A method for constructing a lrp5 a241t gene point mutation high bone mass mouse model
By microinjecting Cas9 mRNA and guideRNA using CRISPR/Cas9 technology, a mouse model of Lrp5 A241T gene point mutation was constructed, solving the problems of long cycle and inconsistent mutations in existing technologies. This method enables the efficient and simple construction of a high bone mass mouse model, which is suitable for research on the mechanism of high bone mass and the treatment of osteoporosis.
Patent Information
- Application Number
- CN202211283712.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-20
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2042-10-20
AI Technical Summary
Existing technologies for constructing Lrp5 gene point mutation high bone mass mouse models are time-consuming and involve the introduction of screening genes such as NeoR, resulting in inconsistencies with the mutations in the patient population, and lack efficient and simple methods.
Using CRISPR/Cas9 technology, a mouse model of Lrp5 A241T gene point mutation was constructed by microinjecting Cas9 mRNA, Donor DNA and guideRNA into fertilized eggs. The target mutation was introduced by homologous recombination repair, avoiding other gene modifications.
It enables the rapid construction of high bone mass mouse models with mutations consistent with human models, simplifies the operation process, improves efficiency, and is suitable for studying the mechanism of high bone mass formation and osteoporosis treatment.
Smart Images

Figure CN116004641B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to a method for constructing a high bone mass mouse model with an Lrp5 A241T gene point mutation. Background Art
[0002] The transmembrane receptor low-density lipoprotein receptor-related protein 5 (LRP5) is closely related to bone mineral density and is primarily believed to regulate bone formation through the canonical Wnt / β-catenin signaling pathway. Gain-of-function mutations in LRP5 can lead to high bone mass manifestations such as increased bone mineral density, cortical thickening, enhanced bone hardness, and fracture resistance. These mutations are usually not associated with other systemic diseases such as the retina and heart. Related neurological complications are primarily caused by excessive bone formation, resulting in an overall benign mutation.
[0003] Studies have found that LRP5 high-bone mass mutations can reduce the risk of osteoporosis caused by aging, long-term hormone use, menopause, and disuse atrophy. They can also rescue bone defects caused by poor osteogenesis and Stat3 deficiency. They can also delay blood sugar elevation and control blood sugar levels in insulin-deficient mice, possibly by enhancing glycolysis. This suggests potential application in the treatment of osteoporosis, poor osteogenesis, diabetes, and other diseases. Furthermore, LRP5 gain-of-function mutations may be closely related to cartilage and tooth development, but the specific effects and related mechanisms require further investigation.
[0004] LRP5 A242T (c.724G>A, p.Ala242Thr) is one of the most common clinically acquired LRP5 mutations, identified in eight families to date. In addition to increased bone density, cortical thickening, and enhanced fracture resistance, some patients also exhibit hard palate osteophytes, without retinal or cardiac complications. Existing technologies have utilized the Cre / loxP system and homologous recombination to generate conditional knock-in mice carrying the Lrp5 A214V and G171V mutations to investigate the bone properties and mechanisms underlying high bone mass in these mice. The Cre / loxP system is used to generate transgenic mice. First, a homologous recombination vector is designed and constructed containing the target mutant gene and a neomycin-resistance cassette (NeoR) with loxP residues at both ends. The transcription of NeoR is driven by a strong promoter opposite to that of the target gene, or the loxP residues are oriented in the opposite direction to the target gene, thereby interfering with target gene expression. The homologous recombination vector is microinjected into embryonic stem cells (ESCs) for genetic modification. Targeted ES cells are screened and verified. These cells are then injected into the blastocyst cavity of mice. The resulting blastocysts are then transplanted into the uterus of pseudopregnant female mice to obtain and verify positive F0 transgenic mice, which carry the target mutant gene but do not express it. These F0 mice are then crossed with wild-type mice to obtain the stably inherited F1 generation. These mice are then crossed with Cre mice to obtain F2 heterozygous mice. The F2 generation is then self-crossed to obtain homozygous Cre mice carrying both the target gene and the Cre gene. The Cre recombinase expressed recognizes two loxP sites, removing both loxP and NeoR, resulting in stable expression of the target gene. This process often requires multiple generations of breeding to obtain the target transgenic mice, which is a time-consuming process. Furthermore, the introduced screening genes, such as NeoR, may differ from the actual mutations in the patient population. Summary of the Invention
[0005] The purpose of the present invention is to provide a method for constructing a high bone mass mouse model with an Lrp5 A241T gene point mutation. The method of the present invention has a short cycle and does not carry other genetic modifications. The amino acid A241 in mouse Lrp5 corresponds to A242 in human LRP5. The mice constructed by the method of the present invention are consistent with the actual mutation in the patient population.
[0006] The present invention provides a method for constructing a high bone mass mouse model with an Lrp5 A241T gene point mutation, comprising the following steps:
[0007] The Cas9 mRNA, the Donor DNA and the guideRNA are mixed, and then the zygote of a donor mouse is microinjected, and then the microinjected zygote is transplanted into a pseudopregnant female mouse, and the offspring is bred, so that the Lrp5 A241T gene point mutation high bone mass mouse model is obtained.
[0008] The nucleotide sequence of the Donor DNA is shown as SEQ ID NO. 1.
[0009] The nucleotide sequence of the guideRNA is shown as SEQ ID NO. 2.
[0010] Preferably, the breeding offspring comprises genotype identification of the F0 generation mice obtained by breeding, and the positive mice carrying the A241T mutation are selected and mated with wild type mice to obtain F1 generation heterozygote mice stably inheriting the Lrp5 A241T mutation.
[0011] Preferably, the wild type mouse comprises a C57BL / 6J mouse.
[0012] Preferably, the donor mouse comprises a C57BL / 6J mouse.
[0013] The application also provides an application of the Lrp5 A241T gene point mutation high bone mass mouse model obtained by the method in the above scheme in the research of high bone mass formation mechanism and osteoporosis treatment drugs related to the Lrp5 A241T gene point mutation.
[0014] The application also provides a kit for preparing the Lrp5 A241T gene point mutation high bone mass mouse model based on the CRISPR / Cas9 technology, wherein the kit comprises a guideRNA for recognizing a target site region of Lrp5 exon4, and the nucleotide sequence of the guideRNA is shown as SEQ ID NO. 2; and the nucleotide sequence of the Lrp5 exon4 is shown as SEQ ID NO. 3.
[0015] Preferably, the kit further comprises Cas9 mRNA and Donor DNA, and the nucleotide sequence of the Donor DNA is shown as SEQ ID NO. 1.
[0016] The application provides a method for constructing an Lrp5 A241T gene point mutation high bone mass mouse model, comprising the following steps: mixing Cas9 mRNA, donor DNA and guide RNA, then performing microinjection on a fertilized egg of a donor mouse, transplanting the microinjection fertilized egg into a pseudopregnant female mouse, breeding offspring, and obtaining an Lrp5 A241T gene point mutation high bone mass mouse model; the nucleotide sequence of the donor DNA is shown in SEQ ID NO. 1; and the nucleotide sequence of the guide RNA is shown in SEQ ID NO. 2. The application uses CRISPR / Cas9 technology, constructs a targeting vector, uses a homologous recombination repair method to introduce a LRP5 target point mutation, and thus obtains a Lrp5 A241T gene point mutation heterozygote mouse. The method of the application is simpler than a traditional Cre / loxP system operation, can realize precise gene modification, and has the advantages of a short technical cycle and high efficiency. In addition, the mouse constructed in the application only has a target gene point mutation and does not carry other gene modifications, is consistent with the real mutation of a patient population, has a high bone mass characteristic through microCT detection, and has important application significance for subsequent exploration of high bone mass related mechanisms, research and development of related targeted therapeutic drugs or gene modification therapy for treating osteoporosis and other diseases, and expansion of clinical applications of LRP5 high bone mass mutations. BRIEF DESCRIPTION OF DRAWINGS
[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.
[0018] Figure 1 The figure shows a schematic diagram of mutant and wild-type genes and primer design;
[0019] Figure 2 It is a horizontal electrophoresis detection result;
[0020] Figure 3 It is a wild-type genomic sequence and actual sequencing result after mutation;
[0021] Figure 4 It is a peak shape graph near the mutation site of the wild-type mouse;
[0022] Figure 5 It is a peak shape graph near the mutation site of the Lrp5 A241T heterozygote mouse;
[0023] Figure 6Figure 5 shows the body size comparison between LRP5 A241T heterozygote and wild type mice, wherein A. wild type and mutant heterozygote mice; B. there is no significant difference in the height of mice in the mutant group compared with the control group; C. there is no significant difference in the weight of mice in the mutant group compared with the control group;
[0024] Figure 7 Figure 6 shows the lumbar vertebrae bone density comparison between LRP5 A241T heterozygote and wild type mice, wherein A. microCT images of the fifth lumbar vertebrae of 16-week-old male mice show that the mutant group has thicker bone cortex and higher cone bone density; B, C. BV / TV, BMD of the fifth lumbar vertebrae show that the mutant group is higher than the control group after 8 weeks;
[0025] Figure 8 Figure 7 shows the distal femur bone density comparison between LRP5 A241T heterozygote and wild type mice, wherein A. microCT images of the distal femur of 16-week-old male mice; B. the trabecular thickness of the distal femur in the mutant group is higher than that in the control group; C, D. BV / TV, BMD of the distal femur show that the mutant group is higher than the control group after 8 weeks;
[0026] Figure 9 Figure 8 shows the comparison of femur cortical thickness and tibia mechanical strength between LRP5 A241T heterozygote and wild type mice, wherein A. microCT images of the femur cross section of 16-week-old male mice; B. the bone cortex thickness of the femur gradually thickens with age, and the mutant group is higher than the control group, and the male is higher than the female; C. the ultimate load of the tibia of the mutant group is higher than that of the control group. DETAILED DESCRIPTION
[0027] The present application provides a method for constructing a Lrp5 A241T gene point mutation high bone mass mouse model, comprising the following steps:
[0028] The Cas9 mRNA, the Donor DNA and the guideRNA are mixed, and then the fertilized eggs of the donor mice are microinjected, and then the microinjected fertilized eggs are transplanted into pseudopregnant female mice, and the offspring are bred to obtain the Lrp5 A241T gene point mutation high bone mass mouse model;
[0029] The nucleotide sequence of the Donor DNA is shown in SEQ ID NO. 1, and specifically is:
[0030] TGCCTGTTTCCTACCTACTGCAGGCAGAAGGTGGTGGAGGGCAGCCTCACT CAT CCTTTTACCCTGACACTCTCTGGGGACACACTCTACTGGACAGACTGGCAGACCCGCTCCATCCACG, wherein the bold bases are the mutated bases, and the bold and underlined bases are synonymous mutations.
[0031] The nucleotide sequence of the guideRNA is shown in SEQ ID NO. 2, specifically: TTTGCCCTGACACTCTCTGG, wherein the bolded bases are the bases to be mutated.
[0032] In the present application, the Cas9 mRNA is based on a Cas9 plasmid, which is obtained by in vitro transcription and purification. The Cas9 mRNA can transiently express Cas9 protein in cells and cut the target DNA sequence at a specific site under the guidance of the guideRNA, which can effectively reduce the off-target effect of CRISPR gene editing.
[0033] In the specific implementation process of the present application, the Cas9 mRNA is based on a Cas9 plasmid, which is transcribed in vitro using the mMESSAGE mMACHINET7 Ultra Kit (Ambion, TX, USA) kit, and then purified using the MEGAclearTM Kit (ThermoFisher, USA) kit, and the specific operation is performed according to the kit instructions.
[0034] In the model construction process of the present application, the Donor DNA directly uses a Donor DNA containing both a synonymous mutation and a target mutation: mutation 1: the first T is a synonymous mutation (bolded + underlined) introduced after mutation; mutation 2: A mutation is a target mutation (bolded). The Donor DNA described in the present application performs a synonymous mutation on the sequence corresponding to the PAM or adjacent PAM of the gRNA to prevent the Donor DNA from being recognized and cut by CAS9 before and after insertion into the genome. The PAM sequence is characterized by NGG (where N is any base). The cutting site of Cas9 is the third base on the 5' end of NGG.
[0035] In the present application, in order to prevent the guideRNA from guiding Cas9 to cut the Donor DNA again, a synonymous mutation (CAT) is introduced at the underlined base of the initial design of the Donor DNA nucleotide shown in SEQ ID NO. 4, but the corresponding histidine is not changed; the sequence shown in SEQ ID NO. 4 is specifically: TGCCTGTTTCCTACCTACTGCAGGCAGAAGGTGGTGGAGGGCAGCCTCACT CAC CCTTTTACCCTGACACTCTCTGGGGACACACTCTACTGGACAGACTGGCAGACCCGCTCCATCCACG, wherein the bolded bases are the bases after mutation.
[0036] The application does not have special restrictions on the use concentration and dosage of Cas9 mRNA, donor DNA and guideRNA, and the conventional use concentration and dosage in the art can be used.
[0037] In the application, the donor mouse preferably includes a C57BL / 6J mouse.
[0038] In the application, the breeding of offspring preferably includes genotype identification of F0 generation mice obtained by breeding, selection of positive mice carrying A241T mutation among them, and mating with wild type mice to obtain F1 generation hybrid mice stably inheriting Lrp5 A241T mutation.
[0039] In the application, the gene base of the mutation site of the positive mouse carrying A241T mutation is A, and the wild type mouse is G.
[0040] The application does not have special restrictions on the identification method, and the conventional method in the art can be used.
[0041] In the application, the wild type mouse preferably includes a C57BL / 6J mouse.
[0042] In the application, the F1 generation hybrid mice stably inheriting Lrp5 A241T mutation and the positive mice identified from the offspring can be used for subsequent research, and the wild type C57BL / 6J mouse is used as a research control group.
[0043] The application also provides the application of the Lrp5 A241T gene point mutation high bone mass mouse model obtained by the method in the above scheme in the research of high bone mass formation mechanism and osteoporosis and other disease treatment drugs related to Lrp5 A241T gene point mutation.
[0044] The application also provides a kit for preparing an Lrp5 A241T gene point mutation high bone mass mouse model based on CRISPR / Cas9 technology, wherein the kit comprises guideRNA for recognizing the target site region of Lrp5 exon4, the nucleotide sequence of the guideRNA is shown as SEQ ID NO. 2; the nucleotide sequence of the Lrp5 exon4 is shown as SEQ ID NO. 3, and specifically is as follows:
[0045] In the application, the nucleotide sequence of Lrp5 exon4 shown in SEQ ID NO. 3 is a wild type genomic sequence fragment, wherein the underlined and bolded base is the base to be mutated, and the sequence shown by the underlined sequence is the nucleotide sequence of the guideRNA.
[0046] In the present application, the kit preferably further comprises Cas9 mRNA and Donor DNA; the nucleotide sequence of the Donor DNA is shown in SEQ ID NO. 1.
[0047] In order to further illustrate the present application, a method for constructing a Lrp5 A241T gene point mutation high bone mass mouse model provided by the present application is described in detail below in combination with the accompanying drawings and examples, but they should not be understood as limiting the scope of protection of the present application.
[0048] Example 1
[0049] Full name of mouse strain: C57BL / 6J-Lrp5 em(A241T) , wherein C57BL / 6J refers to the mouse background, Lrp5 refers to the modified gene, em represents endonuclease system (such as CRISPR / Cas9) mediated gene modification, and A241T represents a specific modification, i.e. the amino-terminal A at position 241 of the protein is mutated to amino acid T.
[0050] 1. Obtain Cas9 mRNA and guideRNA
[0051] Obtain Cas9 mRNA and guideRNA by in vitro transcription.
[0052] The Cas9 mRNA is based on the Cas9 plasmid, which is transcribed in vitro using the mMESSAGE mMACHINE T7 Ultra Kit (Ambion, TX, USA) kit, and then purified using the MEGAclearTM Kit (ThermoFisher, USA) kit, following the instructions of the kit.
[0053] The wild-type genomic sequence information is shown in SEQ ID NO. 5, specifically:
[0054] Among them, the lowercase base is the intron sequence, the uppercase base is the exon sequence, i.e. the Lrp5 exon4 sequence, the underlined and bolded base is the base to be mutated, and the sequence indicated by the underline is the guideRNA sequence.
[0055] 2. Synthesize to obtain Donor DNA
[0056] The nucleotide sequence of the Donor DNA is shown in SEQ ID NO. 1, specifically:
[0057] Wherein the bold and underlined bases are the mutated bases, the first is synonymous mutation, and the second is the mutation of interest.
[0058] 3. Homologous recombination to obtain F0 positive mice
[0059] Cas9 mRNA, guideRNA and Donor DNA were microinjected into fertilized eggs of C57BL / 6J mice, and the injected fertilized eggs were transplanted into pseudopregnant female mice, and F0 mice were obtained about 20 days later.
[0060] Genotype identification was performed by PCR amplification and sequencing, and mice carrying Lrp5 A241T mutation were considered positive. Specifically as follows:
[0061] 1) Extraction of mouse genomic DNA: The mice were numbered and the 3-5 mm tail was cut and placed in a numbered 1.5 ml centrifuge tube, and the cap was tightly closed. Add 0.5 mL lysis buffer and 50 μL protease K stock solution to each tube, and place the centrifuge tube in the hybridization oven, rotate at 56°C overnight. The next day, centrifuge the sample at room temperature at 12000 rpm for 10 min. Take the supernatant to a new 1.5 mL EP tube, add 1 mL anhydrous ethanol (about 2 times the volume of the supernatant), tightly close the cap and shake gently, and a flocculent precipitate can be seen. Centrifuge at 13000 rpm for 15 min, discard the supernatant. Add 70% ethanol 1 mL, wash, centrifuge at 13000 rpm for 15 min, discard the supernatant, collect the precipitate, and air dry at room temperature for 15 min. Add 80-100 μL sterile water to each tube, close the cap and place it at room temperature or 37°C for 1 h to fully dissolve. After the DNA is completely dissolved, store it at -20°C, or directly perform PCR. The DNA concentration is controlled at 50-100 ng / μL, and the OD260 / 280 is between 1.8-2.0.
[0062] 2) PCR amplification:
[0063] The primer information is shown below and see Figure 1 :
[0064] Primer I, upstream primer: 5'-AGTGAGGAGAGTGTGCTTGC-3'(SEQ ID NO. 6);
[0065] Primer II, downstream primer: 5'-TGGCTCAGCACTTGGATGTC-3'(SEQ ID NO. 7).
[0066] The reaction system is shown in Table 1:
[0067] Table 1 Reaction system
[0068] Reaction system reagent Volume (μL) ddH2O 13.2 GXL PCR Buffer 2 2.5mM dNTP 2 Primer I (10pmol / μL) 0.5 Primer II (10pmol / μL) 0.5 GXL DNA Polymerase* 0.8 Mouse tail gene DNA 1 Total volume 20
[0069] Note: *PrimeStar GXL DNA Polymerase (TaKaRa, Code No: R050A).
[0070] Reaction conditions are shown in Table 2.
[0071] Table 2 Reaction conditions
[0072]
[0073]
[0074] Horizontal electrophoresis detection: 1.7% agarose gel was prepared, and after spotting, horizontal electrophoresis was performed to confirm the 324bp band. The results are shown in Figure 2 .
[0075] 3) Gene sequencing: DNA sequencing of the PCR product to determine the base sequence.
[0076] Sequencing primer: 5'-AGTGAGGAGAGTGTGCTTGC-3' (SEQ ID NO. 8).
[0077] The wild-type genomic sequence and the actual sequencing results after mutation are shown in Figure 3 . Wherein, Query is the wild-type genomic sequence, and Subject is the actual sequencing result after mutation.
[0078] 4. Obtain transgenic mice with stably inherited Lrp5 A241T mutation
[0079] F0 generation positive mice were mated with wild-type C57BL / 6J mice to breed F1 generation mice. Genotype identification was performed by PCR amplification and sequencing to obtain F1 generation heterozygous mice with stably inherited Lrp5 A241T mutation. F1 and offspring genotype identification positive mice can be used for subsequent research, and wild-type C57BL / 6J mice are used as a research control group. The gene identification process is as follows:
[0080] 1) Mouse genomic DNA extraction: The mice were numbered and the 3-5mm tail was cut and placed in a numbered 1.5ml centrifuge tube, and the cap was covered. Add 100μL 50mmol / L NaOH solution to each tube, and boil to 100℃ on a metal bath for 30min, then place on ice. Add 26μL 10mmol / L Tris-HCl solution to each tube, vortex to mix, and centrifuge at 3000rpm for 1min.
[0081] 2) PCR amplification:
[0082] Primer information (same as above):
[0083] Upstream primer: 5'-AGTGAGGAGAGTGTGCTTGC-3' (SEQ ID NO. 6);
[0084] Downstream primer: 5'-TGGCTCAGCACTTGGATGTC-3' (SEQ ID NO. 7).
[0085] The PCR reaction system is shown in Table 3.
[0086] Table 3 PCR reaction system
[0087]
[0088]
[0089] Note: *2X Rapid Taq Master Mix (Vazyme, P222-03)
[0090] The PCR cycle conditions are shown in Table 4.
[0091] Table 4 PCR cycle conditions
[0092]
[0093] The horizontal electrophoresis detection results are the same as before
[0094] The PCR product gene sequencing is the same as before.
[0095] The peak shape chart near the mutation site of the wild-type mouse is shown in Figure 4 .
[0096] The peak shape chart near the mutation site of the Lrp5 A241T heterozygote mouse is shown in Figure 5 .
[0097] Example 2
[0098] Lrp5 A241T mice of 4, 8, 12, and 16 weeks of age were collected, and wild-type mice were used as controls, with 6 mice in each group. The height and weight were measured and compared, and the femur, fifth lumbar vertebra, skull, and tibia were collected. The bone morphological characteristics were detected by microCT, the femur shaft, skull cortical thickness, and bone mineral density (BMD, BV / TV) of the distal femur and fifth lumbar vertebra were measured, and the bone trabecular parameters (Tb.Th, Tb.N, etc.) were measured. The mechanical strength of the tibia was detected by three-point bending test. The results showed that although there was no significant difference in height and weight, the Lrp5 A241T mice had high bone mass performance, and the tibia had stronger resistance to fracture. For details, see Figure 6-9 . From Figure 6As shown in the following, there is no significant difference in height and weight between Lrp5 A241T mice and wild-type mice, but there is a gender difference, with males being higher than females, A / + : Lrp5 A241T heterozygous mice; + / + : wild-type mice. Figure 7 As shown in the following, the lumbar vertebrae bone density of LRP5 A241T mice is higher than that of wild-type mice, A. MicroCT images of the fifth lumbar vertebrae of 16-week-old male mice show that the bone cortex of the mutant group is thicker, and the cone bone density is higher; B, C. The BV / TV and BMD of the fifth lumbar vertebrae cone show that the mutant group is higher than the control group after 8 weeks. Figure 8 As shown in the following, the distal femur bone density of LRP5 A241T mice is higher than that of wild-type mice, A. MicroCT images of the distal femur of 16-week-old male mice; B. The trabecular bone thickness of the distal femur of the mutant group is higher than that of the control group; C, D. The BV / TV and BMD of the distal femur show that the mutant group is higher than the control group after 8 weeks. Figure 9 As shown in the following, the femur cortical thickness and tibia mechanical strength of LRP5 A241T mice are higher, A. MicroCT images of the femur cross section of 16-week-old male mice; B. The bone cortex thickness of the femur gradually thickens with age, and the mutant group is higher than the control group, and the male is higher than the female; C. The ultimate load of the tibia of the mutant group mice is higher than that of the control group.
[0099] In summary, the present application successfully constructs a Lrp5 A241T gene point mutation heterozygous mouse using CRISPR / Cas9 technology and homologous recombination, which is the first LRP5 point mutation mouse constructed, and the CRISPR / Cas9 technology has the advantages of short technical cycle and high efficiency.
[0100] Although the above embodiment describes the present application in detail, it is only a part of the embodiments of the present application, not all embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which are within the protection scope of the present application.
Claims
1. A method for constructing a high bone mass mouse model with an Lrp5 A241T gene point mutation, comprising the following steps: Cas9 mRNA, Donor DNA, and guide RNA were mixed and microinjected into fertilized eggs of donor mice. The microinjected fertilized eggs were then transplanted into pseudopregnant female mice to reproduce offspring, creating a high bone mass mouse model with the Lrp5A241T gene point mutation. The nucleotide sequence of the Donor DNA is shown in SEQ ID NO.1; The nucleotide sequence of the guideRNA is shown in SEQ ID NO.
2.
2. The method according to claim 1, characterized in that The breeding of offspring includes genotyping the F0 generation mice obtained by breeding, selecting positive mice carrying the A241T mutation and mating them with wild-type mice to obtain F1 generation heterozygous mice that stably inherit the Lrp5 A241T mutation.
3. The method according to claim 2, characterized in that The wild-type mice include C57BL / 6J mice.
4. The method according to claim 1, wherein The donor mice include C57BL / 6J mice.
5. Use of the Lrp5 A241T gene point mutation high bone mass mouse model obtained by the method according to any one of claims 1 to 4 in the study of the high bone mass formation mechanism associated with the Lrp5 A241T gene point mutation and osteoporosis therapeutic drugs.
6. A kit for preparing a high bone mass mouse model with Lrp5 A241T gene point mutation based on CRISPR / Cas9 technology, characterized in that: The kit includes a guide RNA that recognizes the Lrp5 exon4 target site region, and the nucleotide sequence of the guide RNA is shown in SEQ ID NO.2; the nucleotide sequence of the Lrp5 exon4 is shown in SEQ ID NO.3; the kit also includes Cas9 mRNA and Donor DNA; the nucleotide sequence of the Donor DNA is shown in SEQ ID NO.1.