Recombinant Escherichia coli expressing glucose glycosyltransferase and its application

Abstract

The present invention discloses a recombinant Escherichia coli expressing glucose glycosyltransferase and its application, belonging to the fields of genetic engineering technology and biomedicine. Glucose glycosyltransferases with amino acid sequences such as SEQ ID NO.10-SEQ ID NO.17 were heterologously expressed in Escherichia coli BL21 (DE3) △ pgi and induced with 0.5 μmol / L IPTG at 16°C for 20 hours. SDS-PAGE results showed that the 8 screened glucose glycosyltransferases could all be expressed normally. Glucose glycosyltransferases UGT73C7 or UGT73C8, as well as UGT73AH1 reported in the literature, were simultaneously transferred into Escherichia coli BL21 (DE3) △ pgi. Whether it was shake flask fermentation verification or in vitro crude enzyme liquid reaction, a new peak different from the blank control appeared at 7.92 minutes, with the same mass spectrometry data as asiatic acid disoside, confirming the production of asiatic acid disoside, which makes the biosynthesis of asiaticoside possible.

Description

Technical Field

[0001] The invention relates to a recombinant Escherichia coli expressing glucose glycosyltransferase and application thereof, belonging to the field of bioengineering. Background Art

[0002] Centella asiatica is the dried whole herb of the Apiaceae family. Its chemical components include triterpenoid saponins, triterpenoid acids, polyacetylenes, and volatile oils. It is also rich in various bioactive substances, the main components of which are triterpenoids and their saponin compounds, asiaticoside B, madecassoside, and asiaticoside.

[0003] Triterpenoids are widely found in fungi, ferns, monocots, dicots, and animals, particularly dicots. The primary biological activity of Centella asiatica leaf extracts is due to these saponins, with asiaticoside exhibiting a wide range of biological activities, including anticancer, anti-inflammatory and wound healing, anti-diabetic, antioxidant and liver-protective, anti-hepatitis C virus (HCV) and neuroprotective properties. However, as an important group of plant secondary metabolites, asiaticoside has a complex structure and is relatively low in plant content. Furthermore, most of these compounds can mix with compounds of similar structures, making it difficult to obtain large quantities of triterpenoid monomers through plant extraction or chemical synthesis, thus limiting their application in food, medicine, cosmetics, and other fields. With the rapid development of sequencing technology, an increasing number of enzymes involved in the terpene synthesis pathway have been discovered and identified, enabling the elucidation of the terpene synthesis pathway. Furthermore, the rapid development of synthetic biology has made the construction of microbial cell factories to produce compounds with significant pharmaceutical value, such as terpenes, a research hotspot.

[0004] Over the past few decades, relatively little progress has been made in the functional characterization of UGT genes involved in triterpenoid biosynthesis, likely due to the large number of UGT homologs encoded by plant genomes. Currently, the biosynthesis pathway of asiaticoside remains incompletely elucidated, and studies suggest that a three-step glycosylation process is required from asiatic acid to asiaticoside. Costa et al. reported that UGT73AD1 in Centella asiatica acts as a linker to the carboxyl group of glucose and, through in vitro expression, confirmed that UGT73AD1 specifically glycosylates asiatic acid and madecassic acid. Kim et al. identified the glycosyltransferase UGT73AH1 from Centella asiatica (L.) Urban. This enzyme glycosylates the C28-COOH residue of asiatic acid to produce the corresponding monoglycoside, but its catalytic activity at other positions, C-2α, C-3β, and C23-OH, remains unknown. Furthermore, the glycosyltransferases responsible for the last two steps of the three-step glycosylation remain unknown. Therefore, it is necessary to further analyze the synthesis pathway of Centella asiatica glycoside and explore the glycosyltransferase that can glycosylate Centella asiatica acid. Summary of the Invention

[0005] The present invention conducts second-generation transcriptome sequencing on Centella asiatica plants and utilizes bioinformatics methods such as BLAST alignment, protein modeling, molecular docking, and phylogenetic tree analysis to explore potential functional glucose glycosyltransferases, which are then expressed and verified in Escherichia coli. By exogenously adding the substrate asiatic acid, a recombinant Escherichia coli that can synthesize asiatic acid disoside is constructed.

[0006] The first object of the present invention is to provide the use of glucose glycosyltransferase in the preparation of asiatic acid bioside or asiaticoside, wherein the glucose glycosyltransferase is as follows (a) or (b):

[0007] (a) the amino acid sequence is shown in any one of SEQ ID NO. 10 to SEQ ID NO. 17;

[0008] (b) A protein derived from (a) having glucose glycosyltransferase activity, wherein the amino acid sequence in (a) is substituted, deleted or added with one or more amino acids.

[0009] In one embodiment, the nucleotide sequence encoding the glucose glycosyltransferase gene is shown in any one of SEQ ID NO.1 to SEQ ID NO.8.

[0010] The second object of the present invention is to provide a recombinant Escherichia coli, which uses Escherichia coli as a host and overexpresses glucose glycosyltransferase and glycosyltransferase UGT73AH1.

[0011] In one embodiment of the present invention, the glucose glycosyltransferase is as follows (a) or (b):

[0012] (a) the amino acid sequence is shown in any one of SEQ ID NO. 10 to SEQ ID NO. 17;

[0013] (b) A protein derived from (a) having glucose glycosyltransferase activity, wherein the amino acid sequence in (a) is substituted, deleted or added with one or more amino acids.

[0014] In one embodiment of the present invention, the recombinant Escherichia coli also knocks out the glucose phosphate isomerase protein encoding gene pgi on the genome.

[0015] In one embodiment of the present invention, the nucleotide sequence of the glucose phosphotisomerase protein encoding gene pgi is shown as SEQ ID NO.18.

[0016] In one embodiment of the present invention, the glycosyltransferase UGT73AH1 is derived from Centella asiatica (L.) Urban.

[0017] In one embodiment of the present invention, the nucleotide sequence of the glycosyltransferase UGT73AH1 is shown as SEQ ID NO.9, and the amino acid sequence is shown as SEQ ID NO.19.

[0018] In one embodiment of the present invention, the recombinant Escherichia coli expresses glucose glycosyltransferase using the pETDuet-1 vector and expresses glycosyltransferase UGT73AH1 using the pET series vector.

[0019] In one embodiment of the present invention, the recombinant Escherichia coli uses Escherichia coli BL21 (DE3) as a host.

[0020] The third object of the present invention is to provide the use of the above-mentioned recombinant Escherichia coli in the synthesis of asiatic acid bioside or asiaticoside.

[0021] The fourth object of the present invention is to provide a method for producing asiatic acid bioside, wherein the method comprises inoculating the seed liquid of the recombinant Escherichia coli into a fermentation medium, and shaking and culturing at 35-38°C and 200-240 rpm until the OD 600 When the value is 0.6-0.8, add isopropylthiogalactoside to a final concentration of 0.4-0.6 μmol / L. After 4-8 hours, add asiatic acid to a final concentration of 150-250 mg / L. Continue shaking and incubate at 28-32°C and 200-240 rpm for 40-60 hours.

[0022] Alternatively, glucose glycosyltransferase and glycosyltransferase UGT73AH1 are used as catalysts in a reaction solution containing a final concentration of 0.8-1.2 g / L glycosyl donor UDPG and 150-250 mg / L substrate asiatic acid, and the reaction is carried out at 35-38° C. for 4-10 hours.

[0023] In one embodiment of the present invention, the fermentation medium comprises 15-25 g / L glucose, 4-6 g / L glycerol, 14-18 g / L K2HPO4·3H2O, 1-3 g / L KH2PO4, 20-30 g / L yeast powder, and 10-15 g / L peptone.

[0024] In one embodiment of the present invention, the glucose glycosyltransferase is as follows (a) or (b):

[0025] (a) the amino acid sequence is shown in any one of SEQ ID NO. 10 to SEQ ID NO. 17;

[0026] (b) A protein derived from (a) having glucose glycosyltransferase activity, wherein the amino acid sequence in (a) is substituted, deleted or added with one or more amino acids.

[0027] In one embodiment of the present invention, the glycosyltransferase UGT73AH1 is derived from Centella asiatica (L.) Urban.

[0028] In one embodiment of the present invention, the amino acid sequence of the glycosyltransferase UGT73AH1 is shown in SEQ ID NO.19.

[0029] Beneficial effects of the present invention:

[0030] (1) The present invention connects the glucose glycosyltransferase encoding genes screened by Centella asiatica transcriptome sequencing to the Escherichia coli expression vector pETDuet-1 and induces expression in the Escherichia coli host BL21 (DE3) Δpgi. The cells are induced with 0.5 μmol / L IPTG at 16°C for 20 h, and the cells are collected and ultrasonically disrupted. SDS-PAGE results show that all eight screened glucose glycosyltransferases can be expressed normally.

[0031] (2) The coding genes of the eight selected glucose glycosyltransferases were ligated to the E. coli expression vector pETDuet-1. At the same time, the C-28 glucose glycosyltransferase UGT73AH1 reported in the literature was ligated to the E. coli expression vector pET28a. The recombinant E. coli was constructed using E. coli BL21 (DE3) △ pgi as the host. The expression was induced under certain culture conditions. The empty vector pETDuet-1 was used as the blank control for shake flask fermentation. TB culture medium was added with 20 g / L glucose and the substrate Centella asiatica was added to a final concentration of 200 mg / L. Samples were taken for detection after 24 hours. As can be seen from the mass spectrum, UGT73AH1, UGT73C7, and UGT73C8 were simultaneously transferred into the BL21 (DE3) △ pgi strain. A new peak different from the blank control appeared at 7.92 min, with the same mass spectrum data as Centella asiatica disoside, confirming the production of Centella asiatica disoside in the fermentation broth.

[0032] (3) The coding genes of the eight selected glucose glycosyltransferases were ligated to the E. coli expression vector pETDuet-1, and recombinant E. coli was constructed using the E. coli host BL21 (DE3) △ pgi as the host. The expression was induced under certain culture conditions. The empty vector pETDuet-1 was used as a blank control. The cells were induced with 0.5 μmol / L IPTG at 16°C for 20 h. The cells were collected and ultrasonically disrupted to obtain a crude enzyme solution. The total enzyme reaction system was 500 μl, the crude enzyme solution was 100 μl, the final concentration of UDPG added was 1 g / L, the final concentration of the substrate Centella asiatica was added was 200 mg / L, and the rest was made up to 500 μl with PBS buffer. The reaction was incubated at 37°C for 6 h. It can be seen from the mass spectrum that when UGT73AH1, UGT73C7 and UGT73C8 were simultaneously transferred into the BL21(DE3)△pgi strain, a new peak different from the blank control appeared at 7.92 min, with the same mass spectrum data as Centella asiatica disoside, confirming the production of Centella asiatica disoside in the reaction solution. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 :SDS-PAGE electrophoresis results of UGT73 recombinant E. coli expression. Figure A: supernatant; Figure B: precipitate;

[0034] Figure 2 : Results of shake flask fermentation of recombinant E. coli UGT73 and UGT73AH1. Panel A: Liquid phase of empty vector; Panel B: Liquid phase of UGTs glycosylation products.

[0035] Figure 3 : Mass spectra of shake flask fermentation of recombinant E. coli UGT73 and UGT73AH1. Panel A: Positive ion fragmentation; Panel B: Negative ion fragmentation;

[0036] Figure 4 Mass spectra of crude enzyme solutions of recombinant E. coli UGT73 and UGT73AH1. Panel A: Positive ion fragmentation; Panel B: Negative ion fragmentation. DETAILED DESCRIPTION

[0037] (1) Culture medium

[0038] Seed culture medium (LB): peptone 10 g / L, yeast extract 5 g / L, sodium chloride 5 g / L; solid culture medium was supplemented with 2% (mass fraction) agar powder.

[0039] Fermentation medium (TB): 20 g / L glucose, 5 g / L glycerol, 16.4 g / L K2HPO4·3H2O, 2.31 g / L KH2PO4, 24 g / L yeast extract, and 12 g / L peptone. 20 g / L glucose was sterilized separately and mixed before inoculation.

[0040] (2) PCR reaction system and amplification conditions

[0041] 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 20 ng of template DNA, 25 μL of 2× Phanta Max MasterMix, and double-distilled water to 50 μL. Amplification conditions: 95°C pre-deformation for 3 minutes, followed by 30 cycles (95°C for 15 seconds, 55°C for 15 seconds, and 72°C for 15 seconds), followed by extension at 72°C for 10 minutes.

[0042] (III) Preparation of competent E. coli

[0043] The CRISPR / Cas9 system was used to edit the genome of Escherichia coli BL21(DE3) to construct Escherichia coli BL21(DE3)△pgi. The pTarget plasmids used for knockout were constructed by PCR-mediated point mutagenesis, and the template pTarget plasmids were stored in the laboratory. Primers P21pgi-F and P21pgi-R were used to construct the pTarget-pgi plasmid, and PPGI-UPARM-F / R and PPGI-downARM-F / R were used to construct the homology arms used for knockout. For specific operation methods, please refer to the literature: Li Q, Sun B, Chen J, et al. A modified pCas / pTargetF system for CRISPR-Cas9-assisted genome editing in Escherichia coli[J]. Biochimica et Biophysica Sinica, 2021, 53(5):8.

[0044] P21pgi-F:

[0045] AGTTGCTGGCCTGATTGGCATCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG CT;

[0046] P21pgi-R:

[0047] AAACGATGCCAATCAGCGCCAGCACTAGTATTATACCTAGGACTGAGCTAG;

[0048] 21-PGI-UPARM-F:cctcgtgtcaggggatccattttc;

[0049] 21-PGI-UPARM-R:tgatccggcaaacaaaccaccgctggtagccacggcgcggttttcagtgc;

[0050] 21-PGI-DOWNARM-F:gctaccagcggtggtttgtttgccggatcattgagcaggaatatcgtgatcagg;

[0051] 21-PGIDOWNARM-R:tttacccaaaaacatttcgggcg;

[0052] Streak the BL21(DE3)Δpgi glycerol tube onto the corresponding LB plate and culture at 37°C overnight (about 12 hours). After 12 hours, pick out the flat, round, and growing bacteria and inoculate them into a 50mL shake flask containing 5mL LB medium. Incubate at 37°C and 220rpm for about 8-10 hours. Transfer the inoculum to a 250mL Erlenmeyer flask containing 50mL LB at 1% inoculum. Incubate at 37°C and 220rpm for about 2 hours until the OD reaches 0. 600 =0.6-0.8; transfer the bacterial solution to a 50 mL centrifuge tube and place on ice for about 10-15 minutes; centrifuge at 4000 rpm and 4°C for 5 minutes, and remove the supernatant; add 5 mL of solution A to resuspend; centrifuge at 4000 rpm and 4°C for 5 minutes, and remove the supernatant; add 5 mL of solution B to resuspend the bacteria, and aliquot into 100 μL portions, and store at -80°C.

[0053] (IV) Transformation of Escherichia coli

[0054] Thaw E. coli competent cells on ice; add 10 μL of recombinant product to 100 μL of competent cells and let it stand on ice for 30 min; heat shock in a 42°C water bath for 45 s and let it stand on ice for 2 min; add 1 mL of LB medium and incubate at 37°C, 220 rpm for 60 min; centrifuge at 4000 rpm for 2 min, remove 900 μL of supernatant, resuspend the cells in the remaining medium, and spread on the corresponding resistance plate.

[0055] (V) Identification of Centella asiatica disoside: After the fermentation, 2 mL of fermentation broth was added with an equal volume of methanol, and the mixture was vigorously shaken and mixed. The mixture was centrifuged at 14,000 rpm for 10 min. The supernatant was filtered through a 0.22 μm organic phase filter membrane and the product was identified using Shimadzu UPLC-IT-TOF / MS.

[0056] (6) HPLC determination of Centella asiatica disoside: Chromatographic separation was performed using a Thermo Fisher C18 column (4.6 mm × 250 mm, 5 μm); the column oven temperature was set to 40°C; the injection volume was 10 μL; the mobile phases were: phase A was ultrapure water (with the addition of 0.1% trifluoroacetic acid), and phase B was acetonitrile (with the addition of 0.1% trifluoroacetic acid); the total flow rate was 1 mL / min, the elution mode was isocratic elution, the ratio of phase A to phase B was 70:30, and the detector wavelength was 210 nm.

[0057] Example 1 Screening of Glucose Glycosyltransferases with Potential Function

[0058] BLAST comparison of the Centella asiatica transcriptome data with 17 C-28 glucose glycosyltransferases from different sources with known functions in the literature showed that 5 isozymes were basically homologous to 12 genes with an E value of 0.

[0059] Comparison of these 12 gene sequences revealed that evm.model.CM025782.1.1646[mRNA] differed from the reported CaUGT73AH1 by only one amino acid. The protein sequences of evm.model.CM025782.1.1645[mRNA] and evm.model.CM025782.1.1643[mRNA] were identical, and the protein sequence of evm.model.CM025782.1.1647[mRNA] was identical to that of CaUGT73AH1. Furthermore, all currently reported C28-COOH glucose glycosyltransferases belong to the UGT73 family. Based on the KEGG analysis and BLAST alignment results, the enzymes were renumbered (see Table 1 below).

[0060] Table 1 Glycosyltransferases with high similarity

[0061]

[0062] Example 2 Glycosyltransferase gene amplification and construction of recombinant Escherichia coli expressing glucose glycosyltransferase

[0063] Primer pairs (Table 2) were designed for amplifying the glucose glycosyltransferases screened in Example 1. PCR amplification was performed using reverse-transcribed cDNA from Centella asiatica as a template. Primer Star MasterMix (Takara) high-fidelity pfu enzyme was used for the amplification. The conditions were pre-denaturation at 95°C for 3 minutes; 30 cycles of amplification at 95°C for 15 seconds, 60°C for 15 seconds, and 72°C for 1 minute; and extension at 72°C for 5 minutes. The PCR products were purified to obtain the target fragments UGT73C1 to UGT73C11. PCR amplification and product purification were performed using the pETDuet-1 vector using primers pETDuet-F and pETDuet-R. The purified fragments UGT73C1 to UGT73C11 were recombined with the pETDuet-1 backbone by Gibson assembly to obtain recombinant vectors, which were then transformed into Escherichia coli JM109. The obtained recombinant vectors were sent to Shanghai Bioengineering for sequencing, and the correctly sequenced recombinant plasmids pETDuet-1–UGT73C1, pETDuet-1–UGT73C4, pETDuet-1–UGT73C5, pETDuet-1–UGT73C7, pETDuet-1–UGT73C8, pETDuet-1–UGT73C9, pETDuet-1–UGT73C10, and pETDuet-1–UGT73C11 were obtained, which were transformed into Escherichia coli BL21(DE3)△pgi, respectively, to obtain recombinant Escherichia coli BL21(DE3)△pgi / pETDuet-1–UGT73C1 to BL21(DE3)△pgi / pETDuet-1–UGT73C1.

[0064] A primer pair (UGT73AH1-F / UGT73AH1-R, Table 2) was designed to amplify UGT73AH1 from Centella asiatica (L.) Urban. PCR amplification was performed using the synthesized sequence as a template with this primer pair and PrimerStar MasterMix (Takara) high-fidelity pfu enzyme. The conditions included initial denaturation at 95°C for 3 minutes, 30 cycles of amplification at 95°C for 15 seconds, 56°C for 15 seconds, and 72°C for 1 minute, followed by extension at 72°C for 5 minutes. The PCR product was purified and PCR amplified using pET28a vectors 28a-F and 28a-R. The purified UGT73AH1 fragment was recombined with the pET28a backbone by Gibson assembly to generate the recombinant vector, which was then transformed into Escherichia coli JM109. The obtained vector was sequenced to obtain the correctly sequenced recombinant plasmid pET28a-UGT73AH1, which was transformed into Escherichia coli BL21 (DE3) △pgi to obtain recombinant Escherichia coli BL21 (DE3) △pgi / pET28a-UGT73AH1.

[0065] The recombinant plasmids pETDuet-1–UGT73C1 to pETDuet-1–UGT73C11 were respectively transformed into recombinant Escherichia coli BL21(DE3)Δpgi / pET28a–UGT73AH1 to obtain a series of recombinant bacteria BL21(DE3)Δpgi / pETDuet-1–UGT73C1 / pET28a-UGT73AH1 to BL21(DE3)Δpgi / pETDuet-1–UGT73C11 / pET28a-UGT73AH1 carrying UGT73AH1 and the glycosyltransferase screened in Example 1.

[0066] Table 2 Primers used to construct glucose glycosyltransferase expression vector

[0067]

[0068] Example 3 Inducible expression of glucose glycosyltransferase

[0069] Using the strain BL21 (DE3) △ pgi / pETDuet-1 transformed with the empty vector pETDuet-1 as a control, a series of recombinant E. coli constructed in Example 2 were streaked on LB plates containing 50 μg / mL of ampicillin and cultured at 37 ° C for 12 h. Pick a single colony and transfer it into 5 mL of LB liquid medium containing 50 μg / mL of ampicillin and shake-culture at 37 ° C 220 rpm for 12 h. According to the inoculum volume ratio of 1%, it was transferred to 25 mL of TB liquid medium containing 50 μg / mL of ampicillin and shake-cultured at 37 ° C 220 rpm until the OD 600 When the pH value was 0.6-0.8, isopropylthiogalactoside (IPTG) was added to a final concentration of 0.5 μmol / L, and the culture was continued with shaking at 16°C and 220 rpm for 20 h.

[0070] Pipette 1mL of bacterial solution and measure the final OD 600 Take 1 mL of bacterial solution and centrifuge at 5000 × g for 1 min to collect the cells. Resuspend the cells in 1 mL of 0.1 M pH 7.4 PBS buffer and centrifuge at 5000 × g for 1 min to wash the cells and remove the residual culture medium. Resuspend the cells in 0.1 M pH 7.4 PBS buffer and control the OD value of the final resuspended bacterial solution. 600 The value is 5. The cells were broken by ultrasonication. After the breaking, the broken liquid was collected and centrifuged at 12000×g for 2 minutes. The supernatant was collected as the crude enzyme solution of glucose glycosyltransferase. The SDS-PAGE results are shown in Figure 1 .

[0071] Example 4 Inducing recombinant Escherichia coli to ferment and produce Centella asiatica bioside

[0072] Using the empty vector-transformed strain BL21(DE3)Δpgi / pETDuet-1 / pET28a as a control, a series of recombinant E. coli strains constructed in Example 2, BL21(DE3)Δpgi / pETDuet-1–UGT73C1 / pET28a-UGT73AH1 to BL21(DE3)Δpgi / pETDuet-1–UGT73C11 / pET28a-UGT73AH1, were streaked onto LB plates containing 50 μg / mL kanamycin and 50 μg / mL ampicillin and cultured at 37°C for 12 hours. A single colony was picked and transferred into 5 mL of LB liquid medium containing 50 μg / mL kanamycin and 50 μg / mL ampicillin and cultured at 37°C with shaking at 220 rpm for 12 hours. The inoculum volume was 1% and transferred to 25 mL of TB liquid medium containing 50 μg / mL kanamycin and 50 μg / mL ampicillin, and cultured at 37°C with shaking at 220 rpm until the OD 600The value was 0.6-0.8, and isopropylthiogalactoside (IPTG) was added to a final concentration of 0.5 μmol / L. After 6 h, the substrate Centella asiatica was added to a final concentration of 200 mg / L. The culture was continued with shaking at 30 ° C and 220 rpm for 48 h, and samples were taken for detection after 24 h.

[0073] After the fermentation is completed, 2 mL of fermentation broth was added with the same volume of methanol, vigorously shaken and mixed, and centrifuged at 14000 r / min for 10 min. The supernatant was filtered with a 0.22 μm organic phase filter membrane and then the product was detected using Shimadzu UPLC-IT-TOF / MS. Figure 2 、 3 It can be seen that when UGT73AH1, UGT73C7 and UGT73C8 were simultaneously transformed into the BL21(DE3)△pgi strain, a new peak different from the blank control appeared at 7.92 min, with the same mass spectrometry data as that of asiatic acid disoside, confirming the production of asiatic acid disoside.

[0074] Example 5: Production of Asiatic Acid Disoside by Reaction of Crude Enzyme Solution

[0075] Using the empty vector-transformed strain BL21(DE3)Δpgi / pETDuet-1 / pET28a as a control, a series of recombinant E. coli strains constructed in Example 2, BL21(DE3)Δpgi / pETDuet-1–UGT73C1 / pET28a-UGT73AH1 to BL21(DE3)Δpgi / pETDuet-1–UGT73C11 / pET28a-UGT73AH1, were streaked onto LB plates containing 50 μg / mL kanamycin and 50 μg / mL ampicillin and cultured at 37°C for 12 hours. A single colony was picked and transferred into 5 mL of LB liquid medium containing 50 μg / mL kanamycin and 50 μg / mL ampicillin and cultured at 37°C with shaking at 220 rpm for 12 hours. The inoculum volume was transferred to 25 mL of TB liquid medium containing 50 μg / mL kanamycin and 50 μg / mL ampicillin, and cultured at 37°C with shaking at 220 rpm until the OD 600 Isopropylthiogalactoside (IPTG) was added to the culture to a final concentration of 0.5 μmol / L, and the culture was continued with shaking at 16°C and 220 rpm for 20 h.

[0076] At the end of the culture, aspirate 1 mL of culture to determine the final OD 600The OD value was 0.001, 0.002, and 0.001, respectively. 1 ml of the bacterial solution was centrifuged at 5000 × g for 1 min to collect the cells. The cells were resuspended in 1 mL of 0.1 M pH 7.4 PBS buffer and centrifuged at 5000 × g for 1 min to wash the cells and remove the residual culture medium. The cells were resuspended in 0.1 M pH 7.4 PBS buffer to control the final OD value of the resuspended bacterial solution. 600 The value is 5. The bacteria were disrupted using an ultrasonic disruptor. After the disruption was completed, the disrupted liquid was collected and centrifuged at 12000×g for 2 minutes. The supernatant was collected as the crude enzyme solution of glucose glycosyltransferase.

[0077] The total enzyme reaction system is 500 μL, the crude enzyme solution is 100 μL, the final concentration of UDPG added is 1 g / L, the final concentration of the substrate Centella asiatica added is 200 mg / L, and the rest is made up to 500 μL with PBS buffer, and the reaction is carried out at 37°C for 6 hours. After the fermentation is completed, the same volume of methanol is added, and after vigorous shaking and mixing, centrifugation is carried out at 14000 r / min for 10 minutes. The supernatant is taken and filtered with a 0.22 μm organic phase filter membrane, and the product is detected using Shimadzu UPLC-IT-TOF / MS. Figure 4 It can be seen that when UGT73AH1, UGT73C7 and UGT73C8 were simultaneously transformed into the BL21(DE3)△pgi strain, a new peak different from the blank control appeared at 7.92 min, with the same mass spectrometry data as that of asiatic acid disoside, confirming the production of asiatic acid disoside.

[0078] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. The use of glucose glycosyltransferase in the preparation of Centella asiatica bioside, characterized in that: The amino acid sequence of the glucose glycosyltransferase is shown in SEQ ID NO.13 or SEQ ID NO.

14.

2. A recombinant Escherichia coli, characterized in that Using Escherichia coli as a host, overexpression of glucose glycosyltransferase and glycosyltransferase UGT73AH1 ; and knock out the genomic gene encoding glucose phosphate isomerase protein pgi ; The amino acid sequence of the glucose glycosyltransferase is shown in SEQ ID NO.13 or SEQ ID NO.

14.

3. The recombinant Escherichia coli according to claim 2, characterized in that The glucose phosphate isomerase protein encoding gene pgi The nucleotide sequence is shown in SEQ ID NO.

18.

4. The recombinant Escherichia coli according to claim 2, characterized in that The glycosyltransferase UGT73AH1 Derived from Centella asiatica Centella asiatica (L.) Urban .

5. The recombinant Escherichia coli according to any one of claims 2 to 4, characterized in that Escherichia coli BL21 (DE3) was used as the host.

6. Use of the recombinant Escherichia coli according to any one of claims 2 to 5 in the synthesis of Centella asiatica bioside.

7. A method for producing asiatic acid bioside, characterized in that: The method comprises inoculating the seed liquid of the recombinant Escherichia coli according to any one of claims 2 to 5 into a fermentation medium, and shaking the culture until the OD 600 When the value is 0.6-0.8, add isopropylthiogalactoside, and after 4-8 hours, add asiatic acid at a final concentration of 150-250 mg / L, and continue shaking culture for 40-60 hours; or glucose glycosyltransferase and glycosyltransferase UGT73AH1 As a catalyst, the reaction was carried out at 35-38°C for 4-10 h in a reaction solution containing a final concentration of 0.8-1.2 g / L glycosyl donor UDPG and 150-250 mg / L substrate asiatic acid. The amino acid sequence of the glucose glycosyltransferase is shown in SEQ ID NO.13 or SEQ ID NO.

14.

8. The method according to claim 7, characterized in that The fermentation medium comprises 15-25 g / L of glucose, 4-6 g / L of glycerol, 14-18 g / L of K2HPO4·3H2O, 1-3 g / L of KH2PO4, 20-30 g / L of yeast powder, and 10-15 g / L of peptone.

9. The method according to claim 7, characterized in that The glycosyltransferase UGT73AH1 Derived from Centella asiatica Centella asiatica (L.) Urban .

Images