Markers for detecting colorectal cancer and their applications

Abstract

This invention relates to markers for detecting colorectal cancer, and also to the application of said markers in the detection of colorectal cancer, as well as related kits and detection methods.

Description

[0001] This application is a divisional application. The original application has the application number 202110033240.1 (201410403598.9), the application date is August 15, 2014, and the invention title is "Marker for detecting colorectal cancer and its application". Technical Field

[0002] This invention belongs to the fields of biology and medical testing, and relates to markers for detecting colorectal cancer, as well as the application of said markers in the detection of colorectal cancer and related reagent kits and detection methods. Background Technology

[0003] Colorectal cancer is a common malignant tumor of the digestive tract, ranking second among gastrointestinal tumors. It most commonly occurs in the rectum and the junction of the rectum and sigmoid colon, accounting for 60% of cases. With changes in lifestyle and dietary structure, the incidence and mortality rates of colorectal cancer are increasing year by year, with onset mostly after age 40, and a male-to-female ratio of 2:1. Currently, methods for early diagnosis of colorectal cancer include fecal occult blood test (FOBT), colonoscopy, fecal DNA mutation detection, fecal RNA-specific gene detection, and double-contrast barium enema (DCBE). Colonoscopy is considered the gold standard for diagnosing colorectal cancer; however, it is an invasive procedure requiring bowel preparation, carries risks of complications such as bleeding and perforation, has low patient acceptance, and is costly. While fecal occult blood test is non-invasive, the results are easily affected by factors such as diet, and its sensitivity and specificity for screening for colorectal cancer are not ideal.

[0004] Mature microRNAs (miRNAs) are single-stranded RNAs that do not encode proteins, consisting of 18-24 bases. They bind to their corresponding mRNAs, leading to mRNA degradation or silencing, thereby regulating genes. Recent studies have shown that specific expression of miRNAs is related to tumorigenesis and development; some miRNAs can even function as tumor suppressor genes or oncogenes. Cyclooxygenase (COX) is a crucial rate-limiting enzyme in prostaglandin synthesis. COX2 is not expressed in normal tissues but can be induced under various stimuli, hence it is also known as an inducible early response gene. It is closely related to tumor occurrence and development. Recent studies have found that COX2 is overexpressed in most head and neck tumors, and Cox2 is also one of the biomarkers for colorectal cancer. Therefore, developing corresponding colorectal cancer kits for application in scientific research will greatly promote colorectal cancer screening research and the translation of research results, significantly advancing the diagnosis and treatment of colorectal cancer. Summary of the Invention

[0005] The inventors have discovered that the upregulation of miRNA-92a, miRNA-135b, miRNA-18a, miRNA-221, miRNA-19, miRNA-223, and miRNA-301a is associated with the occurrence and development of various human tumors (such as colorectal cancer), suggesting that detecting the expression of miRNA-92a, miRNA-135b, miRNA-18a, miRNA-221, miRNA-19, miRNA-223, and miRNA-301a in feces and serum could be used as an indicator for the detection of tumors such as colorectal cancer.

[0006] This invention provides primers, probes, and kits for detecting colorectal cancer (especially nucleic acids and detection methods for detecting fecal and serum miRNA-92a, miRNA-135b, miRNA-18a, miRNA-221, miRNA-19, miRNA-223, miRNA-301a, and COX2).

[0007] This invention includes the following technical solutions:

[0008] 1. A colorectal cancer detection kit comprising primers and / or probes selected from those shown in SEQ ID NO:9-27.

[0009] 2. The kit described in 1 above, comprising one or more primers selected from those shown in SEQ ID NO:9-15.

[0010] 3. The kit described in 1 or 2 above, comprising the primer shown in SEQ ID NO:23.

[0011] 4. The kit described in any one of 1-3 above, comprising the probe shown in SEQ ID NO:24 and / or 27.

[0012] 5. The kit described in any one of 1-4 above, comprising one or more primers selected from those shown in SEQ ID NO:16-22 and 25-26.

[0013] 6. The kit described in any one of 1-5 above, comprising one or more sets of primers and probes selected from the following:

[0014] SEQ ID NO: 9, 16, 23 and 24;

[0015] SEQ ID NO: 10, 17, 23 and 24;

[0016] SEQ ID NO: 11, 18, 23 and 24;

[0017] SEQ ID NO: 12, 19, 23 and 24;

[0018] SEQ ID NO: 13, 20, 23 and 24;

[0019] SEQ ID NO: 14, 21, 23 and 24;

[0020] SEQ ID NO:15, 22, 23 and 24; and

[0021] SEQ ID NO:25-27.

[0022] 7. The kit according to any one of 1-6 above, wherein the probe is fluorescently labeled.

[0023] 8. The kit described in 7 above, wherein the 5' of the probe is labeled with FAM and the 3' of the probe is labeled with TAMRM.

[0024] 9. Use of the reagent in the preparation of a colorectal cancer detection kit, wherein the reagent is used to determine one or more markers selected from the group consisting of miRNA-92a, miRNA-135b, miRNA-18a, miRNA-221, miRNA-19, miRNA-223, miRNA-301a and COX2, wherein the reagent is preferably selected from one or more primers and / or probes shown in SEQ ID NO:9-27.

[0025] 10. A method for detecting colorectal cancer, comprising detecting the level of one or more markers selected from the following in a sample: miRNA-92a, miRNA-135b, miRNA-18a, miRNA-221, miRNA-19, miRNA-223, miRNA-301a, and COX2, wherein the sample is preferably a fecal and / or serum sample, and the markers are preferably detected using one or more primers and / or probes selected from those shown in SEQ ID NO:9-27.

[0026] The kit and method of this invention employ the design method of the TaqMan hydrolysis probe technique. Figure 1 In addition to a pair of specific primers, a gene-specific probe (typically 20-30 bp) complementary to the template is added using the TaqMan probe method, resulting in high specificity. Furthermore, a fluorescent reporter group can be labeled at the 5' and 3' ends of the probe to enhance sensitivity. The primers, probes, kits, and methods of this invention are suitable for the detection and diagnosis of colorectal cancer patients.

[0027] Primers and probes preferred for colorectal cancer detection are:

[0028] (1) The reverse transcription primers, probes, and detection primers used to detect miR-92a are shown below:

[0029] miRNA-92a-RT (reverse transcription primer):

[0030] 5'-GCTCAACCAGTGAGGCGTCCACGCCTGCCGTTCGCACTGGATGCACTGGTTGAGCCAGGCC-3';

[0031] miRNA-92a-F:

[0032] 5'-CTGCTGCTATTGCACTTGTCC-3';

[0033] Universal downstream primer (miRNA-92a-R):

[0034] 5'-GCTCAACCAGGTGAGGCGTC-3';

[0035] Universal probe (miRNA-92a-B):

[0036] 5'-CGCCTGCCGTTCGCACTGGAT-3';

[0037] (2) The reverse transcription primers, probes, and detection primers used to detect miRNA-135b are shown below:

[0038] miRNA-135b-RT (reverse transcription primer):

[0039] 5'-GCTCAACCAGTGAGGCGTCCACGCCTGCCGTTCGCACTGGATGCACTGGTTGAGCTCACAT-3';

[0040] miRNA-135b-F:

[0041] 5'-TGCTGCTATGGCTTTTCATTCCT-3';

[0042] Universal downstream primer (miRNA-135b-R):

[0043] 5'-GCTCAACCAGTGAGGCGTC-3';

[0044] Universal probe (miRNA-135b-B):

[0045] 5'-CGCCTGCCGTTCGCACTGGAT-3';

[0046] (3) The reverse transcription primers, probes and detection primers used to detect miRNA-18a are shown below;

[0047] miRNA-18a-RT (reverse transcription primer):

[0048] 5'-GCTCAACCAGTGAGGCGTCCACGCCTGCCGTTCGCACTGGATGCACTGGTTGAGCCTATCT-3';

[0049] miRNA-18a-F (upstream primer for detection):

[0050] 5'-CTGCTGTAAGGTGCATCTAGTGC-3';

[0051] Universal downstream primer (miRNA-18a-R):

[0052] 5'-GCTCAACCAGTGAGGCGTC-3';

[0053] Universal probe (miRNA-18a-B):

[0054] 5'-CGCCTGCCGTTCGCACTGGAT-3';

[0055] (4) The reverse transcription primers, probes, and detection primers used to detect miR-221 are shown below:

[0056] miR-221-RT (reverse transcription primer):

[0057] 5'-GCTCAACCAGTGAGGCGTCCACGCCTGCCGTTCGCACTGGATGCACTGGTTGAGCGAAACC-3';

[0058] miR-221-F (upstream primer):

[0059] 5'-GCTGCAGCTACATTGTCCTGCTG-3';

[0060] Universal downstream primer (miR-221-R):

[0061] 5'-GCTCAACCAGTGAGGCGTC-3';

[0062] Universal probe (miR-221-B):

[0063] 5'-CGCCTGCCGTTCGCACTGGAT-3';

[0064] (5) The reverse transcription primers, probes, and detection primers used to detect miRNA-19 are shown below:

[0065] miRNA-19-RT (reverse transcription primer):

[0066] 5'-GCTCAACCAGTGAGGCGTCCACGCCTGCCGTTCGCACTGGATGCACTGGTTGAGCTCAGTT-3';

[0067] miRNA-19-F (upstream primer): 5'-TGCTGCTGTGCAAATCTATGCAA-3';

[0068] Universal downstream primer (miRNA-19-R): 5'-GCTCAACCAGTGAGGCGTC-3';

[0069] Universal probe (miRNA-19-B):

[0070] 5'-CGCCTGCCGTTCGCACTGGAT-3';

[0071] (6) The reverse transcription primers, probes, and detection primers used to detect miRNA-223 are shown below:

[0072] miRNA-223-RT (reverse transcription primer):

[0073] 5'-GCTCAACCAGTGAGGCGTCCACGCCTGCCGTTCGCACTGGATGCACTGGTTGAGCTGGGGT-3';

[0074] miRNA-223-F (upstream primer): 5'-CTGCTGCTGTCAGTTTGTCAAAT-3';

[0075] Universal downstream primer (miRNA-223-R): 5'-GCTCAACCAGTGAGGCGTC-3';

[0076] Universal probe (miRNA-223-B):

[0077] 5'-CGCCTGCCGTTCGCACTGGAT-3';

[0078] (7) The reverse transcription primers, probes, and detection primers used to detect miRNA-301a are shown below:

[0079] miRNA-301a-RT (reverse transcription primer):

[0080] 5'-GCTCAACCAGTGAGGCGTCCACGCCTGCCGTTCGCACTGGATGCACTGGTTGAGCGCTTTG-3';

[0081] miRNA-301a-F (upstream primer): 5'-CTGCTGCCAGTGCAATAGTATTGT-3';

[0082] Universal downstream primer (miRNA-301a-R): 5'-GCTCAACCAGTGAGGCGTC-3';

[0083] Universal probe (miRNA-301a-B):

[0084] 5'-CGCCTGCCGTTCGCACTGGAT-3'T;

[0085] (8) The primers and probes used to detect COX2 are shown below:

[0086] COX2-B (probe):

[0087] 5'-TCCTCAAAAGATTCATAGGGCTTCAGC-3';

[0088] COX2-F (upstream primer): 5'-CACTTGACCAGAGCAGAGAGATGA-3';

[0089] COX2-R (downstream primer): 5'-TAGAGCGCTTCTAACTCTGCAGC-3'.

[0090] The primer sequences for the microRNAs were designed based on the nucleotide sequences miRNA-92a (MIMAT0000092), miRNA-135b (MIMAT0000758), miRNA-18a (MIMAT0000072), miRNA-221 (MIMAT0000278), miRNA-19 (MIMAT0000073), miRNA-223 (MIMAT0000280), miRNA-301a (MIMAT0000688) reported in the microRNA database (http: / / www.mirbase.org / ) and the COX2 sequence (JN793538) from the GeneBank database. Table 1 lists the nucleotide sequences of the miRNAs.

[0091] Table 1

[0092] miRNA name sequence (Login ID) SEQ ID NO: hsa-miR-92 uauugcacuugucccggccug MIMAT0000092 1 miRNA-135b uauggcuuuucauuccuauguga MIMAT0000758 2 miRNA-18a uaaggugcaucuagugcagauag MIMAT0000072 3 miRNA-221 agcuacauugucugcuggguuuc MIMAT0000278 4 hsa-miR-19a ugugcaaaucuaugcaaaacuga MIMAT0000073 5 hsa-miR-223 ugucaguuugucaaauacccca MIMAT0000280 6 hsa-miR-301a cagugcaauaguauugucaaagc MIMAT0000688 7

[0093] The COX2 sequence (serial number: JN793538) is as follows:

[0094] CACTTGACCAGAGCAGAGAGATGAAATACCAGTCTTTTAATGAGTATCGCAAACGTTTTCTGCTGAAGCCCTATGAATCTTTTGAGGAACTTACAGGAGAGAAGGAAATGGCTGCAGAGTTAGAAGCGCTCTA (SEQ ID NO: 8).

[0095] The kit described in this article can detect samples such as feces, throat swabs, cloacal swabs, tissue samples, serum or plasma, herpes fluid, cerebrospinal fluid, or viral isolates from suspected colorectal cancer patients (e.g., patients), with feces being the preferred sample and serum being the second preferred sample.

[0096] The technical solution provided by this invention can achieve accurate diagnosis of colorectal cancer by detecting a small amount of miRNA and COX2, making it possible to produce accurate, efficient, and economical detection products. The established colorectal cancer detection model can effectively distinguish between individuals with colorectal cancer and healthy individuals, which has important clinical significance for the timely treatment and prevention of colorectal cancer patients.

[0097] Those skilled in the art will understand that the primer and probe sequences of this invention can be appropriately adjusted and modified based on the sequences of the relevant markers (the miRNA and COX2), and these modified primer and probe sequences can still be used to detect the markers. This invention also includes these equivalent technical solutions. Attached Figure Description

[0098] Figure 1 This is a schematic diagram of the probe method for detection; Figure 2 This represents the lowest detection limit for miRNA-19. Figure 3 This is the lowest detection limit for miRNA-135b; Figure 4 This is the lowest detection limit for miRNA-18a; Figure 5 This represents the lowest detection limit for miRNA-221. Figure 6 This is the lowest detection limit for miRNA-92a; Figure 7 This represents the lowest detection limit for miRNA-223. Figure 8 This is the lowest detection limit for miRNA-301a; Figure 9 This is the lowest detection limit for COX2; Figure 10 The expression level of miRNA-19; Figure 11 The expression level of miR-92a; Figure 12 This refers to the expression level of miRNA-135b. Figure 13This refers to the expression level of miRNA-18a. Figure 14 miR-221 expression level; Figure 15 miR-223 expression level; Figure 16 The expression level of miR-301a; Figure 17 This represents the COX2 expression level. Detailed Implementation

[0099] The present invention will be described below with reference to specific embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the medicinal materials, reagents, and other materials used in the following embodiments are commercially available products.

[0100] Example 1: Primer and probe design, and establishment and optimization of the reaction system:

[0101] 1. Primer and probe design:

[0102] Primer and probe sequences were designed based on the corresponding miRNA and Cox2 sequences. Specific examples are shown in Table 2.

[0103] Table 2

[0104]

[0105] Note: The 5' of the probe is marked with FAM, while the 3' of the probe is marked with TAMRM.

[0106] 2. Establishment and optimization of the reaction system for a colorectal cancer PCR diagnostic kit:

[0107] 2.1 Specimen Collection

[0108] We collected data from a series of individuals diagnosed by endoscopy, including those with chronic colitis, ulcerative colitis, intestinal polyps, adenomatous polyps, and colorectal cancer at different stages, and detected the expression levels of miR-92a, miRNA-135b, miRNA-18a, miRNA-221, miRNA-19, miRNA-223, miRNA-301a, and COX2.

[0109] 2.2 RNA Extraction

[0110] RNA extraction solution was purchased from MRC (Molecular Research Center), a well-known molecular biology company in the United States.

[0111] 1) After the sample is taken out from -80℃, it is placed on ice (for clinical samples, it is taken out on ice, aliquoted into centrifuge tubes of about 0.5g / 2ml and then frozen at -80℃);

[0112] 2) Add 1 ml TRIzol LS Reagent, vortex to distribute the sample evenly, and let stand at room temperature for 5 min;

[0113] 3) Add 200 μl of chloroform, vortex to mix, and let stand at room temperature for 1-2 min; centrifuge at 12000 rcf at 4℃ for 15 min;

[0114] 4) Transfer the upper homogeneous aqueous phase (400 μl) to a new centrifuge tube, add 1.5 times the volume of anhydrous ethanol (600 μl), and slowly pipette to mix it thoroughly (do not vortex).

[0115] 5) Take 700 μl in portions and add them to the RNeasy adsorption column. Centrifuge at 4℃ for 30s with >12000rcf / 8000g and discard the filtrate.

[0116] 6) Centrifuge at maximum speed at 4°C for 1 min, then dry the purification column;

[0117] 7) Add 30 μl of RNase-free water, centrifuge at >12000 rcf / 8000g at 4℃ for 1 min to elute total RNA;

[0118] 8) Add 30 μl of RNase-free water again, centrifuge at >12000 rcf / 8000g at 4℃ for 1 min, and perform a second elution (the RNA eluted in the first elution can be collected in the same tube), and place on ice;

[0119] 9) Detect the total RNA concentration and purity.

[0120] After extracting RNA using the methods described above, it was reverse transcribed into cDNA. The reverse transcription system for RNA is shown in Table 3: Table 3

[0121] Components Final concentration 20× Reverse Transcription Buffer 1× <![CDATA[Mg 2+ Concentration 5.0 mmol / L dNTPs (including dUTPs) 0.3 mmol / L reverse transcriptase 5U reverse transcription primers 0.15 μmol / L template 2μg Replenish water to 25μL

[0122] RNA reverse transcription conditions: 16℃ for 30 min; 42℃ for 35 min; 80℃ for 5 min; cDNA stored at 4℃ for subsequent PCR amplification.

[0123] 2.3 Optimization of PCR primer concentration

[0124] In the reaction system, primer concentrations for miRNA-92a, miRNA-135b, miRNA-18a, miRNA-221, miRNA-19, miRNA-223, miRNA-301a, and COX2 were serially diluted from 0.1 μmol / L to 0.6 μmol / L before detection. Through analysis and comparison of the experimental results, the optimal final primer concentrations for miRNA-92a, miRNA-135b, miRNA-18a, miRNA-221, miRNA-19, miRNA-223, miRNA-301a, and COX2 were determined to be 0.20 μmol / L, 0.20 μmol / L, 0.20 μmol / L, 0.20 μmol / L, 0.20 μmol / L, 0.20 μmol / L, 0.20 μmol / L, and 0.25 μmol / L, respectively.

[0125] 2.4 Optimization of magnesium ion concentration

[0126] With other conditions remaining constant in the reaction system, the concentration of MgCl2 was increased in increments of 0.5 mmol / L from 2.5 mmol / L to 5.5 mmol / L. After repeated experiments, 3.0 mmol / L was selected as the magnesium ion concentration in the reaction system of the kit.

[0127] 2.5 Optimization of Taq DNA Polymerase (Taq enzyme) dosage

[0128] By comparing the optimization results of Taq enzyme dosage (in units), 3U was selected as the dosage of Taq enzyme in the kit reaction system.

[0129] Optimization of 2.6 dNTP concentration

[0130] By using different concentrations of dNTPs for detection, and after comprehensive evaluation, 0.25 mmol / L was selected as the amount of dNTPs used in the reagent kit reaction system.

[0131] 2.7 Optimization of probe concentration

[0132] In the reaction system, the probe concentrations were serially diluted from 0.05 μmol / L to 0.2 μmol / L before detection. Through analysis and comparison of the experimental results, the optimal final probe concentrations for miRNA-92a, miRNA-135b, miRNA-18a, miRNA-221, miRNA-19, miRNA-223, miRNA-301a, and COX2 were determined to be 0.10 μmol / L, 0.10 μmol / L, 0.10 μmol / L, 0.10 μmol / L, 0.10 μmol / L, 0.10 μmol / L, 0.10 μmol / L, and 0.15 μmol / L, respectively.

[0133] The reaction system was established using the primers and probes described above. The final fluorescent PCR reaction system used was determined to be 25 μl. The required components and their corresponding concentrations are shown in Table 3.

[0134] Table 4. Optimized PCR reaction system

[0135]

[0136] Note: a. When the volume of the fluorescent PCR reaction is different, the reagents should be adjusted proportionally.

[0137] b. If different instruments are used, the reaction parameters should be adjusted accordingly.

[0138] 3. Selection of instrument detection channels:

[0139] When performing fluorescent PCR, the collection settings for fluorescence signals in the reaction tubes of the instrument should be configured so that the selected fluorescence detection channel matches the fluorescent reporter group labeled on the probe. Specific settings vary depending on the instrument; please refer to the instrument's instruction manual.

[0140] 4. PCR conditions should be selected as follows:

[0141] PCR amplification conditions: 95℃ for 3 minutes, 1 cycle; 95℃ for 5 seconds, 60℃ for 45 seconds, 40 cycles.

[0142] Example 2: Detection of copy numbers of miRNA-92a, miRNA-135b, miRNA-18a, miRNA-221, miRNA-19, miRNA-223, miRNA-301a, and COX2 to determine their lower limit of detection.

[0143] With a concentration of 10 6Positive samples of miRNA-92a, miRNA-135b, miRNA-18a, miRNA-221, miRNA-19, miRNA-223, miRNA-301a, and COX2, provided by the Chinese University of Hong Kong, were serially diluted 10-fold to 10000 copies / ml. 5 1 copy / ml, 10 4 1 copy / ml, 10 3 1 copy / ml, 2.5×10 2 1 copy / ml, 10 2 One copy / ml, using the primers, probes, and established reaction system, instruments, and amplification conditions as described in Example 1, was used for fluorescent PCR detection.

[0144] The results show that at 2.5 × 10 3 At a concentration of 1 copy / ml, the CT value was 32, and other indicators also met the detection requirements. Therefore, this invention improves the detection sensitivity by optimizing primers and probes, achieving a detection limit of 2.5 × 10⁻⁶. 3 One copy / ml, results are shown in [link / ml] Figure 2-6 .

[0145] Example 3: Detection of expression levels of miRNA-92a, miRNA-135b, miRNA-18a, miRNA-221, miRNA-19, miRNA-223, miRNA-301a, and COX2 in samples and determination of their specificity.

[0146] This study collected data from a range of individuals diagnosed by colonoscopy at Tianjin People's Hospital, including those with chronic colitis, ulcerative colitis, intestinal polyps, adenomatous polyps, and colorectal cancer at different stages. Fifty-five patients with colorectal cancer, ten with adenomas, and 15 healthy individuals were selected. Fecal samples were collected, and the expression levels and specificity of miR-92a, miRNA-135b, miRNA-18a, miRNA-221, miRNA-19, miRNA-223, miRNA-301a, and COX2 were detected.

[0147] Interpretation of test results:

[0148] The expression levels of miR-92a, miRNA-135b, miRNA-18a, miRNA-221, miRNA-19, miRNA-223, miRNA-301a, and COX2 in the feces of 55 patients with colorectal cancer, 10 patients with adenoma, and 15 healthy controls are shown in the table below. Figure 10-17The expression levels of miR-92a, miRNA-135b, miRNA-18a, miRNA-221, miRNA-19, miRNA-223, miRNA-301a, and COX2 in the feces of colorectal cancer patients, adenoma patients, and healthy controls were analyzed. The results are shown in Table 5. Statistical analysis using SPSS 13.0 showed that the expression levels of miR-92a, miRNA-135b, miRNA-18a, miRNA-221, miRNA-19, miRNA-223, miRNA-301a, and COX2 in the feces of colorectal cancer patients were significantly higher than those in adenoma patients and healthy controls, and the differences were statistically significant (P<0.01). (See also...) Figure 10-17 The cutoff values ​​for the expression copy numbers of miR-92a, miRNA-135b, miRNA-18a, miRNA-221, miRNA-19, miRNA-223, miRNA-301a, and COX2 in the feces of patients with colorectal cancer were 1360, 66, 1255, 156, 425, 9000, 50, and 925 copies, respectively (see Table 5).

[0149] The combined results indicate that the expression levels of miR-92a, miRNA-135b, miRNA-18a, miRNA-221, miRNA-19, miRNA-223, miRNA-301a, and COX2 in feces can serve as biomarkers for colorectal cancer diagnosis and have important diagnostic value.

[0150] Table 5

[0151]

Claims

1. A kit for the detection of intestinal cancer comprising reagents for the determination of the marker miRNA-18a, said reagents comprising primers and probes as set forth in SEQ ID NO: 11, 18, 23 and 24.

2. The kit according to claim 1, further comprising reagents for the determination of one or more markers selected from the group consisting of miRNA-92a, miRNA-135b, miRNA-221, miRNA-19a, miRNA-223, miRNA-301a and COX2.

3. The kit according to claim 2, further comprising one or more sets of primers and probes selected from the group consisting of: SEQ ID NO: 9, 16, 23 and 24; SEQ ID NO: 10, 17, 23 and 24; SEQ ID NO: 12, 19, 23 and 24; SEQ ID NO: 13, 20, 23 and 24; SEQ ID NO: 14, 21, 23 and 24; SEQ ID NO: 15, 22, 23 and 24; and SEQ ID NO: 25-27.

4. The kit according to any one of claims 1 to 3, wherein the probes are labeled with a fluorescent label.

5. The kit according to claim 4, wherein the 5' of the probes are labeled with FAM and the 3' of the probes are labeled with TAMRM.

6. Use of reagents in the manufacture of a kit for the detection of intestinal cancer, wherein the reagents are for the determination of one or more markers selected from the group consisting of miRNA-18a, miRNA-92a, miRNA-135b, miRNA-221, miRNA-19a, miRNA-223, miRNA-301a and COX2, and wherein the reagents comprise reagents for the determination of the marker miRNA-18a, said reagents comprising primers and probes as set forth in SEQ ID NO: 11, 18, 23 and 24.

7. The use according to claim 6, said reagents further comprising one or more sets of primers and probes selected from the group consisting of: SEQ ID NO: 9, 16, 23 and 24; SEQ ID NO: 10, 17, 23 and 24; SEQ ID NO: 12, 19, 23 and 24; SEQ ID NO: 13, 20, 23 and 24; SEQ ID NO: 14, 21, 23 and 24; SEQ ID NO: 15, 22, 23 and 24; and SEQ ID NO: 25-27.

Images