino acids detected, L-glutamine and L-methionine were most significantly decreased (0.1 -fold) when compared with control group, whereas only cystine was increased about 2.5-fold after C. perfringens infection. The results were confirmed by lower body weight gain in birds challenged by C. perfringens. Since methionine is one of the limited amino acids for protein deposition for animal growth and normally is supplemented with additional ration around 0.1-0.3% in broiler diets. A lower serum methionine level under NE development therefore may suggest impaired absorption of dietary methionine and / or increased methionine / homocysteine / cysteine interconversion for methyl transfer and glutathione (GSH) synthesis in response to oxidative stress. Notably, CRE-H, CR and CLOSTAT® supplements significantly increased the levels of methionine in chicken sera to 10-fold compared to the NE vehicle group, while the glutamine and aspartic acid levels were increased 4.5-fold to 7.4-fold, and 1.6-fold to 6.2-fold, respectively, in CRE-H, CR and CLOSTAT® groups. CRE-H supplement also elevated the level of tyrosine to 2.3-fold in NE birds. These data suggest that the CRE-H and CR feed additive indeed reveal positive or protective effect in the NE birds.

[0193] Among the nineteen detected carbohydrates, D-mannitol, galactonic acid, galacturonic acid, and ketose were increased 1.2-fold to 10-fold in all treated broilers with C. perfringens challenge compared to the NE vehicle group. Particularly, C. perfringens challenge induced a 10-fold and 3.8- fold increase of meso-erythritol and xylose in tested chickens; both metabolites have been proved to inhibit growth performance and nutrient digestibility which can be significantly down-regulated by CR treatment (0.1 -fold). Although the effect of conjugated linoleic acid (CLA) on broiler growth performance is still controversial, it was reported that feeding CLA to broilers resulted in substantial incorporation of CLA into their tissues, providing a potential CLA-rich source for human consumption. In this study, linoleic acid was decreased in NE broilers (0.1 -fold) compared with healthy birds, however, CLA was significantly resumed with CRE-H, CR, and CLOSTA® supplementation (8.8- to 10-fold) in birds with NE. Hypoxanthine is a stress metabolite involved in modulating energy metabolism in intestinal epithelial cells which is critical for intestinal barrier function. We observed the significantly raised levels of hypoxanthine by C. perfringens infection (10-fold) compared to the healthy birds. In CLOSTA® group, the value was even increased 1.4-fold when compared to the NE vehicle group. Since hypoxanthine is a precursor in uric acid synthesis, a high energy demand process for nitrogenous waste excretion in bird, the dramatic increase of serum hypoxanthine level may indicate a negative impact on energyPATENTAttorney Docket No. G4590-20900PCTpartition for body weight gain. In CRE-H and CR groups, the levels of hypoxanthine were decreased 0.1- to 0.5-fold compared with the NE vehicle group, implying the CRE-H / CR supplementation involved a homeostatic regulation of energy metabolism in broiler chickens.

[0194] Organic acids have been reported to have indirectly capability of suppressing pathogenic bacteria by lowering the pH value of avian gastrointestinal tract. Similar to the amino acid levels, C. perfringens infected broilers revealed lower levels of most identified organic acids than the control broilers. CRE-H treatment can resume the levels of 2,4-dihydroxybutanoic acid (8.5-fold), 2-hydroxyglutaric acid (10-fold), oxalic acid (7.1-fold) while CR treatment caused most significant increase of 2,4-dihydroxybutanoic acid (10-fold), 2-hydroxybutanoic acid (10-fold) and 2-hydroxyglutaric acid (10-fold) in infected broilers. CLOSTAT® treatment also resumed the levels of 2,4-dihydroxybutanoic acid (3.8-fold) and 2-hydroxyglutaric acid (10-fold) in C. perfringens infected birds. In chickens, metabolites involved in urea cycle are quite important for metabolic pathways associated with growth and immune status due to the absence or deficiency of functional urea cycle. The three urea cycle metabolites, L-omithine, urea, and uric acid were found decreased in NE group. CRE-H or CR supplementation in diet can increase their levels in broilers with NE. Although most of nitrogenous compounds are metabolized and excreted as uric acid in avian species, chickens can increase the proportion of NH4 and urea excretion under low protein diet or fasted conditions. Accordingly, a decline of serum glutamine and ornithine levels in accompany with decreased urea, and uric acid under C. perfringens infection may suggest a higher proportion of toxic NH3 excretion and increased energy dissipation by the kidney to meet the need for increased workload for maintaining fluid homeostasis, and thereby a less proportion of energy is partitioned for body weight gain.

[0195] On the other hand, CRE-H and CR treatments induced 10-fold increase of 1,5-anhydro-D- sorbitol, an anhydro sugar of D-sorbitol, which shows laxative effect by stimulating muscle contractions (peristalsis) and facilitating bowel movements in animals. Notably, oleamide, a primary fatty acid amide derive from oleic acid involves in a wide range of physiological functions, including a triangular relationship with cancer and Na+and K+channels from that oleamide reveals anti-cancer effect. CRE-H and CR treatment significantly induced 2.1-fold to 2.4-fold in broilers with NE compared to NE vehicle. Taurine is an antioxidant, which has been demonstrated with several therapeutic roles in experimental animal models against oxidative stress, including reducing hypertension risks, hepatic cirrhosis among others. In NE birds the taurine level was significantly decreased (0.1-fold) compared to the healthy birds which can be significantly elevated in CRE-H and CR-treated groups (4- to 6.7-fold). Together, the primary metabolomePATENTAttorney Docket No. G4590-20900PCTresults highlight the beneficial and protective effects of CRE-H and CR supplementation in broilers with necrotic enteritis.

[0196] The chemical composition of the bioactive phytogenic supplement CR contains a-linolenic acid, citric acid, lactic acid, mannitol and palmitic acid, and they are in one or more of the following ratios:• a ratio of a-linolenic acid to citric acid of 1.66 to 1 or less• a ratio of citric acid to lactic acid of 0.79 to 1 or less• a ratio of citric acid to mannitol of 0.94 to 1 or less• a ratio of lactic acid to mannitol of 1.19 to 1 or less• a ratio of a-linolenic acid to palmitic acid of 0.086 to 1 or less

[0197] The chemical composition of the bioactive phytogenic supplement CRE-H contains a-linolenic acid, aspartic acid, mannitol, 1-monomyristin and lactic acid, and they are in one or more of the following ratios:• a ratio of aspartic acid to a-linolenic acid of 0.088 to 1 or less• a ratio of mannitol to aspartic acid of 7.27 to 1 or less• a ratio of a-linolenic acid to mannitol of 1.56 to 1 or less• a ratio of aspartic acid to 1-monomyristin of 0.035 to 1 or less• a ratio of lactic acid to aspartic acid of 8.69 to 1 or less

[0198] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

[0199] II. B.6 Inhibition of C. perfringens growth

[0200] CRE (500 pg / mL) significantly inhibited C. perfringen growth in TSC broth with about 62% inoculated bacteria alive compared to the vehicle-treated group (P < 0.001) (FIG. 23).

Claims

PATENTAttorney Docket No. G4590-20900PCTCLAIMS WHAT IS CLAIMED IS:

1. A method of reducing, preventing or treating an intestinal infection, preventing or treating a disease associated with protozoan parasite of the genus Eimeria, inhibiting an oocyst sporulation of a protozoan parasite or preventing a sporozoite invasion or reproduction, preventing or treating coccidiosis, promoting growth performance, controlling, treating and / or preventing necrotic enteritis in a subject, comprising administering to the subject an effective amount of a composition comprising a Crassocephalum rabens (CR), a bioactive extract thereof (CRE), an active ingredient(s) contained in a CR (CR API) or CRE (CRE API), a combination of two or more of a CR, a CRE, a CR API and a CRE API, or one or more of a-linolenic acid, citric acid, lactic acid, mannitol, palmitic acid, aspartic acid and 1-monomyristin.

2. The method of claim 1, wherein the subject described herein is poultry.

3. The method of claim 2, wherein a body weight gain of the poultry is restored and / or primary metabolome in the poultry is modulated.

4. The method of claim 1, wherein the promotion of growth performance involves enhancing methionine utilization and dissipating less energy for uric acid synthesis for nitrogenous waste excretion and increasing a level of organic acids and / or a level of tyrosine, decreasing a level of hypoxanthine.

5. The method of claim 1, wherein the CR has one or more of the following characteristics: about 45% to about 80% of a-linolenic acid and about 55% to about 20% of citric acid in relative amount;about 25% to about 65% of citric acid and about 75% to about 35% of lactic acid in relative amount;about 30% to about 70% of citric acid and about 70% to about 30% of mannitol in relative amount; about 35% to about 75% of lactic acid and about 65% to about 25% of mannitol in relative amount; andabout 1% to about 25% of a-linolenic acid and about 99% to about 75% of palmitic acid in relative amount.

6. The method of claim 1, wherein the CR has one or more of the following characteristics: a ratio of a-linolenic acid to citric acid of 1.66 to 1 or less in relative amount;a ratio of citric acid to lactic acid of 0.79 to 1 or less in relative amount;a ratio of citric acid to mannitol of 0.94 to 1 or less in relative amount;a ratio of lactic acid to mannitol of 1.19 to 1 or less in relative amount; andPATENTAttorney Docket No. G4590-20900PCTa ratio of a-linolenic acid to palmitic acid of 0.086 to 1 or less in relative amount.

7. The method of claim 1, wherein the CRE has one or more of the following characteristics:about 1% to about 25% of aspartic acid and about 99% to about 75% of a-linolenic acid in relative amount;about 65% to about 99% of mannitol and about 35% to about 1% of aspartic acid in relative amount;about 40% to about 80% of a-linolenic acid and about 60% to about 20% of mannitol in relative amount;about 0.1% to about 20% of aspartic acid and about 99.9% to about 80% of 1-monomyristin in relative amount; andabout 70% to about 99.9% of lactic acid and about 30% to about 0.1% of aspartic acid in relative amount.

8. The method of claim 1, wherein the CRE has one or more of the following characteristics:a ratio of aspartic acid to a-linolenic acid of 0.088 to 1 or less in relative amount;a ratio of mannitol to aspartic acid of 7.27 to 1 or less in relative amount;a ratio of a-linolenic acid to mannitol of 1.56 to 1 or less in relative amount;a ratio of aspartic acid to 1-monomyristin of 0.035 to 1 or less in relative amount; anda ratio of lactic acid to aspartic acid of 8.69 to 1 or less in relative amount.

9. The method of claim 1, wherein the protozoan parasite described herein is Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria brunelli, Eimeria necalrix, Eimeria praecox o Eimeria mitis or any combination thereof.

10. The method of any of claim 1, wherein the intestinal infection and / or necrotic enteritis is caused by Clostridium perfringens.

11. The method of claim 1, wherein the composition described herein is used as a feed additive or a feed supplement.

12. The method of claim 1, wherein the CRE is an alcoholic CRE.

13. A method of controlling, reducing, preventing or treating an intestinal infection, controlling, treating and / or preventing necrotic enteritis in a subject, or promoting growth performance of a subject, comprising administering to the subject an effective amount of a composition comprising a Alpinia zerumbet (AL), a bioactive extract thereof (ALE), an active ingredient(s) contained in an AL (AL API) or an ALE (ALE API), a combination of two or morePATENTAttorney Docket No. G4590-20900PCTof an AL, an ALE, an AL API and an ALE API, one or more of dihydro-5, 6-dehydrokavain (DDK), 5, 6-dehydrokavain (DK), cardamonin and flavokawin B, or one or more of lactic acid, malic acid, nicotinic acid, palmitic acid, myo-inositol, maltose and 1-monomyristin.

14. The method of claim 13, wherein the subject described herein is poultry.

15. The method of claim 14, wherein and a body weight gain of the poultry is restored and / or primary metabolome in the poultry is modulated.

16. The method of claim 13, wherein the AL or ALE has one or more of the following characteristics:about 70% to about 99% of lactic acid and about 30% to about 1% of malic acid in relative amount; about 0.05% to about 5% of malic acid and about 99.95% to about 95% of nicotinic acid in relative amount;about 0.01% to about 1% of malic acid and about 99.99% to about 99% of palmitic acid in relative amount;about 80% to about 99.5% of 1-monomyristin and about 20% to about 0.5% of malic acid in relative amount;about 0.2% to about 20% of malic acid and about 99.8% to about 80% of myo-inositol in relative amount; andabout 30% to about 70% of maltose and about 70% to about 30% of myo-inositol in relative amount.

17. The method of claim 13, wherein the AL or ALE has one or more of the following characteristics:a ratio of lactic acid to malic acid of 6.61 to 1 or less in relative amount;a ratio of malic acid to nicotinic acid of 0.0055 to 1 or less in relative amount;a ratio of malic acid to palmitic acid of 0.00097 to 1 or less in relative amount;a ratio of 1-monomyristin to malic acid of 23.19 to 1 or less in relative amount;a ratio of malic acid to myo-inositol of 0.020 to 1 or less in relative amount; anda ratio of maltose to myo-inositol of 0.92 to 1 or less in relative amount.

18. The method of claim 13, wherein the composition is used as a feed additive or a feed supplement.

19. The method of claim 13, wherein the ALE is an alcoholic ALE.

20. The method of claim 13, wherein the intestinal infection and / or necrotic enteritis is caused by C. perfringen growth.

Images