Aflatoxin oxidase that improves pepsin resistance

Abstract

The present invention discloses an aflatoxin oxidase (AFO) with improved pepsin resistance and its application. The present invention transforms the key amino acid residues in the wild-type aflatoxin oxidase molecule by protein engineering technology, and screens out a mutant aflatoxin oxidase with improved pepsin resistance. The mutant aflatoxin oxidase (AFO) acting on aflatoxin (AFB1) of the present invention is P477S ) has a 16% longer half-life of resistance to pepsin than wild-type AFO. P477S It still retains more than 60% activity at 10-50°C; the optimum reaction pH is 7.5; it retains more than 60% activity at pH 5.0-8.0.

Description

Technical Field

[0001] The present invention relates to aflatoxin oxidase, and in particular to an aflatoxin oxidase with improved pepsin resistance. Background Art

[0002] In 1999, our research group first reported in the world that an active substance with aflatoxin detoxification effect was purified from the edible fungus Armillariella tabescens, and named it Aflatoxin Detoxin Fizyme (ADTZ). Further research found that the enzyme is an oxidoreductase that can undergo oxidation reactions with structural analogs such as aflatoxin (AFB1), so it was renamed Aflatoxion-Oxidase (AFO). The results showed that AFO can convert AFB1 into non-toxic products. This method is efficient, low-toxic, highly specific, and does not pollute the environment.

[0003] Due to the strong toxicity and good thermal stability of aflatoxin, the usual physical and chemical methods cannot completely remove aflatoxin, and will also destroy the nutritional value of the raw materials. Therefore, the most effective method for removing aflatoxin is biological enzymatic hydrolysis.

[0004] So far, the research on aflatoxin detoxification enzymes has mainly focused on the cloning and heterologous expression of aflatoxin detoxification genes; obtaining strains producing aflatoxin detoxification enzymes with different characteristics through gene recombination methods; degradation mechanism research and the preparation and application of aflatoxin detoxification enzyme preparations. A search of the Chinese patent database revealed that there are more than ten patents related to aflatoxin detoxification enzymes. Patents on the discovery or screening of aflatoxin detoxification enzymes with different characteristics from different microbial sources and their encoding genes include: CN1712526A, etc.; there are two patents on the use of gene recombination and other methods to obtain mutants with different characteristics, and both were applied for by this research group. Among them, patent CN104130984A invented a function by modifying the key amino acid residues in the substrate binding site of the wild-type aflatoxin oxidase. Patent CN104611305A invented a mutant with improved trypsin resistance by modifying the key amino acid residues in the outer layer of the three-dimensional structure of the wild-type aflatoxin detoxification enzyme; Patents on the application of aflatoxin detoxification enzymes include CN107727722A, CN102175736A, CN101216450A, CN104152419A, CN103947847A, CN1719243A, etc. The main research on aflatoxin detoxification enzymes in China's Dissertation Database includes revealing enzymatic properties, catalytic reaction mechanisms, cloning and heterologous expression of enzyme genes, directed modification of enzymes, and the application of detoxification enzyme preparations in the feed industry. However, research and patents on aflatoxin detoxification enzymes with improved pepsin resistance have not been reported so far. In feed additive applications, the extension of aflatoxin-degrading enzyme's resistance to pepsin can improve the utilization efficiency of the enzyme and has important application value. Summary of the invention

[0005] The primary object of the present invention is to provide an aflatoxin oxidase with improved pepsin resistance.

[0006] The aflatoxin oxidase with improved pepsin resistance of the present invention is a mutant aflatoxin oxidase obtained by random mutation screening of aflatoxin oxidase derived from the edible fungus Armillariella tabescens with an amino acid sequence of SEQID NO.1, and has an amino acid substitution, which is a substitution at position 477.

[0007] The present invention is to perform error-prone PCR on the gene of aflatoxin oxidase (called AFO gene). The GENBANK accession number of the gene sequence of aflatoxin oxidase obtained from the edible fungus Armillariella tabescens is AY941095.1. The amino acid sequence of the mature protein of the enzyme is AAX53114.1 (SEQ ID NO.1).

[0008] The present invention screened a mutant aflatoxin oxidase by mutation of aflatoxin oxidase. Experiments showed that the obtained mutant AFO had no effect on the degradation function of AFB1, and its half-life of resistance to pepsin was extended by 16% compared with that of wild-type AFO. The mutant was named AFO. P477S .

[0009] According to the further characteristics of the aflatoxin oxidase screened by the error-prone PCR of the present invention, the amino acid substitution at position 477 is substitution of proline with serine; the amino acid sequence of the mutant aflatoxin oxidase is SEQ ID NO.2.

[0010] The mutant aflatoxin oxidase (AFO) of the present invention P477S ), simulated artificial gastric juice (pH 1.2, concentration of 0.012 mg / mL pepsin at 37°C), using W AFO :W 胃蛋白酶 =50:1, after 100 min, the mutant AFO remained in the solution. P477S than residual wild-type AFO wt The percentage of AFO was 11.05% higher, and its half-life was about 37min, while the wild-type AFO wt Its half-life is about 32 minutes. P477S The resistance to pepsin is higher than that of wild-type AFO wt Improved. Mutant AFO P477S Other enzymatic properties of the mutant also changed compared to the wild-type aflatoxin oxidase. Compared to the wild-type, the mutant still retained more than 60% of its activity at 10-50°C; the optimal reaction pH was 7.5; and it retained more than 60% of its activity at pH 5.0-8.0.

[0011] Furthermore, the present invention provides a DNA molecule encoding the aflatoxin oxidase for improving pepsin resistance described in the present invention.

[0012] The nucleotide sequence of the mutant DNA molecule of the present invention is SEQ ID NO.3.

[0013] Another object of the present invention is to provide a vector containing the DNA molecule of the present invention.

[0014] Another object of the present invention is to provide a host cell containing the DNA molecule of the present invention, or containing the vector of the present invention.

[0015] The above-mentioned vectors and host cells can be prepared by techniques well known in the art.

[0016] The present invention also provides a method for producing the aflatoxin oxidase with improved pepsin resistance, comprising: culturing the host cell of the present invention under conditions suitable for the expression of aflatoxin oxidase, and separating the aflatoxin oxidase from the culture medium.

[0017] When the DNA molecule of the present invention is inserted into the vector or transferred into the host cell in the appropriate orientation and correct reading frame, the DNA molecule can be expressed in any eukaryotic or prokaryotic expression system. Many host-vector systems can be used to express protein coding sequences. Host-vector systems include, but are not limited to: bacteria transformed with bacteriophages, plasmids or cosmids; microorganisms containing yeast vectors, such as yeast; mammalian cell systems infected with viruses; insect cell systems infected with viruses; plant cell systems infected with bacteria. Preferred vectors of the present invention include viral vectors, plasmids, cosmids or oligonucleotides.

[0018] The preferred host of the present invention is a eukaryotic system such as Pichia pastoris; the preferred protein expression method of the present invention is Pichia pastoris secretory expression.

[0019] Another aspect of the present invention is to provide the use of the aflatoxin oxidase for improving pepsin resistance, specifically the use of the aflatoxin oxidase for improving pepsin resistance in the preparation of food additives or feed additives. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the SDS-PAGE protein electrophoresis diagram. The black arrow points to the Marker 75Kd band, and the black box is the target protein, which is about 75Kd in size. Lane 1 is the culture supernatant of the wild-type aflatoxin oxidase protein; Lane 2 is the ammonium sulfate precipitated protein of the culture supernatant of the wild-type aflatoxin oxidase protein.

[0021] Figure 2 The wild-type AFO of the present invention wt With mutant AFO P477SThe results of residual protein before and after treatment with artificial gastric juice; Lanes 1-8 are the amounts of AFO protein remaining after pepsin digestion for 0, 10, 20, 30, 40, 60, 80, and 100 minutes, respectively.

[0022] Figure 3 The wild-type AFO of the present invention wt With mutant AFO P477S Grayscale scanning data results of protein. Artificial gastric juice contains pepsin.

[0023] Figure 4 The wild-type AFO of the present invention wt and mutant AFO P477S The optimal reaction temperature.

[0024] Figure 5 The wild-type AFO of the present invention wt and mutant AFO P477S Temperature stability.

[0025] Figure 6 The wild-type AFO of the present invention wt and mutant AFO P477S The optimal reaction pH.

[0026] Figure 7 The wild-type AFO of the present invention wt and mutant AFO P477S pH stability. DETAILED DESCRIPTION

[0027] The terms used herein, unless otherwise specified, have the meanings commonly understood by those skilled in the art. The following provides definitions of some special terms used in the present invention.

[0028] “AFO wt " indicates the wild-type aflatoxin oxidase, the gene of which is in italics "AFO wt "express.

[0029] “AFO Mut ” indicates a gene fragment obtained by error-prone PCR.

[0030] “pPIC3.5K-AFO Mut” It indicates that the gene fragment obtained by error-prone PCR is connected to the vector pPIC3.5K.

[0031] “AFO P477S " indicates mutant aflatoxin oxidase, the gene of which is in italics "AFO P477S "Example 1: Synthesis of aflatoxin oxidase gene

[0032] The present invention uses a wild-type aflatoxin oxidase gene from Armillariella tabescens (GenBank registration number: AY941095.1), which is synthesized by Shanghai Jierui Gene Co., Ltd. (other commercial companies with full gene synthesis can also complete it).

[0033] Example 2: Verifying whether the aflatoxin oxidase gene (AFO) is correctly obtained

[0034] 1. The pPIC3.5K plasmid containing the AFO target gene synthesized by the whole gene was extracted and verified by single and double enzyme digestion. The enzyme digestion conditions are shown in Table 1.

[0035] Table 1:

[0036]

[0037] 2. The digestion products were verified by 1% agarose gel electrophoresis.

[0038] The results showed that after the recombinant plasmid was digested with Not I and Sac I, two bands were obtained, namely the pPIC3.5K vector of about 9000 bp and the target gene fragment of about 2000 bp. After the recombinant plasmid was digested with SalⅠ, a band of about 11000 bp was obtained. The fragment sizes of the double and single digestion products were in line with expectations, indicating that the cloning vector contained the target gene and could be used for the next experiment.

[0039] Example 3: Error-prone PCR

[0040] 1. Error-prone PCR introduces base mismatches while amplifying the target gene, resulting in random mutations in the target gene.

[0041] The present invention is based on pPIC3.5K-AFO wt Gene sequences were obtained and error-prone PCR primers were designed using Primer 6.0 software and DNA MAN.

[0042] Upstream primer (5'-3'):CGAGCTCGATGAGATTTCCTTCAATTTTTACTGCAG

[0043] Downstream primer (5'-3'):TTGCGGCCGCAATTAATGATGATGATGATGATGC

[0044] After the primers are designed, they are synthesized by Shanghai Jierui Bioengineering Co., Ltd. After the synthesis, the error-prone PCR reaction system and reaction procedure are designed.

[0045] Table 2:

[0046]

[0047] Table 3:

[0048]

[0049]

[0050] 2. The PCR product was verified by 1% agarose gel electrophoresis.

[0051] The results showed that after error-prone PCR, a target gene fragment of about 2000 bp could be amplified. The amplification results were in line with expectations and the next step of the experiment could be carried out.

[0052] 3. PCR product recovery

[0053] After electrophoresis of the PCR product, observe the target band on a UV projector and perform gel recovery. Using NEB's DNA gel recovery kit, the recovered DNA fragment is AFO. Mut , stored at 4℃.

[0054] Example 4: Construction of Pichia pastoris secretory expression vector pPIC3.5K-AFO Mut

[0055] 1. Double enzyme digestion of AFO Mut and expression vector pPIC3.5K

[0056] Table 4:

[0057]

[0058] According to the above system, double enzyme digestion of AFO Mut After the enzyme digestion was completed, the digestion products were verified by 1% agarose gel electrophoresis, and the expected vector fragment of about 9000 bp and the target gene fragment of about 2000 bp were obtained. The fragments were cut and recovered for the next experiment.

[0059] 2. AFO after double enzyme digestion Mut Connect with expression vector pPIC3.5K

[0060] The connection system is shown in Table 5.

[0061] Table 5:

[0062]

[0063]

[0064] After overnight ligation, the ligation product can be directly used for the next experiment.

[0065] 3. Transformation of E. coli DH5α competent cells and verification

[0066] The overnight ligation product was transformed into E. coli competent cells DH5α, the steps are as follows:

[0067] Take out 1 tube of 100 μL competent cells from the -80℃ refrigerator, place it on ice to slowly thaw, and divide it into 2×50 μL; add the ligation product to the competent cells, gently blow and mix with a pipette, and place it on ice for 30 minutes; then heat shock in a 42℃ metal bath for 90 seconds, and then quickly place it on ice and cool it for 2-3 minutes; add the heat-shocked product to the LB liquid culture medium in the warm bath, gently shake and mix, and place it on a 37℃ shaker for shaking and culture for 1 hour; centrifuge the above, discard part of the supernatant, resuspend the remaining part, and apply the bacterial suspension to the plate (the plate contains ampicillin resistance); after placing the plate face up for half an hour, wait for the bacterial solution to be absorbed, and invert and culture it at 37℃ overnight.

[0068] After the transformed E. coli was cultured overnight, a single colony grew on the plate. All single colonies on the plate were washed off with LB liquid medium and transferred to LB liquid medium and cultured overnight at 37°C and 200 rpm. The plasmid was extracted from the overnight culture solution in the same way as above. At this time, pPIC3.5K-AFO containing the mutant gene was obtained. Mut Plasmid.

[0069] The obtained pPIC3.5K-AFO Mut The plasmid was digested and verified according to the double digestion system of "Example 2 Step 1". After the digestion was completed, the digestion products were verified by 1% agarose gel electrophoresis, and the expected vector fragment of about 9000 bp and the target gene fragment of about 2000 bp were obtained. This shows that the secretory expression vector pPIC3.5K-AFO Mut The build is successful and you can proceed to the next experiment.

[0070] 4. Electroporation of Pichia pastoris GS115

[0071] In order to improve the integration efficiency of the single-copy expression cassette into the Pichia pastoris chromosome, the restriction endonuclease SalI was used to encode pPIC3.5K-AFO Mut Single enzyme linearization was performed, and then a stable recombinant carrying the target gene was obtained by homologous recombination. The recipient bacteria in this experiment was Pichia pastoris GS115. After electroporation, MD plates were used for preliminary screening, and then single clones on the MD plates were picked and cultured in 2 mL of YPG liquid medium for 14 to 16 hours, and then the Pichia pastoris genome was extracted for PCR verification and further screening of positive clone recombinants.

[0072] After MD plate screening and PCR verification, the positive clone recombinants with successful electroporation were obtained. The mutant AFO library constructed by error-prone PCR has a capacity of about 2.0X10 4 .

[0073] 5. Initial screening and verification of positive clone recombinants

[0074] The positive clone recombinants that were successfully electroporated were inoculated into a 96-deep-well plate containing 1 ml of YPD medium and cultured at 30°C, 200 rpm for 4 days. After the culture was completed, the plate was centrifuged at 12000g and 4°C, the supernatant of the AFO yeast engineering bacteria was collected, and an experiment was designed to use HPLC to detect the degradation of AFB1 for preliminary screening.

[0075] Experimental group: 200 μL supernatant + 300 μL PBS Buffer + AFB1 (final concentration of AFB1 is 20 ng / ml)

[0076] Control group: 200 μL supernatant + 300 μL PBS Buffer + 500 uL methanol + AFB1 (final concentration of AFB1 is 20 ng / ml)

[0077] The experimental group and the control group were reacted at 30°C, and samples were taken for detection at 6h, 12h, and 24h respectively; the experimental group used an equal volume of methanol to terminate the reaction, and after sufficient shaking, it was left to stand for 30min. Then it was centrifuged at 13000rpm for 10min, and the supernatant was taken for HPLC detection. The temperature value was set to 35°C, the UV absorbance was 365nm, the FLD excitation wavelength was 365nm, and the FLD emission wavelength was 425nm.

[0078] Degradation rate calculation formula:

[0079]

[0080] The positive monoclonal recombinants with a degradation rate greater than 70% after 24 hours of reaction were sent to Shanghai Bioengineering Co., Ltd. for sequencing. After screening the mutant AFO library, one of the positive monoclonal recombinants was sequenced as a single point mutation, and the mutation site was 477, which was named AFO P477S .

[0081] Example 5: Wild-type AFO wt and mutant AFO P477S SDS-PAGE electrophoresis detection of recombinant protein The SDS-PAGE electrophoresis detection of this embodiment includes the following steps:

[0082] (1) Prepare 10 mL of 10% separation gel, mix well and use a micropipette to pour the gel into the glass plate until it stops 2 to 3 cm from the upper edge of the short glass plate. Then seal the gel surface with distilled water. Gently lift one end of the gel dispenser and then put it down to make the gel surface flat. After polymerizing for 40 minutes, discard the distilled water and absorb excess water with filter paper.

[0083] (2) Prepare 4 mL of 5% concentrated gel and pour it evenly on the separation gel. Insert a comb of corresponding specifications while avoiding the generation of bubbles. Allow the gel to solidify for 30 minutes.

[0084] (3) Install the electrophoresis tank and fill it with electrophoresis liquid. The volume should be larger than half of the tank volume. Move the prepared gel into the tank and carefully remove the comb.

[0085] (4) Spot samples one by one. The amount of sample spotted should not be too much. 15 μL per well is appropriate.

[0086] (5) At the beginning of electrophoresis, set the voltage to 90V. When the indicator reaches the concentrated gel, change the voltage to 120V and continue electrophoresis. Stop electrophoresis when the target band reaches the middle position (the target band corresponds to the corresponding band of the Maker and can be known in advance).

[0087] (6) Carefully peel off the gel and stain with Coomassie Brilliant Blue R-250 for 30 min. Then destain with destaining buffer until the background is light and the protein bands are clear.

[0088] (7) Gel imaging and observation of results. The SDS-PAGE protein electrophoresis results are as follows: Figure 1 , Figure 2 shown.

[0089] Figure 1 This is the SDS-PAGE protein electrophoresis diagram. The black arrow points to the Marker 75Kd band, and the black box is the target protein, which is about 75Kd in size. Lane 1 is the culture supernatant of the wild-type aflatoxin oxidase protein; Lane 2 is the ammonium sulfate precipitated protein of the culture supernatant of the wild-type aflatoxin oxidase protein. The results show that the target gene is successfully expressed in Pichia pastoris GS115, and the culture can be expanded and the target protein can be isolated and purified for the next experiment.

[0090] Example 6: Electrophoresis detection of wild-type AFO wt and mutant AFO P477S Pepsin resistance test of recombinant proteins

[0091] Wild AFO wt and mutant AFO P477S Digestion of wild-type AFO with artificial gastric juice (pH 1.2, 0.012 mg / mL pepsin at 37°C) wtAFO P477S The amount of protein added was the same, and the content of artificial gastric juice and enzyme protein was in a mass ratio of 1:50. 20 μl was taken out at 0, 10, 20, 30, 40, 50, 60, 80, and 100 min, and 7 μl of protein electrophoresis buffer was added to terminate the digestion and immediately boiled for 5 min. Then, SDS-PAGE electrophoresis was performed to detect the digestion effect of pepsin. The grayscale scanning of SDS-PAGE electrophoresis protein bands was performed to detect the amount of residual protein, and the wild-type AFO was calculated. wt With mutant AFO P477S Enzyme half-life of proteins before and after pepsin treatment.

[0092] The results are as follows Figure 2 , Figure 3 As shown: the mutant aflatoxin oxidase (AFO P477S ), after being digested in simulated gastric juice (pH 1.2, 0.012 mg / mL pepsin at 37°C) for 100 minutes, the mutant AFO remained in the solution P477S than residual wild-type AFO wt The percentage of AFO was 11.05% higher, and its half-life was about 37min, while the wild-type AFO wt Its half-life is about 32 minutes. P477S The half-life of mutant AFO was 16% longer than that of wild type. P477S The resistance to pepsin is higher than that of wild-type AFO wt Improved.

[0093] Example 8: Wild-type AFO wt and mutant AFO P477S Analysis of enzymatic properties of recombinant proteins

[0094] Enzyme activity assay

[0095] At room temperature and pH = 7.4, AFO wt and AFO P477S AFB1 was used as the hydrolysis substrate for the reaction, and the change in the peak area of ​​AFB1 was detected by HPLC to indicate the reduction of the substrate, thereby characterizing the enzyme activity of AFO. The reaction system is shown in Table 6.

[0096] Table 6:

[0097] System components Volume(ul) Substrate AFB1 (1ug / mL) 2.5 AFO (2mg / mL) 25 Low salt buffer (PBS and NaCl) 222.5 Total volume 250

[0098] The reaction was carried out at room temperature for 30 minutes, and 250 μL of methanol was added and mixed thoroughly to terminate the reaction. The system after the termination of the reaction was placed in a centrifuge at 13,000 rpm for 10 minutes, and 20 μL of the supernatant was taken for HPLC detection. The temperature value was set to 35°C, the UV absorbance was 365 nm, the FLD excitation wavelength was 365 nm, and the FLD emission wavelength was 425 nm.

[0099] AFB1 enzyme activity unit definition: One unit (U) is defined as the amount of enzyme required to degrade 1 pmol of AFB1 per minute at room temperature and pH = 7.4. The calculation formula for enzyme activity (U / mg) is:

[0100]

[0101] XD-enzyme activity, unit is U / mg

[0102] C0- AFB1 concentration of sample control group, unit ng / ml

[0103] C- AFB1 concentration of the sample reaction group, unit ng / ml

[0104] A-volume of the reaction system, unit ul

[0105] T-reaction time, unit: min

[0106] m-sample protein content, unit: mg

[0107] Molar mass of M-AFB1, M = 312.3 g / mol

[0108] Optimum reaction temperature and temperature stability analysis

[0109] Optimum reaction temperature: AFO obtained after purification wt and AFO P477S The enzyme activity of the protein was measured at different temperatures (10°C, 20°C, 30°C, 40°C, 50°C, 60°C) according to the method of "Example 8 Step 1", and the highest enzyme activity was taken as 100%, and the relative enzyme activities at the other five temperatures were calculated.

[0110] Temperature stability: AFO obtained after purification wt and AFO P477S After the protein was incubated at different temperatures (10°C, 20°C, 30°C, 40°C, 50°C, 60°C) for 30 min, the enzyme activity was determined according to the method of "Enzyme activity determination in Example 8", and the highest enzyme activity was taken as 100%, and the relative enzyme activities at the other five temperatures were calculated.

[0111] like Figure 4 As shown, mutant AFO P477S and wild-type AFO wtThe optimum reaction temperature is 30℃; Figure 5 As shown, wild-type AFO wt At 10-50℃, the enzyme activity can be kept above 20%. P477S The mutant can still retain more than 60% of its activity at 10-50°C.

[0112] Optimal reaction pH and pH stability analysis

[0113] Optimal reaction pH: AFO obtained after purification wt and AFO P477S The enzymatic activity of the protein was determined in low-salt buffer (PBS and NaCl) at different pH values ​​(5, 6, 6.5, 7, 7.5, 8) according to the method of "Enzymatic activity determination in Example 8", and the highest enzymatic activity was taken as 100%, and the relative enzymatic activities at the other four pH values ​​were calculated.

[0114] pH stability analysis: AFO obtained after purification wt and AFO P477S After the protein was incubated in low-salt buffer (PBS and NaCl) at different pH values ​​(5, 6, 6.5, 7, 7.5, 8) at 30°C for 30 min, the enzyme activity was determined according to the method of "Enzyme activity determination in Example 8", and the highest enzyme activity was taken as 100%, and the relative enzyme activities at the other four pH values ​​were calculated.

[0115] like Figure 6 As shown, wild-type AFO wt The optimal reaction pH is 7.0, and the mutant AFO P477S The optimal reaction pH is 7.5. The activity is inhibited in an acidic environment, and the enzyme activity increases with the increase of pH. Figure 7 As shown, wild-type AFO wt It showed good stability in the range of pH 7.0-8.0; mutant AFO P477S It retains more than 60% activity at pH 5.0-8.0.

[0116] Combining the above two experiments, it can be seen that the mutant AFO P477S The other enzymatic properties of aflatoxin oxidase showed some changes compared with the wild-type aflatoxin oxidase.

Claims

1. An aflatoxin oxidase for improving pepsin resistance, characterized in that: It is derived from the edible fungus Pseudomonas aeruginosa ( Armillariella tabescens ) is a mutant aflatoxin oxidase obtained by random mutation screening of aflatoxin oxidase, wherein the amino acid at position 477 is replaced by serine for proline; the amino acid sequence of the mutant aflatoxin oxidase is SEQ ID NO.

2.

2. A DNA molecule, characterized in that: It encodes the aflatoxin oxidase with improved pepsin resistance as claimed in claim 1.

3. The DNA molecule according to claim 2, characterized in that: Its nucleotide sequence is SEQ ID NO.

3.

4. A carrier, characterized in that: It contains the DNA molecule according to claim 2 or 3.

5. A host cell, characterized in that: It contains the DNA molecule according to claim 2 or 3, or contains the vector according to claim 4.

6. A method for producing aflatoxin oxidase with improved pepsin resistance according to claim 1, characterized in that: The method comprises: culturing the host cell according to claim 5 under conditions suitable for the expression of aflatoxin oxidase, and separating the aflatoxin oxidase from the culture medium.

7. Use of the aflatoxin oxidase with improved pepsin resistance as claimed in claim 1 in the preparation of food additives or feed additives.

Images