A plant gene editing vector and its application
By introducing NC cloning frame structures into plant gene editing vectors, using Nimble cloning technology to achieve a one-step ligation reaction, solving the problems of cumbersome operations and restriction of enzyme cleavage sites in the existing technology, and achieving rapid and efficient construction of gene editing vectors and target gene editing.
Patent Information
- Application Number
- CN202211124303.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-15
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2042-09-15
AI Technical Summary
The existing plant gene editing vector construction methods are complicated to operate and are limited by enzyme cleavage sites, making it difficult to efficiently connect multiple DNA fragments.
Using Nimble cloning technology, a plant gene editing vector was designed, including the NC cloning frame structure of the NC universal linker 1-SfiI-ccdB gene-SfiI-NC universal linker 2, and the target gene fragment was connected through one-step reaction, and cloned using Nimble Mix reaction solution.
Fast and efficient gene editing vector construction is achieved, with cloning efficiency higher than that of Golden Gate and Gibson cloning, and the target gene is successfully edited.
Smart Images

Figure CN116042703B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and specifically relates to an expression vector for plant gene editing and applications thereof. Background Art
[0002] Gene editing technology is increasingly being used in areas such as gene function research and plant variety improvement. In plant gene editing research, plant gene editing vectors are primarily used to express Cas proteins and guide RNA in plant cells to achieve gene editing.
[0003] Currently, plant gene-editing vectors are primarily constructed using traditional restriction enzyme ligation, Golden Gate, and Gibson homologous recombination cloning methods. Traditional restriction enzyme ligation, the earliest and still widely used DNA cloning technique, utilizes restriction enzyme digestion and DNA ligase for ligation. However, this traditional method also has significant limitations, such as the potential for critical restriction sites to occur within the sequence to be assembled, and the difficulty of cloning more than two DNA fragments using this technique. Golden Gate utilizes Type II restriction enzymes and T4 DNA ligase. Commonly used Type II restriction enzymes include Bsa I, Bbs I, BsmB I, and Esp3 I. These enzymes have recognition sites of 6-7 bases, which are more likely to occur within the target gene, limiting their use. Gibson homologous recombination cloning has been widely used to construct various vectors, including plant gene-editing vectors. Construction of plant gene-editing vectors using the Gibson homologous recombination method requires two steps: first, linearization of the vector by restriction enzyme digestion, and then recombination of the target fragment into the linearized vector. This two-step process increases the workload of vector construction.
[0004] The above cloning methods have problems such as cumbersome operation or restriction of enzyme cutting sites. Nimble cloning (NC cloning) is a recently invented standardized molecular cloning technology with the advantages of simple operation, flexible use, and high efficiency (Yan P, Zeng Y, Shen W, et al. Nimble cloning: a simple, versatile, and efficient system for standardized molecular cloning [J]. Frontiers in bioengineering and biotechnology, 2020, 7: 460.). Therefore, the development of a plant gene editing vector based on Nimble cloning will be conducive to rapid and efficient plant gene editing research. Summary of the Invention
[0005] To address the problems of the prior art, the present invention provides a plant gene editing vector structure, sequence, construction method, and application in plant gene editing. In a first aspect, the present invention provides a plant gene editing vector comprising an NC cloning cassette structure at the cloning site: NC universal linker 1-SfiI-ccdB gene-SfiI-NC universal linker 2.
[0006] In a preferred embodiment of the present invention, the sequence of the NC universal linker 1 is: 5'-agtggtctctgtccagtcct-3'; the sequence of the NC universal linker 2 is: 5'-ggtctcagcagaccacaagt-3'.
[0007] In a preferred embodiment of the present invention, the downstream of the NC cloning frame structure contains a gRNA scaffold structure of Cas9 and a plant expression frame of Cas9.
[0008] In a preferred embodiment of the present invention, the nucleotide sequence of the NC cloning frame is shown as SEQ ID NO.1.
[0009] The second aspect of the present invention provides a plant gene editing vector, which contains an NC cloning frame structure of NC universal linker 1-SfiI-ccdB gene-SfiI-NC universal linker 2 at the cloning site. Gene fragments containing one or more gene editing target sequences can be quickly cloned into the NC cloning frame through a one-step ligation reaction of Nimble cloning (NC cloning).
[0010] The third aspect of the present invention provides a method for constructing a plant gene editing vector based on Nimble cloning, the specific steps of which are: 1) designing primers containing a gene editing target sequence, the upstream primer being: GAGTCGAAGTAGTGATTGNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC, wherein N is a 19nt target sequence 1; the downstream primer being: CTATTTCTAGCTCTAAAACNNNNNNNNNNNNNNNNNNNNNCAATCTCTTAGTCGACTCTAC, wherein N is a 19nt reverse target sequence 2; 2) using the primers in step 1 and the plasmid pCBC-DT1T2 as a template, PCR amplification is performed to recover the target band; 3) mixing the recovered product obtained in step 2 with the plant gene editing expression vector plasmid described in the present invention, adding the Nimble Mix reaction solution, and cloning by Nimble cloning to obtain a plant gene editing vector containing the target sequence.
[0011] A fourth aspect of the present invention provides a kit, which includes the expression vector for plant gene editing according to the present invention and a Nimble Mix reaction solution for Nimble cloning.
[0012] The fifth aspect of the present invention provides the application of the expression vector for plant gene editing or the construction method of the plant gene editing vector based on Nimble cloning in plant gene editing.
[0013] In a preferred embodiment of the present invention, a plant gene editing vector containing an NC cloning frame was constructed, and the target sequence of the target gene was successfully cloned into the vector, and the cloning efficiency was higher than that of Golden Gate cloning and Gibson cloning.
[0014] In another preferred embodiment of the present invention, the constructed plant gene editing vector containing the target sequence was injected into tobacco leaves, and the target gene was successfully edited.
[0015] Compared with the prior art, the technical solution provided by the present invention has the following advantages:
[0016] First, the plant gene editing vector based on Nimble cloning can connect the target gene target sequence through a one-step cloning reaction, which has the advantages of being fast and efficient.
[0017] Second, the cloning efficiency of plant gene editing vectors based on Nimble cloning is higher than that of Golden Gate cloning and Gibson cloning.
[0018] Third, as a member of the NC cloning system, the plant gene editing vector based on Nimble cloning has the advantage of standardized cloning. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] The vector and kit preparation method of the present invention, as well as their applications and beneficial effects in plant gene editing are described in detail below with reference to the accompanying drawings and specific embodiments.
[0020] Figure 1 This is the electrophoresis diagram of the NC cloning frame after PCR amplification. M: DL2000 Marker; I: NC cloning frame.
[0021] Figure 2 This is a map of the plant gene editing vector pNC-HSE401, which is based on Nimble cloning. NC Frame: NC cloning frame.
[0022] Figure 3This is the electrophoresis diagram of the PCR amplification of the tobacco PDS gene target sequence fragment. M: DL2000 Marker; 1: PDS gene target sequence fragment.
[0023] Figure 4 This is an electropherogram of the PCR amplification of the gene editing target site fragment used for Hi-Tom sequencing. M: DL2000 Marker; -: negative control; 1-2: two samples of tobacco injected with Agrobacterium.
[0024] Figure 5 This is an analysis of gene editing efficiency. The underlined sequence indicates the gene editing target. WT: wild type; I: base insertion; D: base deletion. DETAILED DESCRIPTION
[0025] Below are described in detail embodiments of the present invention, the examples of the embodiments are shown in the accompanying drawings, wherein identical or similar reference numerals represent identical or similar elements or elements with identical or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and are only used to explain the present invention, and are not to be construed as limiting the present invention. In the embodiments, those without specifying specific conditions are carried out according to normal conditions or the conditions recommended by the manufacturer. Reagents used or instruments without specifying manufacturers are conventional products that can be obtained commercially.
[0026] Example 1 Construction of a plant gene editing vector based on Nimble cloning
[0027] (1) Design primers to amplify the NC cloning frame and amplify the gene fragment
[0028] A pair of primers were designed based on the sequence of the NC cloning frame, the upstream primer (SEQ ID NO.2): tagagtcgaagtagtgattg agtggtctctgtccagtcct (wherein the underlined sequence is the linker sequence for connection to the expression vector), downstream primer (SEQ ID NO.3): gctatttctagctctaaaac ggtctcagcagaccacaagt (the underlined sequence is the linker sequence for connection to the expression vector).
[0029] Plasmid pNC-UC (GenBank: MK720605) was used as a template, and the two primers were used for PCR amplification using PrimeSTAR high-fidelity polymerase (Takara). The PCR amplification program was as follows: 98°C for 30 seconds; 98°C for 10 seconds, 55°C for 20 seconds, and 72°C for 20 seconds, for 28 cycles; and a final extension at 72°C for 1 minute. PCR products were detected by agarose gel electrophoresis. The results are shown in Figure 2. Figure 1Electrophoresis results showed that a band of approximately 700 bp was amplified, consistent with the expected size. Therefore, the band was recovered using an agarose gel recovery kit (Novagen) according to the manufacturer's instructions.
[0030] (2) Connecting the NC cloning frame to the plant gene editing vector
[0031] The plant gene editing vector HSE401 was digested with BsaI, and the digestion product was recovered by agarose gel electrophoresis. The recovered vector and the NC cloning frame were ligated. The reaction system was 2.5ul of the vector and NC cloning frame, 5ul of Pre-Nimble reaction solution (Nixing Bio), and the reaction conditions were 50℃ for 1h. The 5ul ligation product was transformed into Escherichia coli competent cells (strain DB3.1). After overnight culture, the single clone obtained was identified by PCR and sequencing. The plant gene editing vector containing the NC cloning frame with the correct sequence was obtained and named pNC-HSE401. The vector map is shown in Figure 2 .
[0032] Example 2: Cloning the tobacco PDS gene target sequence into the plant gene editing vector pNC-HSE401
[0033] (1) Design target sequence primers and amplify target sequence fragments
[0034] According to the PDS gene sequence of Nicotiana benthamiana, a target sequence TTGGTAGTAGCGACTCCATG for gene editing was selected and a pair of primers were designed. The upstream primer (SEQ ID NO.4) was GAGTCGAAGTAGTGA TTG TTGGTAGTAGCGACTCCATG GTTTTAGAGCTAGAAATAGC (where the underlined sequence is the target sequence), downstream primer (SEQ ID NO.5): TATTTCTAGCTCTAAAAC CATGGAGTCGCTACTACCAA CAATCTCTTAGTCGACTCTAC (where the underlined sequence is the reverse complement of the target sequence). Using the plasmid pCBC-DT1T2 as a template, the two primers mentioned above were used for PCR amplification using PrimeSTAR high-fidelity polymerase (Takara). The PCR amplification program was as follows: 98°C for 30 seconds; 98°C for 10 seconds, 52°C for 20 seconds, and 72°C for 20 seconds, for 28 cycles; and a final extension at 72°C for 1 minute. PCR products were detected by agarose gel electrophoresis. The results are shown in Figure 2. Figure 3 The electrophoresis results showed that a band of about 600 bp was amplified, which was consistent with the expected size. The band was recovered by agarose gel electrophoresis.
[0035] (2) Clone the target sequence fragment into the vector
[0036] The target sequence fragment was cloned into the plant gene editing vector pNC-HSE401 by Nimble cloning. The reaction system consisted of 100 ng of vector, 50 ng of target sequence fragment, and 5 μl of Nimble Mix (Nixing Biotechnology) at 50°C for 1 hour. A 5 μl ligation product was transformed into competent Escherichia coli cells (strain DH5α). After overnight culture, single colonies were obtained and identified by PCR and sequencing. This yielded the plant gene editing vector containing the target sequence and was named pNC-HSE401-pds.
[0037] Example 3 Comparison of cloning efficiency between pNC-HSE401 and pHSE401
[0038] pNC-HSE401 was cloned using Nimble Cloning (NC cloning) with the same steps as in Example 2. pHSE401 was cloned using Golden Gate and Gibson cloning. The Golden Gate cloning reaction consisted of: 100 ng of plasmid, 50 ng of target sequence fragment (containing the corresponding BsaI site), 0.5 μl of BsaI (NEB), 0.5 μl of DNA T4 ligase (NEB), and incubation at 37°C for 2 hours. The Gibson cloning reaction consisted of: 100 ng of plasmid recovered by BsaI digestion, 50 ng of target sequence fragment (same target fragment as in Example 2), 5 μl of Gibson cloning reaction solution (NEB), and incubation at 50°C for 1 hour. 5 μl of each ligation product was used to transform competent E. coli cells (strain DH5α). After overnight incubation, the number of single colonies was counted, and 20 single colonies were selected for PCR analysis to determine the positive rate. The results showed that the number of single colonies using Nimble Cloning was higher than that using Golden Gate and Gibson cloning, and the positive rate for all three methods was above 90%. The number of single clones and the positive rate of different cloning methods are shown in Table 1.
[0039] Table 1 Number and positive rate of monoclonal clones
[0040]
[0041] Example 4 Detecting the gene editing efficiency of plant gene editing vectors
[0042] The plant gene editing vector pNC-HSE401-pds containing the target sequence was transformed into Agrobacterium GV3101, and a single Agrobacterium colony was picked for PCR identification. The single clone containing the target vector was inoculated into 5ml LB liquid culture medium and cultured at 200rpm and 28℃ with shaking until OD600 was 1.0-1.5. Centrifuge at 5000 rpm for 5 minutes and remove the supernatant. Add 5ml injection buffer (50mM MES pH5.6, 10mM MgCl2, 100μM acetosyringone) and gently suspend. Centrifuge at 5000 rpm for 5 minutes and remove the supernatant. Re-add injection buffer until OD600 is 0.1-0.3, and place it in the dark at room temperature for 1-2 hours before injecting into Nicotiana benthamiana leaves. Use a 1ml syringe without a needle to inject Agrobacterium into the lower epidermis of tobacco leaves. Four days after the injection, use Plant Tissue PCR Kit (Quanshijin) was used to rapidly extract DNA from the injection area of the leaf for direct PCR reaction. The amplification primers were: upstream primer (SEQ ID NO. 6): ggagtgagtacggtgtgcgaggtcttcgttgggaactg; downstream primer (SEQ ID NO. 7): gagttggatgctggatggcctttgtcaatcttcgggtc. PCR products were analyzed by agarose gel electrophoresis. The results are shown in Table 1. Figure 4 The electrophoresis results showed that a band of about 180 bp was amplified, which was consistent with the expected size. The PCR products were subjected to HI-TOM high-throughput sequencing, and the sequencing results were analyzed and compared. Sequence alignment showed that the gene editing efficiency of the target sequence site was 54%, including base insertion and base deletion. The proportion of different gene editing types is shown in Figure 5 .
[0043] Sequence Listing
[0044] SEQ ID NO.1
[0045] Agtggtctctgtccagtcctggcctcgtcggccattctcgactaagttggcagcatcacccgacgcactttgcgccgaataaatacctgtgacggaagatcacttcgcagaataaataaatcctggtgtccctgttgataccgggaagccctgggccaacttttggcgaaaatgagacgttgatcggcacgtaagaggttccaactttcaccataatgaaataagatcactaccgggcgtattttttgagttatcgagattttcaggagctaaggaagctaaacttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcctgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtatccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagggccagtctggccacttgtggtctgctgagacc
[0046] SEQ ID NO.2
[0047] tagagtcgaagtagtgattg agtggtctctgtccagtcct
[0048] SEQ ID NO.3
[0049] Gctatttctagctctaaaac
[0050] SEQ ID NO.4
[0051] GAGTCGAAGTAGTGA TTGTTGGTAGTAGCGACTCCATG GTTTTAGAGCTAGAAATAGC
[0052] SEQ ID NO.5
[0053] TATTTCTAGCTCTAAAAC CATGGAGTCGCTACTACCAA CAATCTCTTAGTCGACTCTAC
[0054] SEQ ID NO.6
[0055] ggagtgagtacggtgtgcgaggtcttcgttgggaactg
[0056] SEQ ID ON.7
[0057] gagttggatgctggatggcctttgtcaatcttcgggtc
[0058] Based on the disclosure and teachings of the above description, those skilled in the art may also make appropriate changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and some modifications and variations of the present invention should also fall within the scope of protection of the claims of the present invention. In addition, although certain specific terms are used in this description, these terms are only for convenience of description and do not constitute any limitation to the present invention.
Claims
1. An expression vector for plant gene editing, characterized in that: The vector is formed by connecting the sequence shown in SEQ ID NO.1 with the plant gene editing vector HSE401 after BsaI digestion.
2. An expression vector for plant gene editing, characterized in that: A gene fragment containing one or more gene editing target sequences is quickly cloned into the vector according to claim 1 through a one-step ligation reaction of Nimble cloning to obtain a plant gene editing vector containing the target sequence.
3. A method for constructing a plant gene editing vector based on Nimble cloning, characterized in that: The steps include: 1) Design primers containing the gene editing target sequence. The upstream primer is: GAGTCGAAGTAGTGATTGNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC, where N is the 19-nt target sequence 1; the downstream primer is: CTATTTCTAGCTCTAAAACNNNNNNNNNNNNNNNNNNNCAATCTCTTAGTCGACTCTAC, where N is the 19-nt reverse target sequence 2; 2) Using the primers in step 1, PCR amplification was performed using plasmid pCBC-DT1T2 as a template, and the target band was recovered; 3) Mixing the recovered product obtained in step 2 with the plant gene editing expression vector plasmid according to claim 1, adding Nimble Mix reaction solution, and cloning by Nimble cloning to obtain a plant gene editing vector containing the target sequence.
4. A kit, characterized in that The invention comprises the expression vector for plant gene editing according to claim 1 or claim 2, and also comprises a Nimble Mix reaction solution for Nimble cloning.
5. Use of the expression vector for plant gene editing according to claim 1 or claim 2, or the method for constructing a plant gene editing vector based on Nimble cloning according to claim 3, in plant gene editing.
Citation Information
Patent Citations
Cassava common mosaic virus (CsCMV)induced gene silencing system and application thereof
CN112899301A