Markers for early onset schizophrenia and uses thereof

Abstract

The present application belongs to the field of molecular diagnosis, and particularly relates to a molecular marker for detecting early-onset schizophrenia and application thereof. The present application provides a composition for detecting early-onset schizophrenia, which comprises a detection reagent for detecting the expression level of lncRNA as shown in SEQ ID NO. 1. Using the composition of the present application, the specificity of the diagnosis of early-onset schizophrenia is 100%, the sensitivity is 90%, and the area under the curve (AUC) is 96.7%, which shows good diagnostic efficiency.

Description

Technical Field

[0001] This invention belongs to the field of molecular diagnostics, specifically relating to a molecular biomarker for detecting early-onset schizophrenia and its application. Background Technology

[0002] Schizophrenia is one of the most common severe mental illnesses in clinical practice, seriously endangering human physical and mental health and imposing a heavy burden on families and society. Early-onset schizophrenia (EOS) specifically refers to schizophrenia that begins before the age of 18. Compared to adult schizophrenia patients, early-onset schizophrenia patients exhibit more significant prodromal neurodevelopmental abnormalities, a greater family genetic burden, and a worse long-term prognosis.

[0003] Currently, diagnostic systems relying solely on symptomatology remain the gold standard for diagnosing schizophrenia, such as the Diagnostic and Statistical Manual of Mental Disorders (DSM-5) and the International Classification of Diseases (ICD-10). However, this diagnostic method still primarily depends on clinical interviews with psychiatrists and lacks objective physiological, biochemical, and pathological indicators; the evaluation of treatment efficacy is also mainly based on changes in symptomatology, and this rather subjective judgment is highly prone to misdiagnosis and missed diagnosis.

[0004] Obtaining brain tissue from living patients with schizophrenia is difficult, and even if biological changes are found in the central nervous system, it is difficult to apply them clinically. However, disease-related molecular markers can detach from tissues or cells and enter the bloodstream as the disease progresses. The central nervous system can also influence gene expression in peripheral blood through cytokines, neurotransmitters, hormones, and even exosomes.

[0005] While previous studies have explored molecular markers for the diagnosis and treatment assessment of early-onset schizophrenia based on genes in plasma and serum, including non-coding RNAs such as miRNAs and circRNAs, research has revealed that most miRNAs in circulating plasma are found in exosomes and microvesicles, rather than in plasma lacking extracellular vesicles. Furthermore, the exosome membrane effectively protects internal non-coding RNAs from RNase, making exosome-derived non-coding RNAs more reliable than circulating non-coding RNAs in blood and other bodily fluids, thus possessing greater potential for diagnostic molecular marker applications. Numerous studies have reported that under pathological conditions, the expression levels of many exosomal lncRNAs differ significantly from those in normal controls, indicating that exosomes can selectively package, secrete, and transport lncRNAs, and specifically perform their biological functions.

[0006] Therefore, there is a need in the art for a lncRNA biomarker that can be used for the early diagnosis of early-onset schizophrenia with high sensitivity and specificity. Summary of the Invention

[0007] In view of this, in a first aspect, the present invention provides a composition for detecting early-onset schizophrenia, comprising a detection reagent for detecting the expression level of lncRNA as shown in SEQ ID NO.1.

[0008] The lncRNA described in this invention has the UCSC ID ENST00000653358, and its specific sequence is as follows:

[0009] CAGGCAUGAGCCACCGCGCCCAGCCAAAAUAGUUUCUUUAACAUAACCAUGCUUAUACCAAUGCAGUACUAAAAUAUAAUUUGUAUAUAUUUUCAUGAAGGAAGGGACCCACAAAGGCAAGUGCCUAGGACCCACACAAAUCACAGUGUGGCUCUUGCUCCAACCAUGGGAGAAGCCACAGAAGAGCAUUCCAGGCAGAGGGCACGGCAAGUGCAAAGGUUCUGAGGUGGGAAUGAGCUGGACAUGUUUGAGAAACAGCAAGAAGGACCUCAAGUGAGCCCACAUUGGCAGUGACAAUCAGAAUGUCAAAAUGUCUCAGAGGAUUUCUAGGAAAUCUGUGGCACUUCACGAAGAGGCUGCCCCGGGUGAGAGACCAGCCAGAGUGAAUCGUUAAUACACUUCCCAGGAAGGGGGAUUCUUCUGAAAUGCUAAUACAAUCAACUGCAAGGCAAACUUCAAGCUUCUUUUUCAGUGAUCAGAGAGGCCCUCCCAGAGCAAGGAUGCUCUCCACUGUGCAAGCUAAAGGCCCUACUUUCUCACCCAGCCUUUUCUGGGGAGGAGAAACACAUCCUCACCACAUUGCAGCUGCCCUGCGAGGGCUGCAGGUAUUGUGUGUCCCCACCAGCCAGGGCAGUUCCCAGACAGACUCUGGCUGCCUGGACCCAGGUCUGCUCCAAGGAAGCAGCACGUUUCUGGAGGAGGCUUAGCCAAGAAACCAUUACGGAGUGAGAGAGGAGUUAUCUGGAUAAAUGCGGAACUGCCCAACUCCUAGCAUUUGUUCCUGGGACCCAGGCUGUAACAUCCUCUG GAGCCAAACUGCCUCUGUUCAAACCCUUGUCCCCGCACUCCACCUCCUAGCUGUGUGGCACUG(SEQ ID NO.1).

[0010] Using the composition of the present invention, the specificity of the diagnosis of early-onset schizophrenia is 100%, the sensitivity is 90%, and its area under the curve (AUC) is 96.7%, showing good diagnostic efficacy.

[0011] In some specific implementations, the expression level is measured by amplification-sequencing, microarray, or quantitative real-time PCR.

[0012] In some specific implementations, the detection reagents include, but are not limited to, nucleic acid primers and sequencing tag sequences, used to measure expression levels by amplification-sequencing.

[0013] In some specific implementations, the detection reagents include, but are not limited to, chips, specifically gene expression profiling chips, which have probes that specifically bind to mRNA and lncRNA.

[0014] In some specific implementations, the detection reagents include, but are not limited to, nucleic acid primers and / or nucleic acid probes, for measuring expression levels by quantitative real-time PCR.

[0015] Furthermore, the detection reagent also includes internal standard primers and internal standard probes.

[0016] Furthermore, the above composition may further include other reagents, specifically, for example, various reagents required for sample pretreatment or conditioning. For example, nucleic acid release agents for extracting lncRNA from samples.

[0017] In some specific implementation schemes, the detection reagents are as shown in Table 1:

[0018] Table 1

[0019]

[0020] Secondly, the present invention provides the use of the above-described composition in the preparation of a kit for detecting early-onset schizophrenia.

[0021] Furthermore, the present invention provides the use of the above composition in the preparation of a kit for detecting early-onset schizophrenia using blood nucleic acid.

[0022] In some specific implementations, the blood nucleic acid refers to free nucleic acid in the blood, nucleic acid in peripheral blood, nucleic acid in plasma, nucleic acid in serum, and nucleic acid in blood exosomes.

[0023] In some specific implementations, the nucleic acid is lncRNA.

[0024] Thirdly, the present invention provides a kit for diagnosing early-onset schizophrenia, comprising 1) the composition as described above; and 2) an instruction manual including instructions for diagnosing early-onset schizophrenia using the composition.

[0025] In some specific implementations, the diagnosis of early-onset schizophrenia is described as follows: based on the results of qPCR validation in independent samples, the Ct value range is 27-32, and the Ct value range for patients with early-onset schizophrenia is 32-36. Therefore, a Ct value of 32 can be used as a diagnostic criterion, and a value greater than 32 indicates early-onset schizophrenia.

[0026] In some specific implementation schemes, the diagnosis of early-onset schizophrenia is explained as follows: based on the results of qPCR validation in independent samples, the Ct value range in peripheral blood exosomes of healthy adolescents is 27-32, and the Ct value range in patients with early-onset schizophrenia is 32-36. Therefore, a Ct value of 32 can be used as a diagnostic criterion, and a value greater than 32 indicates early-onset schizophrenia.

[0027] Fourthly, the present invention provides a method for detecting the expression level of the above-mentioned molecular markers in peripheral plasma, comprising the following steps:

[0028] 1) Collect peripheral blood plasma samples;

[0029] 2) Extract exosomes and total RNA;

[0030] 3) Use the above composition to detect the expression level of the molecular marker.

[0031] Step 3) can be RNA whole transcriptome sequencing, microarray, or qPCR.

[0032] Furthermore, the present invention provides a method for detecting the expression level of the above-mentioned molecular markers in a sample for non-diagnostic purposes, comprising the following steps:

[0033] 1) Collect peripheral blood plasma samples;

[0034] 2) Extract exosomes and total RNA;

[0035] 3) Use the above composition to detect the expression level of the molecular marker.

[0036] Step 3) can be RNA whole transcriptome sequencing, microarray, or qPCR. Attached Figure Description

[0037] Figure 1 Figure showing the expression level of ENST00000653358 in early-onset schizophrenia as revealed by transcriptome sequencing;

[0038] Figure 2 The graph shows the diagnostic efficacy assessment results for ENST00000653358.

[0039] Figure 3Figure showing the expression level of ENST00000653358 in non-early-onset schizophrenia as revealed by transcriptome sequencing. Detailed Implementation

[0040] The present invention will be described in detail below with reference to specific implementation schemes and embodiments, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific implementation schemes and embodiments are for illustrative purposes only and are not intended to limit the present invention.

[0041] Example 1: Method for detecting early-onset schizophrenia

[0042] 1. Isolation of exosomes

[0043] Plasma exosomes were separated using ultracentrifugation, and the steps are as follows:

[0044] 1) Samples were rapidly melted at 37°C.

[0045] 2) Transfer the sample to a new centrifuge tube and centrifuge at 2000×g, 4℃, for 30 min.

[0046] 3) Carefully transfer the supernatant to a new centrifuge tube and centrifuge again at 10,000×g, 4℃, for 45 min to remove larger vesicles.

[0047] 4) Take the supernatant, filter it through a 0.45μm filter membrane, and collect the filtrate.

[0048] 5) Transfer the filtrate to a new centrifuge tube, select an ultracentrifuge rotor, and centrifuge at 100,000×g for 70 min at 4°C.

[0049] 6) Remove the supernatant, resuspend in 10 mL of pre-cooled 1×PBS, select an ultracentrifuge rotor, and centrifuge again at 4°C, 100,000×g for 70 min.

[0050] 7) Remove the supernatant, resuspend in 150 μL of pre-cooled 1×PBS, take 20 μL for electron microscopy, 10 μL for particle size analysis, 20 μL for fluorescence analysis, and 10 μL for protein extraction. Store the remaining exosomes at -80℃.

[0051] 2. Exosome identification

[0052] 2.1 Transmission electron microscopy observation

[0053] 1) Take 10 μL of exosomes.

[0054] 2) Take 10 μL of sample and add it to the copper grid to precipitate for 1 min, then use filter paper to absorb the floating liquid.

[0055] 3) Add 10 μL of uranium acetate to a copper grid to precipitate for 1 min, and then use filter paper to absorb the floating liquid.

[0056] 4) Dry at room temperature for several minutes.

[0057] 5) Electron microscopy was performed at 100 kV for detection and imaging.

[0058] 6) Obtain transmission electron microscopy imaging results.

[0059] 2.2 Particle Size Analysis

[0060] 1) Take 10 μL of exosomes and dilute it to 30 μL.

[0061] 2) Exosome samples should only be loaded after the instrument performance has been tested and approved using standard samples. Note that serial dilution is necessary to avoid clogging the injection needle. Shanghai Decoding Life Sciences Research Institute

[0062] 3) Once the sample is tested, the particle size and concentration information of the exosomes detected by the instrument can be obtained.

[0063] 2.3 Western Blot (WB) Protein Index Detection

[0064] 1) Melt the exosomes at 37°C at a moderate speed and then quickly add 5× RIPA lysis buffer.

[0065] 2) After mixing, pyrolyze on ice for 30 minutes, mixing during the process.

[0066] 3) Prepare a standard sample for protein concentration determination by BCA method, and add 5 μL of the sample to the BCA mixture and mix well.

[0067] 4) Incubate at 37℃ for 30 min, and detect and record the absorbance at OD562 nm using an ELISA reader.

[0068] 5) Calculate the protein concentration of the sample to be tested based on the standard curve.

[0069] 6) Prepare an SDS-PAGE gel with a concentration of 10% or 15% according to the size of the protein in the sample to be tested; after assembling the electrophoresis apparatus, add an appropriate amount of running buffer.

[0070] 7) Remove the protein sample, boil it in a constant temperature metal bath for 3-5 minutes, centrifuge and drop it; add the protein sample and protein marker to the wells on the electrophoresis gel in the required order using a pipette or sample needle.

[0071] 8) Cover the tank, turn on the power, run the gel at 80V until the sample comes out of the stacking gel, then switch to 100V and run the gel until the bromophenol blue reaches the bottom of the gel.

[0072] 9) After electrophoresis, remove the electrophoresis gel, trim the size of the gel, cut off the edges and excess parts, and mark the lower left corner; according to the size of the trimmed gel, cut the PVDF membrane to the corresponding size, mark the lower left corner, activate it in an appropriate amount of methanol for 20 seconds, and then soak it in pre-cooled transfer buffer.

[0073] 10) Take 8 sheets of filter paper and cut them into 8cm×10cm sizes. Soak them in pre-cooled transfer buffer. Make the transfer "sandwich" in the order of sponge-filter paper-electrophoresis gel-membrane-filter paper-sponge.

[0074] 11) Add the transfer buffer to the tank, assemble the transfer device, add floating ice, bury the device in an ice bath or place it in a refrigerator, turn on the power, and transfer at 300mA. The transfer time is determined according to the size of the protein to be detected, and the general rule is 1kd = 1min.

[0075] 12) After the transfer is complete, remove the PVDF membrane and immerse it in 5% skim milk TBST with the protein side facing up for 1 hour.

[0076] 13) Primary antibody blocking: Cut the membrane after milk blocking as needed, immerse the membrane in the prepared primary antibody solution (antibody dilution ratio is 1:1000), and incubate overnight at 4°C.

[0077] 14) Recover the primary antibody, wash the membrane with 20 mL TBST at room temperature for 10 min, and repeat three times.

[0078] 15) Select the secondary antibody based on the primary antibody. Prepare the secondary antibody at a ratio of 1:5000 in 5% skim milk TBST solution. Immerse the membrane in the secondary antibody solution and incubate at room temperature for about 1 hour.

[0079] 16) Recover the secondary antibody, wash the membrane with 20 mL TBST at room temperature for 10 min, and repeat three times.

[0080] 17) Take out the PVDF membrane, drain the water, and lay it flat on the plastic wrap with the protein side facing up. Add an equal volume of ECL A / B solution to the membrane and react in the dark for 5 minutes. Then, clamp the membrane and transfer it into the plastic wrap, with the protein side always facing up.

[0081] 18) Place the film in the imager, set the parameters, and start the exposure; adjust the brightness and contrast, and save the image.

[0082] 2.4 Fluorescent labeling and nanoflow cytometry detection

[0083] 1) Dilute 20 μL of exosomes to 60 μL, take 30 μL of diluted exosomes and add 20 μL of fluorescently labeled antibodies (IgG, CD9, CD63), mix well and incubate at 37°C for 30 min in the dark.

[0084] 2) Add 1 mL of pre-cooled PBS, select the ultracentrifuge rotor, 4℃, 110,000×g, ultracentrifuge for 70 min.

[0085] 3) Carefully remove the supernatant, add 1 mL of pre-cooled PBS, select the ultracentrifuge rotor, and centrifuge again at 4°C, 110,000×g for 70 min.

[0086] 4) Carefully remove the supernatant and resuspend in 50 μL of pre-cooled 1×PBS.

[0087] 5) Exosome samples can only be loaded after the instrument performance test with standard products is qualified. Note that serial dilution is required to avoid sample clogging of the injection needle.

[0088] 6) Once the sample has been tested, the protein index results detected by the NanoFCM instrument will be available.

[0089] 2.5 RNA extraction and concentration determination

[0090] 2.5.1 RNA Extraction

[0091] 1) After thawing the RNA lysis buffer, incubate at room temperature for 5 minutes.

[0092] 2) Add 140 μL of chloroform and vortex mix for 15 seconds.

[0093] 3) Incubate at room temperature for 3 minutes, then centrifuge at 4°C, 12000g for 15 minutes (pre-cool the centrifuge beforehand, and immediately return it to room temperature after this step).

[0094] 4) Transfer the upper aqueous phase to a new EP tube (avoid aspirating the middle layer), add 1.5 times the volume of anhydrous ethanol (usually 525 μL), and mix by pipetting.

[0095] 5) Take 700 μL of the mixture (including all precipitates), transfer it to an RNeasy adsorption column, centrifuge at 8000g for 15s at room temperature, discard the filtrate (reuse the collection tube, the same below), and repeat the same step for the remaining mixture.

[0096] 6) Add 700 μL Buffer RWT to wash the adsorption column, centrifuge at 8000g for 15s at room temperature, and discard the filtrate.

[0097] 7) Add 500 μL of Buffer RPE to wash the adsorption column, centrifuge at 8000g for 15s at room temperature, and discard the filtrate.

[0098] 8) Add 500 μL of Buffer RPE to wash the adsorption column, centrifuge at 8000g for 2 min at room temperature, and discard the filtrate and collection tube (carefully remove the column to avoid touching the filtrate and residual alcohol).

[0099] 9) Transfer the adsorption column to a new 2mL centrifuge tube (self-provided), centrifuge at 12000g for 1min to dry, and discard the filtrate and collection tube.

[0100] 10) Transfer the adsorption column to a new 1.5 mL centrifuge tube, add 30 μL of RNase-free water to the middle of the adsorption membrane, centrifuge at 8000g for 1 min, and elute the RNA.

[0101] 11) Immediately transfer to a -80℃ freezer for storage and register the sample information.

[0102] 2.5.2 RNA Concentration Measurement

[0103] Take 1 μL of each extracted RNA sample, stain it, and measure the RNA concentration using a Quantus Fluorometer.

[0104] 2.6 RNA Qsep100 Detection

[0105] Based on the RNA concentration, take an appropriate amount of the stock RNA solution and dilute it with the diluent provided with the NR1 card holder. After dilution, perform the analysis on the instrument. RNA that passes the quality inspection can be used for subsequent lncRNA detection.

[0106] Subsequent detection of lncRNA with UCSC ID ENST00000653358 can be divided into three methods:

[0107] 1. Transcriptome sequencing method for detection

[0108] a) The extracted Total RNA was used to construct a library using a micro-sample strand specific kit. The concentration of the constructed library was detected using a Qubit 2.0 Fluorometer and the size of the library fragments was detected using an Agilent 2100.

[0109] b) Sequencing. After the libraries pass the initial screening, different libraries are pooled according to the effective concentration and target data volume requirements before Illumina sequencing. The basic principle of sequencing is sequencing by synthesis. Four fluorescently labeled dNTPs, DNA polymerase, and adapter primers are added to the sequencing flow cell for amplification. During the extension of the complementary strand of each sequencing cluster, each added fluorescently labeled dNTP releases corresponding fluorescence. The sequencer captures the fluorescence signal and converts it into sequencing peaks using computer software, thereby obtaining the sequence information of the target fragment.

[0110] c) Raw data quality control. The raw sequencing data may contain a small number of reads containing adapter information, low-quality bases, or undetected bases. To ensure the quality of information analysis, raw reads need to be finely filtered to obtain clean reads. Subsequent analyses are based on these clean reads. Data processing uses Fastp software.

[0111] The data processing steps are as follows:

[0112] (1) Remove read pairs with adapters;

[0113] (2) When the proportion of N (N means that the base information cannot be determined) in a single-end sequencing read is greater than 10%, this read pair needs to be removed;

[0114] (3) When the number of low-quality (less than 5) bases in a single-end sequencing read exceeds 50% of the length of the read, the read pair needs to be removed.

[0115] d) Reference genome alignment

[0116] Read alignment was performed using the HISAT2 software based on the Ensembl release 102GRCh38 version of the reference genome.

[0117] e) lncRNA identification and quantification

[0118] Transcripts were constructed using Stringtie software with alignment files. The transcripts were compared with human genome annotation files using gffcompare to obtain annotated and candidate lncRNA transcripts. Transcripts longer than 200 nt were selected as candidate lncRNA transcripts. The coding capacity of lncRNAs was predicted using four software programs: CPC2, CNCI, Pfam, and FEElc. Transcripts predicted as coding by at least three software programs were filtered to obtain new lncRNAs. lncRNAs (known and unknown) were quantified and annotated using featureCounts.

[0119] f) Differential expression analysis of lncRNA

[0120] Differential lncRNA analysis between samples was performed using DESeq2.

[0121] g) ROC curve

[0122] Use the pROC package in R software to plot ROC curves. The results are as follows: Figure 2As shown, the lncRNA with AUC=0.967, specificity 100%, sensitivity 90%, and UCSC ID ENST00000653358 can distinguish between patients with early-onset schizophrenia and typical adolescents.

[0123] 2. lncRNA microarray method for detection

[0124] a) Perform lncRNA detection according to the Arraystar Human LncRNA Expression Array V5.0 or the instructions for the customized chip. The steps are briefly described as follows: cDNA synthesis; Cy3 labeling; chip hybridization, cleaning and scanning; data extraction.

[0125] b) Calculate the expression level of lncRNA with UCSC ID ENST00000653358 in different samples and perform statistical analysis.

[0126] 3. Detection using qPCR method

[0127] (a) The extracted Total RNA was reverse transcribed into cDNA using random primers;

[0128] (b) Prepare the qPCR reaction system according to the following system:

[0129]

[0130]

[0131] (c) Perform the qPCR reaction according to the following procedure:

[0132] 95℃ for 30 seconds

[0133]

[0134] Melting curve

[0135] (d) Calculate the Ct value of the lncRNA with UCSC ID ENST00000653358 and calculate the relative expression level.

[0136] Example 2: Detection results of test samples of the composition of the present invention

[0137] Following the method described in Example 1, transcriptome sequencing revealed that the expression level of exosome ENST00000653358 was significantly lower in EOS patients than in the control group. Specifically... Figure 1 As shown.

[0138] Furthermore, the inventors verified its detection results on samples. The efficacy of ENST00000653358 in distinguishing between controls and EOS patients was evaluated using receiver operating characteristic (ROC) curve analysis. According to the analysis results, ENST00000653358 demonstrated a diagnostic specificity of 100%, a sensitivity of 90%, and an area under the line (AUC) of 96.7%, exhibiting good diagnostic efficacy. Specific results are as follows... Figure 2 As shown.

[0139] In addition, we used SYBR Green I-based qPCR to detect the expression level of ENST00000653358 in peripheral blood exosomes of 6 adolescents (under 18 years old). One adolescent had a Ct value of ENST00000653358 greater than 32, which initially led to a diagnosis of early-onset schizophrenia. After evaluation by clinicians, it was confirmed that the adolescent had early-onset schizophrenia.

[0140] Comparative Example 1: Detection results of the composition of the present invention in non-early-onset schizophrenia.

[0141] We collected samples from patients with common schizophrenia (SCZ) and detected the expression level of lncRNA with UCSC ID ENST00000653358. The results showed that the expression level of ENST00000653358 in SCZ patients was not different from that in control samples (P>0.05). Furthermore, the inventors validated the samples, demonstrating that the composition of this invention cannot be used to identify non-early-onset schizophrenia.

Claims

1. Use of a composition for detecting early-onset schizophrenia in the manufacture of a kit for detecting early-onset schizophrenia, characterized in that, The composition comprises a detection reagent for detecting the expression level of the lncRNA as shown in SEQ ID NO. 1 in plasma exosomes.

2. Use according to claim 1, characterized in that, The expression level is measured by means of amplification-sequencing, chip, or fluorescent quantitative PCR.

3. Use according to claim 1, characterized in that, The detection reagent is a primer pair as shown in SEQ ID NO. 2-3.

4. Use according to claim 1, characterized in that, The composition further comprises reagents required for pretreatment or pre-treatment of the sample.

5. Use according to claim 1, characterized in that, The diagnosis of early-onset schizophrenia is as follows: according to the result of qPCR, if the Ct value is greater than 32, it is an early-onset schizophrenia patient.

Images