Application of TPST gene in regulating plant traits

Abstract

The present invention provides the use of TPST gene in regulating plant traits. Specifically, the present invention provides the use of TPST gene or its encoded protein, or its promoter in regulating plant traits or preparing a preparation or composition for regulating plant traits, wherein the traits of the plant include one or more traits selected from the following group: (i) stress resistance; (ii) thousand-grain weight; (iii) yield and / or biomass; (iv) size, weight and / or number of fruits and / or seeds. The present invention is the first to discover that increasing the expression level or activity of TPST gene or its encoded protein in the plant (such as rice) can significantly improve the traits of the plant.

Description

[0001] This application is a divisional application of the invention patent application with application date of August 21, 2020, application number 202080003113.0, and invention name “Application of TPST genes in regulating plant traits”. Technical Field

[0002] The present invention relates to the field of agronomy, and in particular, to the application of TPST gene in regulating plant traits, and more particularly, to the application of TPST gene in regulating plant agronomic traits, especially rice stress resistance, yield and the like. Background Art

[0003] There are many genes in organisms with diverse functions. They work together to complete the life process. For example, the genome of the model plant Arabidopsis contains about 25,000 genes, and the genome of rice contains 30,000 to 50,000 genes. With the completion of the whole genome sequence maps of Arabidopsis, soybean, rice, corn and other plants, many important genes have been cloned one after another, and their functions have also been studied in depth. In recent years, with the increasingly serious food problem in the world, in order to increase the yield of grain crops, improve varieties, improve resistance, and achieve high yield, stable yield and high quality, scientists are gradually shifting from simple gene function research to paying more attention to the relationship between the functional domains of the studied genes and important agronomic traits. In grain crops, research is mainly carried out around crop yield, resistance, varieties and other new equipment, in order to discover important genes that regulate target traits, and cultivate excellent varieties through genetic engineering, molecular marker-assisted breeding and other means. Some research results have been successfully applied to crop improvement, showing great application prospects in grain production, highlighting the importance of plant functional gene research.

[0004] Rice is one of the most important food crops in the world and the main source of energy and protein for humans. Its output and consumption have always ranked first among food crops. Due to the current lack of arable land, population growth, and soil erosion problems, the selection and production of new varieties of high-yield, high-quality, and multi-resistant rice has always been the theme of rice breeding in China. Therefore, it is of great significance to explore relevant functional genes and use them to cultivate excellent varieties with target traits and open up new breeding paths to promote my country's transformation from a large seed industry country to a strong seed industry country. Summary of the invention

[0005] The object of the present invention is to provide the use of TPST gene or its encoded protein or its promoter in regulating plant (such as rice) traits.

[0006] Specifically, in the present invention, by increasing the expression or activity of the TPST gene or its encoded protein, one or more traits in the plant can be improved, including enhancing the stress resistance of the plant, increasing the thousand-grain weight, increasing the yield and / or biomass, increasing the size, weight and / or number of fruits and / or seeds, and increasing the root length or root weight. The present invention provides a new technical means for plant trait improvement and molecular breeding.

[0007] The first aspect of the present invention provides a use of a substance, which is a TPST gene or its encoded protein, or a promoter thereof, for regulating plant traits or preparing a preparation or composition for regulating plant traits, wherein the plant traits include one or more traits selected from the following group:

[0008] (i) Stress resistance;

[0009] (ii) thousand-grain weight;

[0010] (iii) yield and / or biomass;

[0011] (iv) size, weight and / or number of fruits and / or seeds.

[0012] In another preferred embodiment, the stress resistance is selected from the group consisting of salt resistance, drought resistance, disease and insect resistance, or a combination thereof.

[0013] In another preferred embodiment, the traits further include one or more selected from the following group:

[0014] (v) root length;

[0015] (vi) Root weight.

[0016] In another preferred embodiment, the regulating plant traits include:

[0017] (i) enhancing plant stress resistance; and / or

[0018] (ii) increase thousand kernel weight; and / or

[0019] (iii) increase yield and / or biomass; and / or

[0020] (iv) increasing the size, weight and / or number of fruits and / or seeds.

[0021] In another preferred embodiment, the regulating plant traits further comprises:

[0022] (v) increase root length; and / or

[0023] (vi) Increase root weight.

[0024] In another preferred embodiment, the composition comprises an agricultural composition.

[0025] In another preferred embodiment, the preparation includes an agricultural preparation.

[0026] In another preferred embodiment, the composition comprises (a) the TPST gene or its encoded protein, or a promoter thereof; and (b) an agronomically acceptable carrier.

[0027] In another preferred embodiment, the composition contains 0.0001-99 wt%, preferably 0.1-90 wt% of component (a), based on the total weight of the composition.

[0028] In another preferred embodiment, the dosage form of the composition or preparation is selected from the following group: solution, emulsion, suspension, powder, foam, paste, granule, aerosol, or a combination thereof.

[0029] In another preferred embodiment, the composition further comprises other substances that regulate plant traits.

[0030] In another preferred embodiment, the other substances for regulating plant traits include osmotic regulators, brassinolide, algae, fertilizers with high potassium, nitrogen or phosphorus content, trace elements (such as boron, zinc, calcium, silicon), triazole fungicides (such as difenoconazole, propiconazole, tebuconazole), high potassium foliar fertilizers, plant hormones (such as abscisic acid, ethylene, cytokinin, polyamines), rare earths, PP 333 , benzoic acid, salicylic acid, and pheniconol.

[0031] In another preferred embodiment, the osmotic regulator is selected from the following group: an inorganic regulator, an organic regulator, a growth regulator, or a combination thereof.

[0032] In another preferred embodiment, the inorganic regulator includes Ca 2+ , salicylic acid.

[0033] In another preferred embodiment, the organic regulator includes betaine, proline, and sodium nitroprusside (SNP).

[0034] In another preferred embodiment, the growth regulator includes: abscisic acid (ABA).

[0035] In another preferred embodiment, the promoter includes a small molecule compound that promotes the expression of the TPST gene or its encoded protein.

[0036] In another preferred embodiment, the promoter is selected from the following group: small molecule compounds, nucleic acid molecules, or a combination thereof.

[0037] In another preferred embodiment, the plants include monocots, dicots, and / or gymnosperms.

[0038] In another preferred embodiment, the plants include crops, forestry plants, vegetables, fruits, flowers, and forage grasses (including lawn grasses).

[0039] In another preferred embodiment, the plant is selected from the following group: Cruciferae, Poaceae, Leguminosae, Solanaceae, Apiaceae, Chenopodiaceae, or a combination thereof.

[0040] In another preferred embodiment, the plant is selected from the following group: Arabidopsis, rice, soybean, tomato, corn, sorghum, tobacco, wheat, sorghum, millet, quinoa, potato, sweet potato, rapeseed, cabbage, spinach, lettuce, cucumber, chrysanthemum, water spinach, celery, lettuce, or a combination thereof.

[0041] In another preferred embodiment, the plants include: rice, wheat, corn, and / or sorghum.

[0042] In another preferred embodiment, the rice is selected from the following group: indica rice, japonica rice, or a combination thereof.

[0043] In another preferred embodiment, the TPST gene is selected from the following group: cDNA sequence, genomic sequence, or a combination thereof.

[0044] In another preferred embodiment, the TPST gene comes from one or more plants selected from the following groups: Cruciferae, Poaceae, Solanaceae, Leguminosae, and Chenopodiaceae.

[0045] In another preferred embodiment, the TPST gene comes from one or more plants selected from the following group: Arabidopsis thaliana, rice, corn, sorghum, wheat, millet, Brachypodium distichum, and quinoa.

[0046] In another preferred example, the TPST gene is selected from the following group: the TPST gene of Arabidopsis thaliana (AtTPST, AT1G08030), the TPST gene of rice (OsTPST, accession number LOC9267276), the TPST gene of corn (corn ZmTPST, accession number LOC100280275), the TPST gene of sugarcane (sugarcane SbTPST, accession number LOC8071351), the TPST gene of camelina (camelina CsTPST, accession number LOC104754980), the TPST gene of rapeseed (rapeseed BrTPST, accession number LOC103871547), the TPST gene of radish (radish RsTPST, accession number LOC108862166), or a combination thereof.

[0047] In another preferred example, the TPST gene includes a wild-type TPST gene and a mutant TPST gene.

[0048] In another preferred embodiment, the mutants include mutant forms in which the function of the encoded protein is not changed after mutation (ie, the function is the same or substantially the same as that of the wild-type encoded protein) and mutant forms in which the function is enhanced.

[0049] In another preferred embodiment, the polypeptide encoded by the mutant TPST gene is identical or substantially identical to the polypeptide encoded by the wild-type TPST gene.

[0050] In another preferred embodiment, the mutant TPST gene comprises a polynucleotide having a homology ≥80% (preferably ≥90%, more preferably ≥95%, more preferably ≥98% or 99%) compared to the wild-type TPST gene.

[0051] In another preferred embodiment, the mutant TPST gene comprises a polynucleotide having 1-60 (preferably 1-30, more preferably 1-10) nucleotides truncated or added to the 5' end and / or 3' end of the wild-type TPST gene.

[0052] In another preferred embodiment, the amino acid sequence of the TPST protein is selected from the following group:

[0053] (i) a polypeptide having an amino acid sequence as shown in SEQ ID NO.: 3;

[0054] (ii) a polypeptide derived from (i) having the function of regulating plant traits formed by replacing, deleting or adding one or several (e.g., 1-10) amino acid residues in the amino acid sequence as shown in SEQ ID NO.: 3; or

[0055] (iii) a polypeptide having an amino acid sequence with ≥80% homology (preferably ≥90%, more preferably ≥95% or ≥98%) to the amino acid sequence of SEQ ID NO.: 3, and having the TPST activity.

[0056] In another preferred embodiment, the nucleotide sequence of the TPST gene is selected from the following group:

[0057] (a) a polynucleotide encoding the polypeptide shown in SEQ ID NO.: 3;

[0058] (b) a polynucleotide whose sequence is shown in any one of SEQ ID NO.: 1, 2 or 5;

[0059] (c) a polynucleotide having a nucleotide sequence homologous to any one of SEQ ID NO.: 1, 2 or 5 by ≥ 75% (preferably ≥ 85%, more preferably ≥ 90% or ≥ 95%);

[0060] (d) a polynucleotide having 1 to 60 (preferably 1 to 30, more preferably 1 to 10) nucleotides truncated or added to the 5' end and / or 3' end of the polynucleotide shown in any one of SEQ ID NO.: 1, 2 or 5;

[0061] (e) A polynucleotide complementary to the polynucleotide described in any one of (a) to (d).

[0062] The second aspect of the present invention provides a composition comprising:

[0063] (a) a promoter of the TPST gene or its encoded protein; and

[0064] (b) an agriculturally acceptable carrier.

[0065] In another preferred embodiment, the composition comprises an agricultural composition.

[0066] In another preferred embodiment, the dosage form of the composition is selected from the following group: solution, emulsion, suspension, powder, foam, paste, granule, aerosol, or a combination thereof.

[0067] In another preferred embodiment, the composition contains 0.0001-99 wt%, preferably 0.1-90 wt% of component (a), based on the total weight of the composition.

[0068] In another preferred embodiment, in the composition, the content (wt%) of the promoter of the TPST gene or its encoded protein is 0.05%-10%, preferably, 0.1%-8%, and more preferably, 0.5%-6%.

[0069] In another preferred embodiment, the promoter is selected from the following group: small molecule compounds, nucleic acid molecules, or a combination thereof.

[0070] In another preferred embodiment, the composition further comprises other substances that regulate plant traits.

[0071] In another preferred embodiment, the other substances for regulating plant traits include osmotic regulators, brassinolide, algae, fertilizers with high potassium, nitrogen or phosphorus content, trace elements (such as boron, zinc, calcium, silicon), triazole fungicides (such as difenoconazole, propiconazole, tebuconazole), high potassium foliar fertilizers, plant hormones (such as abscisic acid, ethylene, cytokinin, polyamines), rare earths, paclobutrazol (PP 333 ), benzoic acid, salicylic acid, uniconazole. In another preferred embodiment, the osmotic regulator is selected from the following group: inorganic regulators, organic regulators, growth regulators, or a combination thereof.

[0072] In another preferred embodiment, the inorganic regulator includes Ca 2+ , salicylic acid.

[0073] In another preferred embodiment, the organic regulator includes betaine, proline, and sodium nitroprusside (SNP).

[0074] In another preferred embodiment, the growth regulator includes: abscisic acid (ABA).

[0075] The third aspect of the present invention provides a use of the composition according to the second aspect of the present invention for improving plant traits.

[0076] A fourth aspect of the present invention provides a method for improving plant traits, comprising the steps of:

[0077] The expression amount and / or activity of the TPST gene or its encoded protein in the plant is increased, thereby improving the traits of the plant.

[0078] In another preferred embodiment, the method comprises administering a promoter of the plant TPST gene or its encoded protein.

[0079] In another preferred embodiment, the promoter is a substance that promotes the expression of the TPST gene or its encoded protein.

[0080] In another preferred embodiment, the promoter is selected from the following group: small molecule compounds, nucleic acid molecules, or a combination thereof.

[0081] In another preferred embodiment, the method comprises introducing an exogenous TPST gene into the plant.

[0082] In another preferred embodiment, the method comprises introducing into the plant a substance that promotes the expression of the endogenous TPST gene or its encoded protein.

[0083] In another preferred embodiment, the method comprises promoting the expression of endogenous TPST gene or its encoded protein in the plant.

[0084] In another preferred embodiment, the method comprises the steps of:

[0085] (i) providing a plant or plant cell; and

[0086] (ii) introducing the TPST gene sequence into the plant or plant cell, thereby obtaining a transgenic plant or plant cell.

[0087] In another preferred embodiment, the method comprises the steps of:

[0088] (a) providing Agrobacterium carrying an expression vector of a TPST gene sequence;

[0089] (b) contacting plant cells, tissues or organs with the Agrobacterium in step (a), so that the gene sequence of TPST is transferred into the plant cells and integrated into the chromosomes of the plant cells;

[0090] (c) selecting plant cells, tissues or organs into which the TPST gene sequence has been transferred; and

[0091] (d) regenerating the plant cell, tissue or organ in step (c) into a plant.

[0092] In another preferred embodiment, the expression level or activity of the TPST gene or its encoded protein in the plant tissue or plant cell is increased by ≥5%, ≥10%, ≥20%, and more preferably, ≥50%.

[0093] In another preferred embodiment, the “increase” refers to that the expression or activity of the TPST gene or its encoded protein is increased to meet the following conditions:

[0094] The ratio of A1 / A0 is ≥5%, more preferably ≥10%, more preferably ≥20%, and most preferably 50-200%; wherein A1 is the expression or activity of the TPST gene or its encoded protein in plant tissues or plant cells; A0 is the expression or activity of the same TPST gene or its encoded protein in wild-type plant tissues or plant cells of the same type.

[0095] In another preferred embodiment, the ratio of the activity E1 of TPST in the plant to the background activity E0 of the same TPST in the wild-type plant of the same type (E1 / E0) is ≥2 times, preferably ≥5 times, and more preferably ≥10 times.

[0096] A fifth aspect of the present invention provides a method for preparing genetically engineered plant tissues or plant cells, comprising the steps of:

[0097] The expression level and / or activity of the TPST gene or its encoded protein in plant tissues or plant cells is increased, thereby obtaining genetically engineered plant tissues or plant cells.

[0098] In another preferred embodiment, the genetic engineering includes transgenic.

[0099] In another preferred embodiment, the method further comprises introducing a promoter of the TPST gene or its encoded protein into plant tissues or plant cells.

[0100] A sixth aspect of the present invention provides a method for preparing a plant with improved traits, comprising the steps of:

[0101] The genetically engineered plant tissue or plant cell prepared by the method described in the fifth aspect of the present invention is regenerated into a plant body, thereby obtaining a plant with improved traits.

[0102] In another preferred embodiment, the traits include one or more traits selected from the following group:

[0103] (i) Stress resistance;

[0104] (ii) thousand-grain weight;

[0105] (iii) yield and / or biomass;

[0106] (iv) size, weight and / or number of fruits and / or seeds.

[0107] In another preferred embodiment, the traits further include one or more selected from the following group:

[0108] (iii) root length;

[0109] (iv) Root weight.

[0110] In another preferred embodiment, the trait improvement includes:

[0111] (i) enhancing plant stress resistance; and / or

[0112] (ii) increase thousand kernel weight; and / or

[0113] (iii) increase yield and / or biomass; and / or

[0114] (iv) increasing the size, weight and / or number of fruits and / or seeds.

[0115] In another preferred embodiment, the trait improvement further comprises:

[0116] (iii) increase root length; and / or

[0117] (iv) Increase root weight.

[0118] The seventh aspect of the present invention provides a genetically engineered plant, into which the TPST gene or its encoded protein, or its promoter is introduced, or the plant is prepared by the method described in the sixth aspect of the present invention.

[0119] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0120] Figure 1This is the detection of AtTPST gene expression in AtTPST transgenic T1 rice lines. Among them, control is the Nipponbare negative control transformed with the empty vector pCambia1305, among which P35S-3, 46, 51, 52 are TPST CDs transgenic rice lines driven by the 35S promoter; PTPST-31, 40, 46, 47 are transgenic rice lines driven by the Arabidopsis TPST endogenous promoter to drive the AtTPST genomic sequence.

[0121] Figure 2 Comparison of metal ion content in transgenic and wild-type rice seeds. Figure 2 A Potassium content, Figure 2 B Sodium content; control is the Nipponbare negative control transformed with the empty vector pCambia1305, P35S is the TPST CDs transgenic rice driven by the 35S promoter, and PTPST is the transgenic rice with the AtTPST genomic sequence driven by the Arabidopsis TPST endogenous promoter.

[0122] Figure 3 Comparison of grain weight between transgenic and wild-type rice seeds, where control is the Nipponbare negative control transformed with the empty vector pCambia1305, P35S is the TPST CDs transgenic rice driven by the 35S promoter, and PTPST is the transgenic rice with the AtTPST genomic sequence driven by the Arabidopsis TPST endogenous promoter.

[0123] Figure 4 To prove that AtTPST transgenic rice hydroponic seedlings have more developed root systems, Figure 4 A. Arabidopsis TPST endogenous promoter drives AtTPST genomic sequence transgenic lines 7 and 31, compared with Japonica and empty vector control transformed with Nipponbare negative control (control), all have more developed root systems; Figure 4 B. Arabidopsis TPST endogenous promoter drives AtTPST genomic sequence transgenic lines 7 and 31 and Nipponbare (Japonica), empty vector control transformed Nipponbare negative control (control), the root length is increased; Figure 4C Arabidopsis TPST endogenous promoter drives AtTPST genomic sequence transgenic strain No. 7 and strain No. 31 and Nipponbare (Japonica), empty vector control transformed Nipponbare negative control (control), the root fresh weight increased, and the aboveground part also increased; Japonica refers to Nipponbare; control refers to empty vector control transformed Nipponbare negative control; PTPST-7 refers to Arabidopsis TPST endogenous promoter drives AtTPST genomic sequence transgenic strain No. 7; PTPST-31 refers to Arabidopsis TPST endogenous promoter drives AtTPST genomic sequence transgenic strain No. 31.

[0124] Figure 5 The figure shows the drought resistance of AtTPST transgenic rice, where A: normally growing rice seedlings; B: 2-week-old rice seedlings that were de-watered and subjected to drought treatment for two weeks; C: 1 week after watering was resumed.

[0125] Figure 6 It was shown that increasing the expression of endogenous OsTPST in rice can improve the traits of rice plants. Figure 6 A shows the results of root growth of plants with AMV-enhanced OsTPST expression (AMV-OsTPST-1) and control plants (AMV Control). Increasing the expression of OsTPST in rice can promote root growth. Figure 6 B shows the development results of the plants with AMV-enhanced OsTPST expression (AMV Inserted Lines) and the control group (Control) and the plants with other non-AMV sequences inserted (DNA Fragment Inserted Line). Figure 6 B can clearly show that increasing the expression level of endogenous OsTPST in rice can make rice plants stronger at the seedling stage. DETAILED DESCRIPTION

[0126] After extensive and in-depth research, the inventors have discovered for the first time that increasing the expression or activity of the TPST gene or its encoded protein in the plant (such as rice) can significantly improve the plant's traits by studying and screening a large number of plant trait loci. On this basis, the inventors have completed the present invention.

[0127] Specifically, when the expression level or activity of the TPST gene or its encoded protein in the plant is increased, it is possible to (i) enhance plant stress resistance; and / or (ii) increase thousand-grain weight; and / or (iii) increase yield and / or biomass; and / or (iv) increase the size, weight and / or number of fruits and / or seeds; and / or (v) increase root length; and / or (vi) increase root weight.

[0128] TPST gene

[0129] TPST, or tyrosyl-protein sulfo-transferase, is involved in the post-translational sulfation modification of proteins. It transfers the sulfonic acid group of the substrate 3-phosphoadenosine-5-phosphosulfate (PAPS) to the tyrosine residue of the protein. This modification enables secretory proteins or membrane proteins to have mature biological functions. [1] .

[0130] As used herein, the terms "TPST gene of the present invention" and "TPST gene" are used interchangeably and refer to TPST genes or variants thereof derived from plants (such as rice and Arabidopsis). In a preferred embodiment, the nucleotide sequence of the TPST gene of the present invention is shown in SEQ ID NO.: 2. Variants of the gene can be obtained by inserting or deleting regulatory regions, performing random or site-directed mutagenesis, and the like.

[0131] The present invention also includes nucleic acids having 50% or more (preferably 60% or more, 70% or more, 80% or more, more preferably 90% or more, more preferably 95% or more, most preferably 98% or more, such as 99%) homology with the preferred gene sequence of the present invention (SEQ ID NO.: 2), which can also effectively regulate the traits of plants (such as rice). "Homology" refers to the level of similarity (i.e., sequence similarity or identity) between two or more nucleic acids according to the percentage of identical positions.

[0132] In the present invention, the nucleotide sequence in SEQ ID NO.: 2 can be substituted, deleted or added with one or more (usually 1-90, preferably 1-60, more preferably 1-20, and most preferably 1-10), and several (usually within 60, preferably within 30, more preferably within 10, and most preferably within 5) nucleotides can be added at the 5' and / or 3' end to generate a derivative sequence of SEQ ID NO.: 2. Due to the degeneracy of codons, even if the homology with SEQ ID NO.: 2 is low, it can basically encode the amino acid sequence shown in SEQ ID NO.: 3.

[0133] In addition, the meaning of "a nucleotide sequence in SEQ ID NO.: 2 that has been substituted, deleted or added with at least one nucleotide derivative sequence" also includes nucleotide sequences that can hybridize with the nucleotide sequence shown in SEQ ID NO.: 2 under moderately stringent conditions, and more preferably under highly stringent conditions. These variant forms include (but are not limited to): deletion, insertion and / or substitution of several (usually 1-90, preferably 1-60, more preferably 1-20, and most preferably 1-10) nucleotides, and addition of several (usually within 60, preferably within 30, more preferably within 10, and most preferably within 5) nucleotides at the 5' and / or 3' ends.

[0134] It should be understood that although the gene provided in the examples of the present invention is derived from Arabidopsis, the gene sequence of TPST derived from other similar plants (especially plants belonging to the same family or genus as Arabidopsis or plants of other families or genera with relatively high homology to Arabidopsis) and having a certain homology (conservativeness, such as having more than 80%, such as 85%, 90%, 95% or even 98% sequence identity) with the sequence of the present invention (preferably, the sequence is shown in SEQ ID NO.: 2) is also included in the scope of the present invention, as long as a person skilled in the art can easily isolate the sequence from other plants based on the information provided in the present application after reading the present application, and methods and tools for comparing sequence identity are also well known in the art, such as BLAST.

[0135] The polynucleotide of the present invention can be in the form of DNA or RNA. The DNA forms include: DNA, genomic DNA or artificially synthesized DNA, and the DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide can be the same as the coding region sequence shown in SEQ ID NO.: 2 or a degenerate variant.

[0136] The polynucleotide encoding the mature polypeptide includes: a coding sequence encoding only the mature polypeptide; a coding sequence of the mature polypeptide and various additional coding sequences; a coding sequence of the mature polypeptide (and optional additional coding sequences) and non-coding sequences.

[0137] The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, or may include a polynucleotide further including additional coding and / or non-coding sequences. The present invention also relates to variants of the above-mentioned polynucleotides, which encode fragments, analogs and derivatives of polyglycosides or polypeptides having the same amino acid sequence as the present invention. The variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a replacement form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but will not substantially change the function of the polypeptide encoded by it.

[0138] The present invention also relates to polynucleotides that hybridize to the above-mentioned sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "stringent conditions" refer to: (1) hybridization and elution at relatively low ionic strength and relatively high temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) addition of denaturing agents during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization occurs only when the identity between the two sequences is at least 90%, preferably at least 95%.

[0139] The full-length TPST nucleotide sequence of the present invention or its fragments can usually be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed based on the relevant nucleotide sequences disclosed in the present invention, especially the open reading frame sequences, and a commercially available DNA library or a cDNA library prepared by conventional methods known to those skilled in the art is used as a template to amplify the relevant sequence. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then splice the fragments amplified in each time together in the correct order. Once the relevant sequence is obtained, the relevant sequence can be obtained in large quantities by recombination. Usually, it is cloned into a vector, then transferred into cells, and then the relevant sequence is isolated from the proliferated host cells by conventional methods.

[0140] In addition, artificial synthesis methods can also be used to synthesize relevant sequences, especially when the fragment length is shorter. Usually, by synthesizing multiple small fragments first and then connecting them, very long fragments of the sequence can be obtained. At present, the DNA sequence encoding the protein of the present invention (or its fragment, or its derivative) can be obtained completely by chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (or such as vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequence of the present invention by chemical synthesis.

[0141] TPST gene encoded polypeptide

[0142] As used herein, the terms "polypeptide of the present invention" and "protein encoded by TPST gene" can be used interchangeably and refer to polypeptides and variants of TPST derived from plants. In a preferred embodiment, a typical amino acid sequence of the polypeptide of the present invention is shown in SEQ ID NO.:3.

[0143] The present invention relates to a TPST polypeptide and variants thereof for regulating plant traits. In a preferred embodiment of the present invention, the amino acid sequence of the polypeptide is shown in SEQ ID NO.: 3. The polypeptide of the present invention can effectively regulate the traits of plants (such as rice).

[0144] The present invention also includes polypeptides or proteins with the same or similar functions that have 50% or more (preferably 60% or more, 70% or more, 80% or more, more preferably 90% or more, more preferably 95% or more, most preferably 98% or more, such as 99%) homology with the sequence shown in SEQ ID NO.: 3 of the present invention.

[0145] The “same or similar functions” mentioned above mainly refer to: “regulating the properties of plants or crops (such as rice)”.

[0146] The polypeptide of the present invention can be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide. The polypeptide of the present invention can be a naturally purified product, or a chemically synthesized product, or produced using recombinant technology from a prokaryotic or eukaryotic host (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production scheme, the polypeptide of the present invention can be glycosylated, or can be non-glycosylated. The polypeptide of the present invention may also include or not include an initial methionine residue.

[0147] The present invention also includes TPST protein fragments and analogs having TPST protein activity. As used herein, the terms "fragment" and "analog" refer to polypeptides that substantially retain the same biological function or activity as the natural TPST protein of the present invention.

[0148] The polypeptide fragments, derivatives or analogs of the present invention may be: (i) polypeptides having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, and such substituted amino acid residues may or may not be encoded by the genetic code; or (ii) polypeptides having a substitution group in one or more amino acid residues; or (iii) polypeptides formed by fusion of a mature polypeptide with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (iv) polypeptides formed by fusion of an additional amino acid sequence to the polypeptide sequence (such as a leader sequence or secretory sequence or a sequence or proprotein sequence used to purify the polypeptide, or a fusion protein). According to the definition herein, these fragments, derivatives and analogs belong to the scope known to those skilled in the art.

[0149] In the present invention, the polypeptide variant is an amino acid sequence as shown in SEQ ID NO.: 3, a derivative sequence obtained by replacing, deleting or adding at least one amino acid, and adding one or more (usually within 20, preferably within 10, more preferably within 5) amino acids to the C-terminus and / or N-terminus. For example, in the protein, when amino acids with similar or similar properties are substituted, the function of the protein is usually not changed, and adding one or more amino acids to the C-terminus and / or N-terminus usually does not change the function of the protein. These conservative variations are preferably generated by substitution according to Table 1.

[0150] Table 1

[0151]

[0152]

[0153] The present invention also includes analogs of the claimed proteins. The difference between these analogs and the natural SEQ ID NO.: 3 may be a difference in the amino acid sequence, or a difference in the form of modification that does not affect the sequence, or both. The analogs of these proteins include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by radiation or exposure to mutagens, or by site-directed mutagenesis or other known biological techniques. Analogs also include analogs with residues different from natural L-amino acids (such as D-amino acids), and analogs with non-natural or synthetic amino acids (such as β, γ-amino acids). It should be understood that the proteins of the present invention are not limited to the representative proteins exemplified above.

[0154] Modifications (usually without altering the primary structure) include: chemical derivatization of proteins in vivo or in vitro such as acetylating or carboxylating. Modifications also include glycosylation, such as those carried out during protein synthesis and processing. Such modifications can be accomplished by exposing the protein to glycosylation enzymes (such as mammalian glycosylases or deglycosylases). Modifications also include sequences with phosphorylated amino acid residues (such as phosphotyrosine, phosphoserine, phosphothreonine).

[0155] Expression vector

[0156] The present invention also relates to a vector comprising the polynucleotide of the present invention, a host cell produced by genetic engineering using the vector of the present invention or the mutant protein coding sequence of the present invention, and a method for producing the polypeptide of the present invention by recombinant technology.

[0157] The polynucleotide sequences of the present invention can be used to express or produce the protein or its variants of the present invention by conventional recombinant DNA techniques. Generally, the following steps are involved:

[0158] (1) Transforming or transducing a suitable host cell with a polynucleotide encoding the protein of the present invention or a variant thereof, or with a recombinant expression vector containing the polynucleotide;

[0159] (2) Host cells cultured in a suitable culture medium;

[0160] (3) Isolate and purify proteins from culture medium or cells.

[0161] The present invention also provides a recombinant vector comprising the gene of the present invention. As a preferred mode, the promoter downstream of the recombinant vector comprises a multiple cloning site or at least one restriction site. When it is necessary to express the target gene of the present invention, the target gene is connected into a suitable multiple cloning site or restriction site, so that the target gene is operably connected to the promoter. As another preferred mode, the recombinant vector comprises (from 5' to 3' direction): a promoter, a target gene, and a terminator. If necessary, the recombinant vector may also include an element selected from the following group: a 3' polynucleotide signal; a non-translated nucleic acid sequence; a transport and targeting nucleic acid sequence; a resistance selection marker (dihydrofolate reductase, neomycin resistance, hygromycin resistance, and fluorescent protein, etc.); an enhancer; or an operator.

[0162] In the present invention, the polynucleotide sequence encoding the protein can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. As long as they can replicate and be stable in the host, any plasmid and vector can be used. An important feature of an expression vector is that it usually contains a replication origin, a promoter, a marker gene and a translation control element.

[0163] Methods well known to those skilled in the art can be used to construct expression vectors containing the protein encoding DNA sequence of the present invention and appropriate transcription / translation control signals. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. When using the gene of the present invention to construct a recombinant expression vector, any enhancing, constitutive, tissue-specific or inducible promoter can be added before its transcription initiation nucleotide.

[0164] The DNA sequence can be effectively linked to an appropriate promoter in the expression vector to direct mRNA synthesis. Representative examples of these promoters include: lac or trp promoters of Escherichia coli; λ phage PL promoter; eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter, LTRs of retroviruses and other known promoters that can control gene expression in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

[0165] The vectors including the gene, expression cassette or of the present invention can be used to transform appropriate host cells so that the host expresses the protein. The host cell can be a prokaryotic cell, such as Escherichia coli, Streptomyces, Agrobacterium; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a plant cell. Those skilled in the art are aware of how to select appropriate vectors and host cells. Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism (such as Escherichia coli), competent cells that can absorb DNA can be harvested after the exponential growth phase and treated with the CaCl2 method, and the steps used are well known in the art. Another method is to use MgCl2. If necessary, transformation can also be carried out by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be selected: calcium phosphate coprecipitation method, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0166] Plant transformation can also be carried out by Agrobacterium transformation or gene gun transformation, for example, leaf disc method, young embryo transformation method, flower bud immersion method, etc. Transformed plant cells, tissues or organs can be regenerated into plants by conventional methods to obtain transgenic plants.

[0167] In addition, the expression vector preferably contains one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for Escherichia coli.

[0168] The vector containing the above-mentioned appropriate DNA sequence and an appropriate promoter or control sequence can be used to transform appropriate host cells to enable them to express proteins.

[0169] The host cell can be a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells such as yeast, plant cells (such as rice cells).

[0170] When the polynucleotide of the present invention is expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. Enhancers are cis-acting factors of DNA, usually about 10 to 300 base pairs, which act on the promoter to enhance gene transcription. Examples include the SV40 enhancer of 100 to 270 base pairs on the late side of the replication origin, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

[0171] Those skilled in the art will appreciate how to select appropriate vectors, promoters, enhancers and host cells.

[0172] The obtained transformant can be cultured by conventional methods to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the culture medium used in the culture can be selected from various conventional culture media. Culture is carried out under conditions suitable for the growth of the host cells. After the host cells grow to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0173] The protein of the present invention can be expressed in cells, on cell membranes, or secreted outside cells. If necessary, the recombinant protein can be separated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of these methods include but are not limited to: conventional renaturation treatment, treatment with protein precipitants (salting out method), centrifugation, osmotic sterilization, ultra-treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography techniques and combinations of these methods.

[0174] Improving plant traits

[0175] The present invention also provides a method for improving plant traits, specifically, promoting or increasing the expression of the TPST gene or its encoded protein, thereby improving the plant traits, wherein the traits are selected from one or more of the following groups:

[0176] (i) Stress resistance;

[0177] (ii) Thousand-grain weight.

[0178] (iii) yield and / or biomass;

[0179] (iv) size, weight and / or number of fruits and / or seeds.

[0180] In a preferred embodiment, the traits further include one or more selected from the following group:

[0181] (v) root length;

[0182] (vi) Root weight.

[0183] In a preferred embodiment, the traits of the improved plant include:

[0184] (i) enhancing plant stress resistance; and / or

[0185] (ii) increase thousand kernel weight; and / or

[0186] (iii) increase yield and / or biomass; and / or

[0187] (iv) increasing the size, weight and / or number of fruits and / or seeds.

[0188] In a preferred embodiment, the traits of the improved plant further include:

[0189] (v) increase root length; and / or

[0190] (vi) Increase root weight.

[0191] The main advantages of the present invention include:

[0192] (1) The present invention first discovered that increasing the content of the TPST gene in plants or upregulating the expression of the gene can improve the agronomic traits of the plants, such as stress resistance, 1000-grain weight, yield, biomass, fruit or seed size, weight, number, root length, root weight, etc.

[0193] (2) The present invention first discovered that using an Arabidopsis endogenous promoter to drive the expression of the Arabidopsis AtTPST gene in rice or increasing the expression of the rice endogenous OsTPST gene can promote the root development of rice in the seedling stage, which is bound to be beneficial to the growth of the aboveground part of rice under natural cultivation conditions and has the effect of strengthening the seedlings. A developed and strong root system can also make rice have excellent growth traits of drought resistance and barrenness resistance, and promote the strength of rice plants in the later stage from many aspects. Moreover, this gene-transformed rice can increase the thousand-grain weight of grains, directly promote rice yield, and make the plant have excellent yield traits. It is the most direct and effective solution to the problems of food shortage and efficient land use.

[0194] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in the examples are all commercially available products.

[0195] Example 1 Acquisition of TPST gene:

[0196] 1) TPST gene promoter and genomic sequence cloning

[0197] The total volume of the reaction system was 25 μL, and the template was Arabidopsis genomic DNA for gene cloning to obtain the full-length sequence of the TPST gene (SEQ ID NO: 1), the promoter sequence was shown in SEQ ID NO: 4, and the genome sequence was shown in SEQ ID NO: 5.

[0198] The primers used (designed by the inventors) are as follows:

[0199] TPST-F:GTAAGCTTCATGGGAGCTCCA (SEQ ID NO.:6);

[0200] TPST-R:AATCTTAACTTTGGAGGTTCTTCT (SEQ ID NO.:7).

[0201] Reaction system:

[0202]

[0203] Add water to 50 μL.

[0204] Amplification process: 98°C for 2 min;

[0205] (98℃20sec; 58℃30min; 72℃90sec) for 30cycles;

[0206] 72℃5min.

[0207] 2) Cloning of TPST CDS gene sequence

[0208] The total volume of the reaction system was 25 μL, and the template was Arabidopsis thaliana cDNA for gene cloning to obtain the TPST CDS sequence (sequence shown in SEQ ID NO: 2), and the amino acid sequence encoded by the gene was shown in SEQ ID NO: 3;

[0209] The primers used (designed by the inventors) are as follows:

[0210] TPST-CDS-F:ATGCAAATGAACTCTGTTTGGA (SEQ ID NO.:8);

[0211] TPST-CDS-R:AATCTTAACTTTGGAGGTTCTTCT (SEQ ID NO.:9).

[0212] Reaction system:

[0213]

[0214] Add water to 50 μL

[0215] Amplification process: 98°C for 2 min;

[0216] (98℃20sec; 58℃30min; 72℃90sec) for 30cycles;

[0217] 72℃5min.

[0218] Example 2: Construction and trait analysis of transgenic plants

[0219] 1. Construction of transgenic vector

[0220] 1) Construction of TPST gene transgenic vector

[0221] The sequence shown in SEQ ID NO: 1 was cloned into the pCambia1305 vector, fused with the HA (influenza hemagglutinin epitope: YPYDVPDYA (SEQ ID NO.: 10)) tag for expression, and a TPST gene transgenic vector was constructed.

[0222] 2) Construction of 35S-TPST transgenic vector

[0223] The sequence shown in SEQ ID NO: 2 was cloned into the pCambia1305 vector and fused with the HA tag for expression to construct a 35S-TPST gene transgenic vector.

[0224] 2. Rice genetic transformation

[0225] Rice genetic transformation was carried out using the Agrobacterium EHA105-mediated genetic transformation method, as follows:

[0226] After the mature rice seeds are shelled and disinfected with mercuric chloride, they are cultured in the dark at 26°C on a callus induction medium for 30 days; the induced calli are cultured on a subculture medium for 15 days; the bright yellow calli are selected and soaked in a culture medium containing Agrobacterium carrying the target vector for 30 minutes, blown dry, and cultured on a co-culture medium at 18°C ​​for 2 days; the calli are washed with sterile water, blown dry, and placed on a resistance screening medium for 2 rounds of resistance screening, each for 15 days; the obtained resistant calli are transferred to a differentiation medium, differentiated in a light culture room for about 40 days to produce regenerated plants; the regenerated plants are transferred to a rooting medium for culture for 10 days, and transplanted after 3-5 days of seedling hardening.

[0227] 3. Transplantation, Expression Identification and Phenotypic Analysis

[0228] The rooted transgenic plants were genetically constructed into lines and transplanted to the greenhouse, and leaves were taken for real-time qRT-PCR expression identification.

[0229] The primers used (designed by the inventors) are:

[0230] qTPST-1FTTACTTCTTAGCTCAGTATTGGC(SEQ ID NO.:11)

[0231] qTPST-1R CAATGAAAATATGTTCTGCCTCCA (SEQ ID NO.:12)

[0232] Reaction system:

[0233]

[0234] Add water to 15 μL

[0235] Amplification process: 98°C for 2 min; (98°C for 20 sec; 60°C for 30 sec) for 45 cycles;

[0236] Add a blend curve.

[0237] 4. Results

[0238] 1) Detection of AtTPST gene expression in AtTPST transgenic T1 rice

[0239] like Figure 1 After germination of seeds of T1 transgenic rice lines, total RNA was extracted and RT-qPCR was performed. Compared with the negative control transformed with an empty vector, AtTPST gene transcripts were detected in the AtTPST expression lines P35-3 / 46 / 51 / 52 driven by the PCMV35S promoter and the AtTPST gene transgenic rice lines PTPST-31 / 40 / 46 / 47 driven by the AtTPST endogenous promoter. In the tested lines, the activity of the AtTPST endogenous promoter was significantly higher than that of the CMV35S promoter line, and the transcriptional activity was 3.5 times higher on average in the T1 generation of rice.

[0240] 2) Phenotypic identification of AtTPST transgenic T1 rice

[0241] Please refer to the identification results Figure 2-4 The metal ion content of AtTPST transgenic rice seeds was significantly different from that of the control, especially the higher K content. The K content of AtTPST transgenic plants was 130% higher than that of the control group ( Figure 2 A), and lower Na content, about 50% of the control group ( Figure 2 B).

[0242] In terms of thousand-grain weight, the seeds of transgenic plants were heavier than those of the control, with an average weight increase of about 15% ( Figure 3 ).

[0243] AtTPST transgenic rice seedlings have a more developed root system, with root length increased by more than 14% and root weight increased by more than 60%. Figure 4 A- Figure 4 C), among which, Arabidopsis TPST endogenous promoter driving AtTPST genomic sequence transgenic strains 7 and 31 and Nipponbare (Japonica), empty vector control transformed Nipponbare negative control (control) all had more developed root systems ( Figure 4 A), the root length increased significantly ( Figure 4 B), the root fresh weight increased significantly, and the aboveground part also increased ( Figure 4 C).

[0244] 3) Drought resistance test of AtTPST transgenic T1 rice

[0245] Soak the seeds in water for three days to germinate. Weigh an equal amount of dry soil into a flower pot, place the flower pot on the same tray, and water until the upper soil is moist. Plant the germinated seeds in the soil. Cultivate in a greenhouse. Ensure that the upper soil is moist before drought treatment. Stop watering the rice seedlings after two weeks of growth, and observe phenotypic changes after two weeks of growth. Then resume watering and grow for 1 week, and observe phenotypic changes.

[0246] The results showed that under normal conditions, there was no significant difference between the wild-type group and the vector control group. Figure 5 A. After two weeks of drought treatment, the growth of seedlings in the wild-type group and the vector control group was significantly inhibited. Compared with the transgenic plants, the plant height was significantly shorter and the leaves were more wilted. Figure 5 B. After rehydration, the seedlings of the wild type group and the vector control group showed no significant improvement, while the transgenic plants showed some improvement. Figure 5 C.

[0247] 5. Conclusion

[0248] The increase of TPST content can reduce the Na / K ratio in plants, thereby enhancing the salt resistance of plants; at the same time, it can significantly increase the thousand-grain weight of seeds, thereby increasing the yield of crops; it can significantly increase the root length and weight of plants, thereby improving the drought resistance, disease and pest resistance, lodging resistance of plants, and enhancing environmental adaptability. This shows that TPST has important scientific application value in cultivating new high-yield and stress-resistant plant varieties.

[0249] Example 3 Experiment on enhancing the expression of endogenous TPST (OsTPST) gene in rice

[0250] Furthermore, the inventors will increase the expression of OsTPST in rice by the following method:

[0251] (1) Increasing the endogenous content of OsTPST by introducing OsTPST-related genes into rice;

[0252] (2) inserting OsTPST after endogenous strong promoters such as UBQ1, UBQ2, UBI9 or ACT2 to increase their expression;

[0253] (3) Inserting AHD and / or AMV upstream or downstream of the OsTPST promoter promotes the expression of OsTPST and increases its expression level. For example, a CRISPR vector targeting the 5′UTR position of OsTPST (accession number LOC9267276) (AMVKI sgRNA: CCGCCTCGAACCGGGGCCG) was constructed and transferred into Nipponbare rice callus together with the AMV enhancer sequence using a gene gun. By testing the T1 generation plants, homozygous plants with AMV insertion and homozygous strains with other non-AMV sequence insertions can be detected. The insertion of AMV can enhance the expression of OsTPST. Figure 6 As shown in (AB), increasing the expression level of endogenous OsTPST in rice can make rice plants stronger at the seedling stage and the root system longer and stronger.

[0254] In addition, by knocking out the endogenous OsTPST gene in rice, it was found that the knockout plants showed significant developmental defects or root development defects, which also suggested that the OsTPST gene has an indispensable and important function in rice development.

[0255] The above method can significantly enhance the expression of endogenous TPST in rice and improve some traits of rice, such as increasing the thousand-grain weight of rice, enhancing stress resistance, increasing root length and root weight, etc. This method provides a new means for improving plant traits.

[0256] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

[0257] References

[0258] [1]Moore KL(2003).The biology and enzymology of protein tyrosineOsulfation.J Biol Chem, 278(27):24243-24246.

Claims

1. A method for improving plant traits, characterized in that: The method comprises the steps of: increasing the expression amount of the TPST gene or its encoded protein in the plant, thereby improving the traits of the plant, wherein the plant is rice; The traits of the improved plants are: increased thousand-grain weight; The TPST gene is derived from Arabidopsis thaliana, and the amino acid sequence encoded by the TPST gene is shown in SEQ ID NO.: 3; or, The TPST gene is derived from rice, and the accession number of the TPST gene is LOC9267276; The method comprises the steps of: (a) providing Agrobacterium carrying an expression vector of a TPST gene sequence; (b) contacting plant cells, tissues or organs with the Agrobacterium in step (a), so that the gene sequence of TPST is transferred into the plant cells and integrated into the chromosomes of the plant cells; (c) selecting plant cells, tissues or organs into which the TPST gene sequence has been transferred; (d) regenerating the plant cell, tissue or organ in step (c) into a plant.

2. A method for preparing a plant with improved traits, characterized in that: The method comprises the steps of: increasing the expression level of the TPST gene or its encoded protein in plant tissues or plant cells, thereby obtaining genetically engineered plant tissues or plant cells, and then regenerating them into plant bodies, thereby obtaining plants with improved traits; The properties of the plant are: increased thousand-grain weight; The TPST gene is derived from Arabidopsis thaliana, and the amino acid sequence encoded by the TPST gene is shown in SEQ ID NO.: 3; or, The TPST gene is derived from rice, and the accession number of the TPST gene is LOC9267276; The plant is rice; The method comprises the steps of: (a) providing Agrobacterium carrying an expression vector of a TPST gene sequence; (b) contacting plant cells, tissues or organs with the Agrobacterium in step (a), so that the gene sequence of TPST is transferred into the plant cells and integrated into the chromosomes of the plant cells; (c) selecting plant cells, tissues or organs into which the TPST gene sequence has been transferred; (d) regenerating the plant cell, tissue or organ in step (c) into a plant.

Images