A primer combination and kit for detecting chlamydophila psittaci based on isothermal amplification method

Abstract

The application discloses a primer combination and a kit for detecting Chlamydophila psittaci based on an isothermal amplification method. The primer combination comprises a specific isothermal amplification primer and a gRNA sequence. The kit comprises a reaction buffer, an enzyme mix, and a primer probe mix. The application also provides a method for detecting Chlamydophila psittaci by using the kit. The method can be used for isothermal amplification detection of deoxyribonucleotides in a sample to be detected. The detection method has low requirements for temperature control, is simple to operate, and can reduce the requirements for laboratory equipment. The amplification and detection are synchronously performed, and the whole reaction can be completed within 30 minutes. The detection result has good specificity and high sensitivity. The whole experiment process does not need to be opened, and the risk of laboratory aerosol pollution is greatly reduced. The kit has the advantages of simple operation, good specificity and high sensitivity, and has great clinical significance in the detection of Chlamydophila psittaci.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and relates to a primer combination and a kit for detecting Chlamydia psittaci based on an isothermal amplification method. Background Art

[0002] Chlamydia psittaci is a Gram-negative, strictly intracellular microorganism belonging to the Chlamydiaceae family, Chlamydialese order, and Chlamydia genus. Its size is intermediate between that of bacteria and viruses. It is primarily transmitted to humans through infected birds and poultry, or through inhalation of aerosolized nasal secretions, feces, or feather dust from infected birds. Parrots were initially believed to be the host of this pathogen, and the disease they cause was named psittacosis. Chlamydia psittaci can cause a wide spectrum of illness in its numerous host species. In humans, psittacosis typically presents with high fever, chills, headache, myalgia, cough, and infiltrative lung lesions. The incubation period is typically 5-14 days, and 85% to 90% of patients develop pneumonia. Severe cases may also develop complications such as myocarditis, endocarditis, and pulmonary edema.

[0003] In the early days, because various detection methods had not yet been developed, the detection of psittacosis mainly used the most basic method of infectious disease pathogen diagnosis, that is, the isolation and identification of pathogens. In the laboratory, cell inoculation culture, chicken embryo inoculation culture, and animal inoculation culture are usually used for isolation and proliferation, and then staining and microscopy are used to detect whether it is psittacosis. This method takes a long time to test and the operation process is cumbersome, which is not suitable for large-scale sample testing and epidemiological surveys. In addition, immunological detection technology is also commonly used for laboratory psittacosis detection, such as immunofluorescence technology, immunohemagglutination test, and enzyme-linked immunosorbent assay. These methods have high sensitivity and good specificity, but they also have disadvantages such as long time consumption and high cost.

[0004] In the early 20th century, molecular diagnostic techniques, utilizing nucleic acids in specimens as detection targets, gained widespread application due to their high specificity, sensitivity, and adaptability. Polymerase chain reaction (PCR) has become a fundamental laboratory technique in many fields. Fluorescence quantitative PCR builds on conventional PCR by adding a fluorescent group to the reaction system. By detecting the fluorescent signal during the reaction, pathogens in the sample can be qualitatively or quantitatively detected. In 2010, Feng Yue et al. established the Taqman-MGB fluorescence quantitative PCR assay. The results showed that the assay tested positive for Chlamydia psittaci strains and negative for non-C. psittaci strains, demonstrating the method's high specificity and its significance for both clinical evaluation and epidemiological investigations of Chlamydia psittaci disease. However, compared to conventional PCR, fluorescence PCR also has drawbacks such as high cost and increased contamination.

[0005] While PCR has long held a monopoly on nucleic acid amplification, isothermal amplification is becoming a widely used alternative to PCR due to its simpler operation and lower instrumentation requirements. Both isothermal and PCR technologies are nucleic acid amplification techniques. Compared to PCR, isothermal amplification is not restricted by temperature cycling and eliminates the reliance on precision instrumentation. It amplifies nucleic acids at a specific temperature, avoiding the time-consuming process of repeated temperature increases and decreases, resulting in higher sensitivity and amplification efficiency.

[0006] Common isothermal amplification technologies include loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA / RAA) and rolling circle amplification (RCA). LAMP is currently the most widely used. Patent CN113136445A discloses an isothermal amplification detection kit for pet zoonotic chlamydia psittaci disease using LAMP technology. The amplification reaction can be completed within 30 minutes, but in terms of product detection, a high concentration of SYBR Green I dye is required for visual detection, so closed-tube detection cannot be achieved. Patent CN114540525A uses RAA technology to amplify and detect psittacosis, which is fast and efficient. The amplification reaction is completed within 15 minutes, but after the amplification is completed, the lid needs to be opened and the lateral flow chromatography test strips need to be used to interpret the results, and closed-tube detection is also not possible. Because the isothermal amplification technology has a fast amplification speed and a large amount of product, once the lid is opened after amplification, aerosols are easily generated, affecting the test results of other subsequent samples and producing false positives. Isothermal amplification technology has high sensitivity, but it can also produce nonspecific amplification. If conventional SYBR Green I or visual inspection is used to interpret the results, nonspecific amplification cannot be distinguished.

[0007] With the research on the CRISPR / Cas system, nucleic acid detection methods developed based on the CRISPR / Cas system have been widely studied in the diagnosis of infectious diseases, and can achieve specific and sensitive on-site detection of pathogenic microorganisms. The detection technology based on the CRISPR / Cas system mainly uses artificially designed guide RNA (gRNA) to enable it to specifically recognize the target sequence. When the Cas protein forms an effector complex with the gRNA and the target sequence, the Cas protein's auxiliary cleavage activity is activated, cutting the labeled reporter gene, thereby releasing a signal to achieve the detection effect. At present, the nucleic acid detection technology based on CRISPR / Cas mainly includes two parts: target amplification and Cas protein-mediated signal detection. In actual practice, due to the different optimal reaction temperatures of the two parts, a two-step method is usually used to build the detection platform, but the step-by-step operation is cumbersome and prone to contamination. Summary of the Invention

[0008] The object of the present invention is to provide a primer combination and a kit for rapid detection or auxiliary detection of Chlamydia psittaci based on an isothermal amplification method.

[0009] The present invention is based on the nucleic acid detection technology and isothermal amplification technology of CRISPR / Cas. It mainly uses isothermal amplification technology to specifically amplify and enrich the extracted target DNA, and guides the Cas protein to specifically recognize the isothermal amplification product through artificially designed gRNA to activate the Cas protein cleavage activity, and act on the designed substrate to output the signal in a fluorescent manner to achieve the effect of signal amplification. The isothermal amplification technology based on the CRISPR / Cas system reduces the dependence on precision equipment and realizes one-step closed-tube detection, which is simple to operate and avoids contamination. At the same time, the artificially designed gRNA can identify specific amplification and has higher specificity. Based on the above technology, the present invention has established a primer combination and kit for detecting Chlamydia psittaci based on isothermal amplification.

[0010] To achieve the above-mentioned and other related purposes, the technical solution provided by the present invention is:

[0011] A primer combination for detecting Chlamydia psittaci based on an isothermal amplification method, the primer combination comprising a set of specific isothermal amplification primers and a gRNA sequence;

[0012] The specific isothermal amplification primers include primers with the following sequences:

[0013] Primer F3: 5'-GCTGAGTTCCAATACGCT-3', i.e., SEQ ID NO. 1;

[0014] Primer B3: 5'-CCTACTTGCCATTCATGGTAT-3', i.e., SEQ ID NO. 2;

[0015] Primer FIP:

[0016] 5'-CCTCTTGGTTTGTGAATCACAAATTAATCCTAAGATTGAAATACTCAACG-3', namely SEQ IDNO.3;

[0017] Primer BiP:

[0018] 5'-AAGGAGCTAGCTCGAATTTTCCTTAATTGTAGCTGATTTGGTGTC-3', which is SEQ ID NO.4;

[0019] Primer LB: 5'-GTGCTGGGCTTGAAGTGA-3', i.e., SEQ ID NO. 5;

[0020] Primer LF: 5'-CCTATAACGGCTGGAACAACAGAAG-3', i.e., SEQ ID NO. 6;

[0021] The specific isothermal amplification primers are designed for the main protein region of the outer membrane of Chlamydia psittaci.

[0022] The sequence of the gRNA is

[0023] 5'-AAUGUAGAUGGUUAGCACAAGCCCAGCACAAUUUGUGA-3', which is SEQ ID NO.7.

[0024] The sequence of the gRNA includes a sequence that can bind to the Cas12b protein and a targeted recognition DNA sequence of Chlamydia psittaci.

[0025] The detection includes rapid detection or auxiliary detection.

[0026] The present invention also provides a kit for detecting Chlamydia psittaci based on an isothermal amplification method, containing the primer combination.

[0027] Furthermore, the kit includes a reaction buffer, an enzyme mix, and a primer-probe mix.

[0028] The primer probe mix is ​​the primer combination, including the specific isothermal amplification primer and the gRNA sequence.

[0029] The reaction buffer comprises a DNA fluorescent reporter probe, the sequence of which is SEQ ID NO. 8: 5'-FAM-TTTTTTTT-BHQ1-3'.

[0030] The fluorescent reporter probe is a single-stranded DNA sequence, the 5' end of which is labeled with a fluorescent group (FAM) and the 3' end of which is labeled with a quenching group (BHQ1).

[0031] The reaction buffer also includes dNTPs.

[0032] Furthermore, the reaction buffer comprises dNTP, dimethyl sulfoxide (DMSO), magnesium chloride, potassium chloride, sorbitol and a DNA fluorescent reporter probe.

[0033] The enzyme mix includes Bst DNA polymerase and Cas12b nuclease.

[0034] Furthermore, the kit also includes quality control products, including positive quality control products and negative quality control products. The positive quality control product includes a DNA plasmid containing a 427bp fragment of the Chlamydia psittaci OmpA gene. Furthermore, the nucleotide sequence of the Chlamydia psittaci OmpA gene fragment is shown in SEQ ID NO. 9.

[0035] Furthermore, the positive quality control product includes a plasmid containing the conserved sequence shown in SEQ ID NO.9.

[0036] Furthermore, the positive control product is a mixed solution of a plasmid containing the conserved sequence shown in SEQ ID NO.9 and extracted human cell nucleic acid; the negative control product is extracted human cell nucleic acid.

[0037] The conserved sequence shown in SEQ ID NO.9 is the DNA of the detection fragment of the Chlamydia psittaci OmpA gene.

[0038] The conserved sequence is SEQ ID NO.9:

[0039] AAATCAAGTTCGGCTGCATTCAACTTGGTTGGGTTAATAGGGTTTCAGCTA

[0040] CCAACTCAACCTCTACCGATCTTCCAATGCAACTTCCTAACGTAGGCATTAC

[0041] CCAAGGTGTTGTGGAATTTTATACAGACACATCATTTTCTTGGAGCGTAGGT

[0042] GCACGTGGAGCTTTATGGGAATGTGGTTGTGCAACTTTAGGAGCTGAGTTC

[0043] CAATACGCTCAATCTAATCCTAAGATTGAAATACTCAACGTCACTTCAAGCC

[0044] CAGCACAATTTGTGATTCACAAACCAAGAGGCTATAAAGGAGCTAGCTCGA

[0045] ATTTTCCTTTACCTATAACGGCTGGAACAACAGAAGCTACAGACACCAAAT

[0046] CAGCTACAATTAAATACCATGAATGGCAAGTAGGCCTCGCCCTGTCTTACAG

[0047] ATTGAATATGCTTG

[0048] Furthermore, it is preferred that the kit comprises the following components:

[0049] (1) Reaction buffer: dNTPs, dimethyl sulfoxide (DMSO), magnesium chloride, potassium chloride, sorbitol, and a DNA fluorescent reporter probe (SEQ ID NO. 8);

[0050] (2) Enzyme mix: Bst DNA polymerase and Cas12b nuclease;

[0051] (3) Primer probe mix: specific isothermal amplification primers SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 and gRNA sequence SEQ ID NO.7;

[0052] (4) Quality control products: including positive quality control products and negative quality control products.

[0053] The gRNA SEQ ID NO.7 can be obtained by synthesis.

[0054] Furthermore, in a kit for detecting Chlamydia psittaci based on an isothermal amplification method, the reaction buffer, enzyme mix, and primer probe mix are composed as follows:

[0055] Reaction buffer: 20-100 mM Tris-HCl buffer (pH 7.5), 0.1-10 μM dNTPs, 1-10 mM DTT, 0-25% v / v dimethyl sulfoxide (DMSO), 2-50 mM magnesium chloride, 20-100 mM potassium chloride, 0.01 M-0.5 M sorbitol, 1-4 μM DNA fluorescent reporter probe; the volume concentration of DMSO in the reaction buffer is 0-25% v / v, where 0 represents no DMSO added;

[0056] Enzyme mix: Cas12b protein 1 ng-10 μg / reaction, Bst DNA polymerase 1-100 U / reaction, 20-100 mM Tris-HCl (pH 7.5), 1-10 mM DTT (dithiothreitol), 20-50% v / v glycerol;

[0057] Primer probe mix: F3, B3 primers 0.1-2 μM each; FIP, BIP primers 0.1-10 μM each; LF, LB primers 0.1-2 μM each; gRNA: 100-300 ng / reaction.

[0058] The quality control product is a positive quality control product or a negative quality control product: the positive quality control product is a mixed solution of a plasmid containing the conserved sequence shown in SEQ ID NO.9 and extracted human cell nucleic acid; the negative quality control product is extracted human cell nucleic acid.

[0059] The extracted human cell nucleic acid is obtained by extracting human cells using an extraction or purification reagent.

[0060] The concentration of the extracted human cell nucleic acid is preferably 1 to 10 ng / μL;

[0061] Furthermore, human cells can be Jurkat cells, and nucleic acid can be extracted using the nucleic acid extraction and purification kit (Cat. No.: MD049T-P2) of Hangzhou Jieyi Biotechnology Co., Ltd. to obtain extracted human cell nucleic acid.

[0062] More preferably, the positive quality control product is obtained by the following method: a plasmid containing a fragment of Chlamydia psittaci OmpA (SEQID NO.9) is diluted 1-10 ng / μL of human cell nucleic acid in a 10-fold ratio to 1-10 fg / μL to obtain a positive quality control product.

[0063] The plasmid containing the fragment of Chlamydia psittaci OmpA (SEQ ID NO. 9) is an artificially synthesized pUC19 plasmid containing the fragment of Chlamydia psittaci OmpA (SEQ ID NO. 9), and can be prepared according to conventional recombinant plasmid preparation methods.

[0064] Furthermore, the kit may also include a DNA extraction reagent for extracting the template DNA of the sample to be tested.

[0065] Alternatively, a commercially available nucleic acid extraction kit is used to extract the template DNA of the sample to be tested.

[0066] The present invention also provides the use of the kit for detecting Chlamydia psittaci based on the isothermal amplification method in rapid detection or auxiliary detection of Chlamydia psittaci.

[0067] Furthermore, the present invention provides a method for rapid detection or auxiliary detection of Chlamydia psittaci using a kit for detecting Chlamydia psittaci based on an isothermal amplification method, the method comprising the following steps:

[0068] (1) Extracting DNA nucleic acid from the sample to be tested;

[0069] (2) using the extracted DNA as a template and the components of the kit, preparing an isothermal amplification reaction system, and using a positive quality control and a negative quality control as controls;

[0070] (3) performing isothermal amplification and detection, detecting the fluorescence signal in real time, and analyzing the results based on the detected fluorescence signal value to determine whether Chlamydia psittaci is present in the sample.

[0071] Furthermore, in step (2), the isothermal amplification reaction system is 50 μL, including 30 μL of reaction buffer, 10 μL of primer-probe mix, 5 μL of enzyme mix, and 5 μL of template DNA, positive quality control product or negative quality control product.

[0072] In step (3), the isothermal amplification and detection procedures are: 65° C., reading the fluorescence value every 30 seconds, and the time is 30 minutes.

[0073] In the step (3), the result analysis method is: if the fluorescence detection curve shows an upward trend and the end point fluorescence signal value of 30 minutes is higher than 10,000, it is determined that the psittacosis is positive; if the fluorescence detection curve is horizontal and the end point fluorescence signal value of 30 minutes is lower than 10,000, it is determined that the psittacosis is negative.

[0074] The instrument for detecting fluorescence signals is the constant temperature nucleic acid amplification detector FMS-800M produced by Hangzhou Jieyi Biotechnology Co., Ltd.

[0075] The present invention uses isothermal amplification technology to specifically amplify and enrich the extracted target DNA, then guides the Cas12b nuclease through gRNA to specifically recognize the amplified target DNA, obtain DNA enzyme activity, cut the fluorescent substrate to separate the fluorescent group and the fluorescent quenching group, thereby generating a fluorescent signal; finally, a constant temperature nucleic acid amplification detector reads the fluorescence value, and the test result is analyzed and judged according to the strength of the fluorescent signal.

[0076] The primer combination of the present invention is used to detect the OmpA-specific conserved target sequence of Chlamydia psittaci, and the sequence can be used as one of the marker genes of Chlamydia psittaci.

[0077] The present invention provides a primer combination and a kit for detecting Chlamydia psittaci based on an isothermal amplification method, and a method for detecting Chlamydia psittaci, which have the following beneficial effects:

[0078] (1) It is fast and efficient, saving the detection time of psittacosis. The entire detection process can be completed within 30 minutes at 65°C, which greatly shortens the detection time compared to conventional PCR and real-time fluorescence quantitative PCR, which take several hours.

[0079] (2) Compared with conventional PCR and fluorescent quantitative PCR, the present invention can complete a large number of amplification reactions at a constant temperature, without the need for specialized PCR equipment. The apparatus of the present invention only requires a constant temperature nucleic acid amplification detector, which is compact and easy to transport and use.

[0080] (3) Compared with the traditional isothermal amplification method, the entire experimental process does not require opening the lid, reducing the risk of laboratory aerosol contamination.

[0081] (4) It has strong specificity and can accurately detect Chlamydia psittaci. The experimental results show that there is no cross reaction with Streptococcus pneumoniae, Klebsiella pneumoniae, Pseudomonas aeruginosa, Acinetobacter baumannii, Haemophilus influenzae, Klebsiella oxytoca, Staphylococcus aureus, Streptococcus pyogenes, Aspergillus fumigatus, Aspergillus flavus, Candida albicans and Cryptococcus neoformans.

[0082] (5) High sensitivity, with the minimum detection limit being single copy / μL.

[0083] (6) The identification method is simple and convenient, and the results can be observed through fluorescence values ​​and detection curves. It is suitable for on-site or clinical testing and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0084] Figure 1 Fluorescence detection curves for screening three sets of isothermal amplification primer combinations.

[0085] Figure 2 This is a fluorescence detection curve diagram of the combination of two gRNAs and isothermal amplification primer set 1.

[0086] Figure 3 It is the fluorescence detection curve of negative quality control product and positive quality control product.

[0087] Figure 4 This is the sensitivity test result of Chlamydia psittaci.

[0088] Figure 5 This is a specific test result for Chlamydia psittaci.

[0089] Figure 6 These are the test results of clinical samples. DETAILED DESCRIPTION

[0090] Below in conjunction with specific embodiment and accompanying drawing, the technical method provided by the present invention is elaborated and described in detail, and described embodiment is only a part of embodiment of the present invention, and is not limited to all embodiments of the present invention. The reagent components used in the following examples are all components in the kit of the present invention unless otherwise specified. Modifications or changes based on the present invention by professionals in this field, the mode of these equivalent modifications also fall within the scope of the claims described in the claims of the present invention.

[0091] Example 1: Screening results of Chlamydia psittaci primer set

[0092] (1) Screening of isothermal amplification primer sets for Chlamydia psittaci

[0093] The inventors downloaded the Chlamydia psittaci OmpA gene from the NCBI database, performed sequence alignment using Align X, selected a conserved region of 427 bp, and used this sequence as a template to design an isothermal amplification primer set. Preferably, three isothermal amplification primer sets containing two loop primers are designed, as shown in Table 1.

[0094] Conservative sequence SEQ ID NO.9:

[0095] AAATCAAGTTCGGCTGCATTCAACTTGGTTGGGTTAATAGGGTTTTCAGCTACCAACTCAACCTCTACCGATCTTCCAATGCAACTTCCTAACGTAGGCATTACCCAAGGTGTTGTGGAATTTTATACAGACACATCATTTTCTTGGAGCGTAGGTGCACGTGGAGCTTTATGGGAATGTGGTTGTGCAACTTTAGGAGCTGAGTTCCAATAC GCTCAATCTAATCCTAAGATTGAAATACTCAACGTCACTTCAAGCCCAGCAATTTGTGATTCACAAACCAAGAGGCTATAAAGGAGCTAGCTCGAATTTTCCTTTACCTATAACGGCTGGAACAGAAGCTACAGACACCAAATCAGCTACAATTAAATACCATGAATGGCAAGTAGGCCTCGCCCTGTCTTACAGATTGAATATGCTTG

[0096] Table 1 Three sets of isothermal amplification primers:

[0097]

[0098]

[0099] (2) Isothermal amplification detection of Chlamydia psittaci

[0100] A pUC19 plasmid containing the conserved sequence of the OmpA gene (SEQ ID NO. 9) (synthesized by GenScript Biotech Co., Ltd.) was used as a positive control, and 1 ng / μL of human cell nucleic acid was diluted 10-fold to 1 pg / μL. A 1 ng / μL human cell nucleic acid was used as a negative control, and isothermal amplification was performed on the negative and positive controls using three sets of primers, respectively.

[0101] Human cell nucleic acid was obtained by extracting nucleic acid from Jurkat cells using the nucleic acid extraction and purification kit (Cat. No.: MD049T-P2) from Hangzhou Jieyi Biotechnology Co., Ltd.

[0102] Isothermal amplification detection system 50 μL, as shown in Table 2

[0103] Table 2 Isothermal amplification detection system:

[0104]

[0105] A constant temperature nucleic acid amplification detector was used for detection. The reaction conditions were set as follows: temperature 65°C, fluorescence value reading every 30 seconds, time 30 minutes, and observation of fluorescence curves and fluorescence value changes. The fluorescence detection curves of the three primer groups are shown in the figure below. Figure 1 As shown, from Figure 1 The results showed that primer set 1 was the preferred primer for the detection of Chlamydia psittaci. (3) Screening of Chlamydia psittaci gRNA

[0106] Primer set 1 was used for the detection of Chlamydia psittaci, and two gRNAs were designed, with the sequences being 5'-AAUGUAGAUGGUUAGCACAAGCCCAGCACAAUUUGUGA

[0107] -3' (SEQ ID NO. 7) and 5'

[0108] -AAUGUAGAUGGUUAGCACUGUUGUUCCAGCCGUUAUAGG-3' (SEQ ID NO. 22). A pUC19 plasmid containing the conserved OmpA gene sequence (SEQ ID NO. 9) was used as a positive control. Human cell nucleic acid at 1 ng / μL was diluted 10-fold to 10 fg / μL. Human cell nucleic acid at 1 ng / μL was used as a negative control. Two replicates of each negative and positive control nucleic acid samples were used for simultaneous amplification.

[0109] The detection reaction system is 50 μL, as shown in Table 3

[0110] Table 3 Detection reaction system:

[0111]

[0112] A constant temperature nucleic acid amplification detector was used for detection. The reaction conditions were set as follows: temperature 65°C, fluorescence value reading every 30 seconds, time 30 minutes, and the change of fluorescence value and detection time were observed. The fluorescence detection curves of the two gRNAs are shown in the figure below. Figure 2 As shown. Figure 2 Based on the results, gRNA (SEQ ID NO.7) was preferred for the detection of Chlamydia psittaci.

[0113] Example 2: Negative and positive control results

[0114] (1) Preparation of standard products

[0115] Negative control: extracted human cell nucleic acid, concentration 1 ng / μL;

[0116] Positive control: A synthetic plasmid containing a fragment of Chlamydia psittaci OmpA (SEQ ID NO. 9). This positive control is prepared by diluting 10-fold the concentration of 1 ng / μL human cell nucleic acid to 10 fg / μL.

[0117] (2) Amplification and detection

[0118] a. Thaw all components of the kit at room temperature according to the instructions and mix thoroughly for later use.

[0119] b. Solution Preparation: Prepare the following four reactions in nuclease-free centrifuge tubes: pipette 30 μL of amplification reaction solution into each of reaction tubes 1, 2, 3, and 4. Add 10 μL of primer-probe mix and 5 μL of enzyme mix to each reaction tube. Add 5 μL of negative control to reaction tubes 1 and 2, and 5 μL of positive control to reaction tubes 3 and 4. The resulting reaction system contains the following components at the following final concentrations:

[0120] 50 mM Tris-HCl buffer, pH 7.5, 5 μM dNTP, 1 μM DTT, final concentration 1% v / v dimethyl sulfoxide (DMSO), 30 mM magnesium chloride, 50 mM potassium chloride, 0.1 M sorbitol, 1 μM DNA fluorescent reporter probe.

[0121] Cas12b protein 0.5 μg / reaction, Bst DNA polymerase 10 U / reaction, 2% v / v glycerol.

[0122] F3 and B3 primers, 0.2 μM each; FIP and BIP primers, 1.6 μM each; LF and LB primers, 0.4 μM each; gRNA: 200 ng / reaction.

[0123] c. After instant centrifugation, place the reaction tube in a constant-temperature nucleic acid amplification detector for real-time detection. The constant-temperature nucleic acid amplification detector is programmed as follows: 65°C, fluorescence readings every 30 seconds, and real-time detection for 30 minutes (the fluorescence reading instrument used in the kit is the Constant-temperature Nucleic Acid Amplification Detector FMS-800M, manufactured by Hangzhou Jieyi Biotechnology Co., Ltd.).

[0124] (3) Result judgment

[0125] If the fluorescence detection curve shows an upward trend and the endpoint fluorescence signal value of 30 minutes is higher than 10,000, it is judged as psittacosis positive; if the fluorescence detection curve is horizontal and the endpoint fluorescence signal value of 30 minutes is lower than 10,000, it is judged as psittacosis negative.

[0126] (4) Result analysis

[0127] Fluorescence detection curves of negative and positive control products are shown in the figure below. Figure 3 As shown by Figure 3 The fluorescence detection curve of the positive control product shows an upward trend, while the fluorescence detection curve of the negative control product is flat. The endpoint fluorescence signal value of the positive control product at 30 minutes is higher than 10,000, while the endpoint fluorescence signal value of the negative control product at 30 minutes is lower than 10,000.

[0128] Therefore, the detection and judgment method of the present invention can accurately and quickly distinguish between negative quality control products and positive quality control products.

[0129] Example 3: Detection of Chlamydia psittaci sensitivity

[0130] (1) The same preparation process of the standard in Example 2 was continued, and the nucleic acid plasmid containing the gene detection fragment was diluted with 1 ng / μL human cell nucleic acid to obtain 10 ag / μL (about 3*10 3 copies / mL),

[0131] 5ag / μL (about 1.5*10 3 copies / mL), 3ag / μL (about 9*10 2 copies / mL), 1ag / μL (about 3*10 2 copies / mL) of the DNA nucleic acid solution to be tested.

[0132] (2) The amplification and detection system and conditions are the same as those in Example 2, with two replicates of each nucleic acid sample being performed for amplification and detection.

[0133] (3) Result analysis: The fluorescence detection signal results of DNA plasmids with different concentrations are as follows Figure 4 As shown, the negative control test result is negative, and the positive control test result is positive; higher than 3ag / μL (about 9*10 2 The results of DNA nucleic acid solution with 1g / μL (about 3*10 2 The test result of DNA nucleic acid solution with 10 copies / mL) was negative. Therefore, the sensitivity of this kit is 9*10 2 copies / mL, that is, the minimum detection limit is single copy / μL.

[0134] Example 4: Specific detection results of Chlamydia psittaci

[0135] (1) The positive and negative quality control products in the kit were used as controls, and nucleic acid samples of common respiratory or lung infection pathogens were used as specific interference samples for testing. These pathogen samples included Streptococcus pneumoniae, Klebsiella pneumoniae, Pseudomonas aeruginosa, Acinetobacter baumannii, Haemophilus influenzae, Klebsiella oxytoca, Staphylococcus aureus, Streptococcus pyogenes, Aspergillus fumigatus, Aspergillus flavus, Candida albicans, and Cryptococcus neoformans.

[0136] (2) The detection system and conditions were the same as those in Example 2. Two replicates were set for each of the above nucleic acid samples, and the detection was performed after synchronous amplification.

[0137] (3) Result analysis: The fluorescence detection signal results of different pathogen samples are as follows Figure 5 As shown in the figure, except for the positive control product, the test results of the other samples were negative. This shows that the specificity of this kit is high and no cross signals are generated in other common pathogens of respiratory or lung infections.

[0138] Example 5: Detection of Chlamydia psittaci Clinical Samples

[0139] (1) The alveolar lavage fluid of 10 patients with clinically confirmed psittacosis was selected and DNA was extracted using the nucleic acid extraction and purification kit (Cat. No.: MD049T-P2) produced by Hangzhou Jieyi Biological Co., Ltd. as the nucleic acid samples to be tested.

[0140] (2) The amplification and detection system and conditions were the same as those in Example 2, with the positive and negative quality control products in the kit as controls. Two replicates were set for each nucleic acid sample to be tested, and simultaneous detection was performed.

[0141] (3) Result analysis: The test results of clinical samples are shown in the figure below. Figure 6 As shown in the figure, except for the negative control sample, the test results of the other samples were all positive, which is consistent with the clinical diagnosis. This shows that the detection accuracy of this kit is high.

Claims

1. A kit for detecting Chlamydia psittaci based on isothermal amplification, comprising a primer combination and a reaction buffer, wherein the primer combination comprises a set of specific isothermal amplification primers and a gRNA sequence; The specific isothermal amplification primers consist of primers with the following sequences: Primer F3: 5′-GCTGAGTTCCAATACGCT-3′; Primer B3: 5′-CCTACTTGCCATTCATGGTAT-3′; Primer FIP: 5'-CCTCTTGGTTTGTGAATCACAAATTAATCCTAAGATTGAAATACTCA ACG-3'; Primer BiP: 5'-AAGGAGCTAGCTCGAATTTTCCTTAATTGTAGCTGATTTGGTGTC-3'; Primer LB: 5′-GTGCTGGGCTTGAAGTGA-3′; Primer LF: 5′-CCTATAACGGCTGGAACAACAGAAG-3′; The sequence of the gRNA is 5'-AAUGUAGAUGGUUAGCACAAGCCCAGCACAAUUUGUGA-3'; The reaction buffer includes a DNA fluorescent reporter probe, and the nucleotide sequence of the DNA fluorescent reporter probe is: 5′-FAM-TTTTTTTT-BHQ1-3′.

2. The kit for detecting Chlamydia psittaci based on isothermal amplification method according to claim 1, characterized in that The kit also includes an enzyme mix.

3. The kit for detecting Chlamydia psittaci based on isothermal amplification method according to claim 2, characterized in that The kit also includes quality control products, which include positive quality control products and negative quality control products. The positive quality control product includes a DNA plasmid containing a 427 bp fragment of the psittacosis Chlamydia OmpA gene, and the nucleotide sequence of the 427 bp fragment of the psittacosis Chlamydia OmpA gene is shown in SEQ ID NO.

9.

4. The kit for detecting Chlamydia psittaci based on isothermal amplification method according to claim 3, characterized in that The positive quality control product is a mixed solution of a plasmid containing a conserved sequence as shown in SEQ ID NO.9 and extracted human cell nucleic acid; the negative quality control product is extracted human cell nucleic acid.

5. The kit for detecting Chlamydia psittaci based on isothermal amplification method according to claim 2, characterized in that The reaction buffer comprises dNTPs, dimethyl sulfoxide, magnesium chloride, potassium chloride, sorbitol and a DNA fluorescent reporter probe; the enzyme mix comprises Bst DNA polymerase and Cas12b nuclease.

6. The kit for detecting Chlamydia psittaci based on isothermal amplification method according to claim 2, characterized in that The composition of the reaction buffer, enzyme mix, and primer combination is as follows: Reaction buffer: 20–100 mM Tris-HCl buffer (pH 7.5), 0.1–10 μM dNTPs, 1–10 mM DTT, 0–25% v / v dimethyl sulfoxide, 2–50 mM magnesium chloride, 20–100 mM potassium chloride, 0.01 M–0.5 M sorbitol, 1–4 μM DNA fluorescent reporter probe; Enzyme mix: Cas12b protein 1 ng-10 μg / reaction, Bst DNA polymerase 1-100 U / reaction, 20-100 mM Tris-HCl (pH 7.5), 1-10 mM DTT, 20-50% v / v glycerol; Primer combination: F3, B3 primers 0.1~2μM each; FIP, BIP primers 0.1~10μM each; LF, LB primers: 0.1-2 μM each; gRNA: 100-300 ng / reaction.

7. A method for rapid or auxiliary detection of Chlamydia psittaci using the kit for detecting Chlamydia psittaci based on the isothermal amplification method according to any one of claims 1 to 6, wherein the method is for non-diagnostic purposes and is characterized in that The method comprises the following steps: (1) Extract DNA nucleic acid from the sample to be tested; (2) Using the extracted DNA as a template, an isothermal amplification reaction system was prepared according to the components of the kit, and positive and negative quality controls were used as controls; (3) Perform isothermal amplification and detection, detect the fluorescence signal in real time, and analyze the results based on the detected fluorescence signal value to determine whether Chlamydia psittaci exists in the sample.

Images