L-pantolactone dehydrogenase mutant and its encoding gene and application

Abstract

The present invention relates to an L-pantolactone dehydrogenase mutant, an encoding gene, a vector containing the encoding gene, a genetically engineered bacterium, and an application thereof in the microbial catalytic preparation of D-pantolactone. The mutant is obtained by saturation mutation of the 28th position of the amino acid sequence shown in SEQ ID NO.1. A28S Co-expression of engineered bacteria RopLPLDH with its molecular chaperone A28S The specific enzyme activity of / pGro7 was increased by 0.45 times and 0.50 times compared with the control group RopLPLDH. The co-expression strategy of RopLPLDH mutant and molecular chaperone significantly improved the soluble expression of the target protein. A28S / pGro7 can basically completely catalyze 500mM and 750mM L-pantolactone. When the three-enzyme co-expression engineering bacteria pA-CglCPR / EsGDH-pET-RopLPLDH catalyzed 200mM substrate, the concentration of the product L-pantolactone gradually increased over time, and the substrate conversion rate reached 95.6% at 24h.

Description

(I) Technical field

[0001] The invention relates to an L-pantolactone dehydrogenase mutant, a coding gene, a vector containing the coding gene, a genetic engineering bacterium, and application of the mutant in preparing D-pantolactone by microbial catalysis. (II) Background technology

[0002] D-Pantothenate calcium, also known as vitamin B5, is a component of coenzyme A and has been widely used in food, feed, medicine, chemical industry and cosmetics industries. D-(-)-Pantothenic acid lactone, also known as (R)-pantothenic acid lactone, has a chemical structure of the γ-lactone of D-(-)-pantoic acid and is a key chiral intermediate for the synthesis of D-(+)-pantothenic acid. At present, the industrial synthesis of D-pantothenic acid lactone adopts a technical route that combines chemical method and hydrolase resolution method. Starting from isobutyraldehyde and formaldehyde as starting materials, DL-pantothenic acid lactone is chemically synthesized; D-pantothenic acid lactone can be stereoselectively hydrolyzed by D-pantothenic acid lactone hydrolase to generate D-pantoic acid, and then lactonized to generate D-pantothenic acid lactone. The remaining L-pantothenic acid lactone is chemically racemized to DL-pantothenic acid lactone and then recycled for resolution.

[0003] The resolution of DL-pantoic acid lactone is a key step in the synthesis of D-pantoic acid lactone. The chiral resolution preparation process of hydrolase requires the racemization of L-pantoic acid lactone, the separation of D-pantoic acid and L-pantoic acid lactone, and the acidification of D-pantoic acid to form D-pantoic acid lactone. Although the chiral resolution method catalyzed by hydrolase is mature, it still has problems such as complex process, high energy and material consumption, and the need to consume more acid and alkali.

[0004] In view of this, the development of a more direct, efficient and environmentally friendly asymmetric synthesis method for D-pantoic acid lactone to replace the existing chiral resolution technology will have important application value. D-pantoic acid lactone can be asymmetric synthesized by redox method, which can be achieved through two different pathways. The first pathway is to firstly use L-pantoic acid lactone dehydrogenase to catalyze the dehydrogenation of L-pantoic acid lactone to generate ketopantoic acid lactone, then ketopantoic acid lactone spontaneously hydrolyzes to form ketopantoic acid, and then D-pantoic acid is generated under the action of D-ketopantoic acid reductase, and then D-pantoic acid is closed under the action of acid to form D-pantoic acid lactone; the more simple second pathway is to use mixed DL-pantoic acid lactone as substrate, use stereoselective L-pantoic acid lactone dehydrogenase to catalyze the dehydrogenation of L-pantoic acid lactone to generate ketopantoic acid lactone, and then ketopantoic acid lactone is asymmetric to generate D-pantoic acid lactone under the catalysis of D-ketopantoic acid reductase.

[0005] Compared with the existing hydrolase catalytic pathway, the second pathway is simpler. The racemic substrate can be directly biocatalyzed to obtain an optically pure product without the need for a racemization step or a separation step of the lactone and the acid. Therefore, the second pathway's oxidoreductase asymmetric synthesis of D-pantoic acid lactone is a very promising alternative to the biohydrolase method. The dehydrogenation of L-pantoic acid lactone is one of the key steps in this pathway, which is catalyzed by L-pantoic acid lactone dehydrogenase. There are only a few known L-pantoic acid lactone dehydrogenases, and the lack of L-pantoic acid lactone dehydrogenases with excellent catalytic performance limits the application of the oxidoreductase method in the asymmetric synthesis of D-pantoic acid lactone. The L-pantoic acid lactone dehydrogenases that have been studied more include the L-pantoic acid lactone dehydrogenase from Rhodococcus erythropolis and the L-pantoic acid lactone dehydrogenase from Nocardia asteroides. The L-pantoic acid lactone dehydrogenase from Rhodococcus erythropolis is poorly expressed in the Escherichia coli system, which increases the difficulty of multi-enzyme combination catalysis. The genetically engineered bacteria AKU2103, in which the L-pantoic acid lactone dehydrogenase gene of Rhodococcus erythropolis is enhanced in the same Rhodococcus erythropolis, was used as a biocatalyst to catalyze the dehydrogenation reaction of 0.768M L-pantoic acid lactone for 144 hours, and the conversion rate of the reaction was 91.9%. Considering that the dehydrogenation product of L-pantoic acid lactone is ketopantoic acid lactone, ketopantoic acid lactone is easily hydrolyzed spontaneously to ketopantoic acid. After 144 hours of the above reaction, recombinant Escherichia coli expressing ketopantoic acid reductase needs to be further added as a biocatalyst to convert the generated ketopantoic acid into D-pantoic acid after 24 hours of reduction reaction. Finally, D-pantoic acid is further acidified to produce D-pantoyl lactone (SiD, Urano N, Nozaki S, et al. L-Pantoyllactone dehydrogenase from Rhodococcus erythropolis: genetic analyses and application to the stereospecific oxidation of L-pantoyl lactone. Applied Microbiology and Biotechnology, 2012, 95: 431-440).In addition, although the enzymatic properties of L-pantoyl lactone dehydrogenase from Nocardia asteroides have been studied in detail (Kataoka M, Shimizu S, Yamada H. Purification and characterization of a novel FMN-dependent enzyme: membrane-bound L-(+)-pantoyl lactone dehydrogenase from Nocardia asteroides. European Journal of Biochemistry, 1992, 204, 799-806), its encoding gene is still unknown, which hinders its further application in biocatalysis.

[0006] So far, there has been no research on L-pantolactone dehydrogenase from Rhodococcus opacus, nor has there been any report on the use of L-pantolactone dehydrogenase from Rhodococcus opacus in a multi-enzyme cascade to catalyze the chiral inversion of L-pantolactone to synthesize D-pantolactone. (III) Summary of the invention

[0007] The purpose of the present invention is to provide an L-pantolactone dehydrogenase mutant, an encoding gene, a vector containing the encoding gene, a genetically engineered bacterium, and the use of the same in the microbial catalytic preparation of D-pantolactone in order to address the problems that the existing L-pantolactone dehydrogenase RopLPLDH has low catalytic activity on L-pantolactone and requires a large amount of catalyst (bacteria).

[0008] The technical solution adopted by the present invention is:

[0009] A L-pantolactone dehydrogenase mutant is obtained by performing a saturation mutation on the 28th position of the amino acid sequence shown in SEQ ID NO.1.

[0010] Preferably, the amino acid sequence of the mutant is shown as SEQ ID NO.5 (mutant A28S) (the encoding gene is shown as SEQ ID NO.6).

[0011] The present invention also relates to a gene encoding the L-pantoic acid lactone dehydrogenase mutant, and a recombinant vector and genetic engineering bacteria containing the encoding gene.

[0012] The present invention also relates to the application of the L-pantolactone dehydrogenase mutant in preparing ketopantolactone from L-pantolactone by microorganism catalysis.

[0013] Specifically, the application method is: using wet bacteria obtained by induction culture of an engineered bacterium containing an L-pantolactone dehydrogenase (RopLPLDH) mutant vector and a molecular chaperone plasmid pGro7 as a catalyst, L-pantolactone as a substrate, and a pH 7.5, 50mM PB buffer (0.05M Na2HPO4, 0.05M NaH2PO4) as a reaction medium to form a conversion system, reacting at 30-40°C and 600-800rpm (preferably 35°C and 800rpm), adjusting the reaction solution with 1M NaOH solution to control the pH to maintain 7.0-8.0, reacting to obtain ketopantolactone, and taking samples regularly to detect the concentrations of the substrate and the product.

[0014] In the transformation system, the substrate is added to a final concentration of 500-1000 mM (preferably 50-750 mM), and the amount of the catalyst is 100-200 g WCW / L (WCW cell wet weight) based on the wet weight of the bacteria.

[0015] The wet bacteria were prepared as follows: the engineered bacteria containing the RopLPLDH mutant vector and the molecular chaperone pGro7 were inoculated into a LB liquid culture medium containing a final concentration of 50 μg / mL kanamycin and 25 μg / mL chloramphenicol, and cultured at 37°C for 10 hours to obtain a seed solution; the seed solution was inoculated into a fresh LB liquid culture medium containing a final concentration of 50 μg / mL kanamycin and 25 μg / mL chloramphenicol at an inoculum concentration of 1.0% by volume, and 0.5 g / L L-arabinose was added to induce the molecular chaperone protein, and cultured at 37°C and 180 rpm for 2 hours (OD 600 =0.6~0.8), add isopropyl β-D-thiogalactoside (IPTG) with a final concentration of 0.1mM into the culture medium, culture at 20℃ for 12h, and centrifuge at 4℃ and 8000rpm for 10min to obtain wet cells containing RopLPLDH mutant protein and molecular chaperone protein.

[0016] The invention also relates to the application of the L-pantolactone dehydrogenase mutant in the preparation of D-pantolactone by microbial catalysis.

[0017] Specifically, the application is: constructing an L-pantolactone dehydrogenase mutant, a conjugated polyketide reductase, and a glucose dehydrogenase co-expressing engineered bacterium, using the wet bacteria obtained by the co-expression as a catalyst, L-pantolactone as a reaction substrate, glucose as a cosubstrate, and PB buffer as a reaction medium to form a conversion system, and reacting to obtain D-pantolactone.

[0018] In view of the problem of poor soluble expression of L-pantolactone dehydrogenase RopLPLDH, the present invention provides a variety of strategies to improve soluble expression, and constructs a three-enzyme co-expression system using L-pantolactone dehydrogenase RopLPLDH, aldehyde-keto reductase CglCPR, and glucose dehydrogenase EsGDH to catalyze L-pantolactone to generate ketopantolactone, and further prepare D-pantolactone. Among them, L-pantolactone dehydrogenase mutant RopLPLDH A28S The enzyme activity was increased by 0.43 times compared with that of cells. The co-expression strategy of L-pantoic acid lactone dehydrogenase RopLPLDH and molecular chaperone pGro7 or pG-KJE8 significantly reduced the inclusion body expression and enhanced the soluble expression. The volume enzyme activity of recombinant bacteria RopLPLDH / pG-KJE8 and RopLPLDH / pGro7 reached 46.26U / L and 39.38U / L. Recombinant bacteria RopLPLDH A28S / pGro7 catalyzes 750mM L-pantoic acid lactone to generate ketopantoic acid lactone, with a conversion rate of 95%. The recombinant bacteria pA-CglCPR / EsGDH-pET-RopLPLDH co-expressing L-pantoic acid lactone dehydrogenase RopLPLDH, aldehyde-keto reductase CglCPR, and glucose dehydrogenase GDH catalyzes 200mM L-pantoic acid lactone to generate D-pantoic acid lactone, with a 24-hour conversion rate of 95.6%.

[0019] Specifically, the L-pantoic acid lactone dehydrogenase encoding gene sequence is shown in SEQ ID NO.2, the conjugated polyketide reductase encoding gene (GenBank NO.CAG61069.1) is from Candida glabrata, the sequence is shown in SEQ ID NO.3, and the glucose dehydrogenase encoding gene (GenBank NO.KM817194.1) is from Exiguobacterium sibirium DSM 17290, the sequence is shown in SEQ ID NO.4.

[0020] Preferably, in the transformation system, the final concentration of the substrate added is 50-500 mM, the final concentration of glucose added is 75-750 mM, and the amount of the catalyst used is 1-100 g WCW / L based on the wet weight of the bacteria.

[0021] The wet bacteria were prepared as follows: the co-expression engineering bacteria constructed with the RopLPLDH gene, the CglCPR gene and the GDH gene were inoculated into a LB liquid culture medium containing a final concentration of 50 μg / mL kanamycin and 25 μg / mL chloramphenicol, and cultured at 37° C. for 10 h to obtain a seed solution; the seed solution was inoculated into a fresh LB liquid culture medium containing a final concentration of 50 μg / mL kanamycin and 25 μg / mL chloramphenicol at an inoculum concentration of 1.0% by volume, and cultured at 37° C. and 180 rpm for 2 h (OD 600 =0.6~0.8), add isopropyl β-D-thiogalactoside (IPTG) with a final concentration of 0.3 mM into the culture medium, culture at 28°C for 10 h, and centrifuge at 4°C and 8000 rpm for 10 min to obtain wet bacteria co-expressing RopLPLDH, CglCPR and GDH.

[0022] The full length of the base sequences of RopLPLDH and its mutants of the present invention is 1206 bp. From the first base to the 1206th base, the start codon is ATG and the stop codon is TAA.

[0023] The RopLPLDH mutant of the present invention is obtained by using site-directed saturation mutagenesis technology, using this technology to mutate the gene (SEQ ID NO.2) of RopLPLDH, transferring the obtained mutant plasmid into E.coli BL21 (DE3) competent cells by heat shock, inoculating, transferring, inducing, and recovering the bacteria, and using the resuspended bacterial liquid to catalyze L-pantoic acid lactone. The specific method is as follows: the first step is to activate the control bacteria E.coli BL21 (DE3) / pET28b (+)-RopLPLDH and extract the plasmid pET28b (+)-RopLPLDH, and store it at -20°C. The second step is to perform homology modeling through SWISS-MODEL to obtain the three-dimensional structure of RopLPLDH; and then predict the active center and related amino acids of RopLPLDH through HOTSPOT WIZARD. The key amino acid site Ala 28 that affects the binding of substrate to RopLPLDH is obtained. Using pET28b(+)-RopLPLDH as a template plasmid, a mutant plasmid was obtained by site-directed saturation mutagenesis of Ala 28 and then transformed to obtain a mutant library. The redox indicator 2,6-dichlorophenol indophenol (DCPIP) was used to obtain H in the catalytic reaction of dehydrogenase. +The blue color of the oxidized state changes to colorless in the reduced state. The oxidized state has a characteristic absorption peak at a wavelength of 600 nm. A high-throughput screening method was established. The RopLPLDH site-directed saturation mutation library was screened for dominant mutant strains to obtain the dominant body. The dominant mutation A28S was obtained by gas phase rescreening to obtain the RopLPLDH mutant strain E.coli BL21(DE3) / pET28b(+)-RopLPLDH A28S (denoted as RopLPLDH A28S ). Mutant strain RopLPLDH A28S Compared with the starting strain, the cell viability increased by 0.43 times.

[0024] RopLPLDH of the present invention A28S The mutant was co-expressed with the molecular chaperone pGro7 by the engineered bacteria RopLPLDH A28S The recombinant plasmid of the mutant gene was introduced into competent cells prepared by the molecular chaperone bacterium E. coli BL21 (DE3)-pGro7, and screened in a solid medium with dual resistance to kanamycin and chloramphenicol. A28S After inoculation, transfer, induction and cell recovery, the wet cells were used to test the specific cell viability. A28S / pGro7 showed a 36.8% increase in cell viability compared to the starting strain RopLPLDH / pGro7.

[0025] The inoculation, transfer, induction, and bacterial cell recovery of the RopLPLDH mutant, conjugated polyketide reductase, and glucose dehydrogenase genetically engineered bacteria of the present invention can be any culture medium in the art that can grow the bacteria and produce the present invention, preferably LB culture medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, dissolved in distilled water, and adjusted to pH 7.0. There are no special restrictions on the culture method and culture conditions, and the culture method and conditions can be optimized according to factors such as the host type and the culture method.

[0026] The beneficial effects of the present invention are mainly reflected in: the RopLPLDH mutant engineering bacteria RopLPLDH constructed by the present invention A28S Co-expression of engineered bacteria RopLPLDH with its molecular chaperone A28S The specific enzyme activity of / pGro7 was increased by 0.45 times and 0.50 times compared with the control group RopLPLDH. The co-expression strategy of RopLPLDH mutant and molecular chaperone significantly improved the soluble expression of the target protein. A28S / pGro7 can basically completely catalyze 500mM and 750mM L-pantolactone. When the three-enzyme co-expression engineering bacteria pA-CglCPR / EsGDH-pET-RopLPLDH catalyzes 200mM substrate, the concentration of the product L-pantolactone gradually increases over time, and the substrate conversion rate reaches 95.6% at 24h. (IV) Description of the drawings

[0027] Figure 1 Schematic diagram of the reaction of L-pantolactone dehydrogenase RopLPLDH, conjugated polyketide reductase CglCPR and glucose dehydrogenase EsGDH catalyzing the conformational reversal of L-pantolactone to prepare D-pantolactone.

[0028] Figure 2 Figure 3. Molecular chaperones and soluble tags promote L-pantolactone dehydrogenase expression.

[0029] Figure 3 The volumetric enzyme activity and conversion rate of L-pantolactone dehydrogenase recombinant bacteria constructed for molecular chaperones and soluble tags.

[0030] Figure 4 RopLPLDH A28S / pGro7 catalyzes the L-pantolactone dehydrogenase reaction process.

[0031] Figure 5 It is the protein expression of the recombinant bacteria with three enzymes co-expressed;

[0032] 1 is the expression supernatant of the recombinant bacteria pA-EsGDH / CglCPR-pET-RopLPLDH;

[0033] 2 is the expression precipitation of the recombinant bacteria pA-EsGDH / CglCPR-pET-RopLPLDH;

[0034] 3 is the expression supernatant of the recombinant bacteria pA-CglCPR / EsGDH-pET-RopLPLDH;

[0035] 4 is the expression precipitation of the recombinant bacteria pA-CglCPR / EsGDH-pET-RopLPLDH.

[0036] Figure 6 The reaction process of recombinant bacteria pA-EsGDH / CglCPR-pET-RopLPLDH catalyzing the conformational reversal of 100mM L-pantolactone to prepare D-pantolactone.

[0037] Figure 7The reaction process of preparing D-pantolactone by recombinant bacteria catalyzing the configuration reversal of 200mM L-pantolactone by three-enzyme co-expression; 1 is the recombinant bacteria pA-CglCPR / EsGDH-pET-RopLPLDH; 2 is the recombinant bacteria pA-EsGDH / CglCPR-pET-RopLPLDH. (V) Specific implementation methods

[0038] The present invention is further described in detail below in conjunction with specific embodiments, but the present invention is not limited to the following embodiments:

[0039] Example 1: Construction and screening of L-pantolactone dehydrogenase mutant library

[0040] 1. Starting strain:

[0041] The laboratory preserved engineering bacteria E. coli BL21 (DE3) / pET28b (+) -RopLPLDH was used as the original strain, and the plasmid pET28b (+) -RopLPLDH was activated and extracted, wherein the amino acid sequence of L-pantolactone dehydrogenase RopLPLDH is shown in SEQ ID NO.1, and the coding gene sequence is shown in SEQ ID NO.2.

[0042] 2. Site-directed mutagenesis:

[0043] (1) Construction of mutation library

[0044] The preparation of the RopLPLDH mutant library was achieved by site-directed mutagenesis, using the vector pET28b(+)-RopLPLDH in the original strain as the template and the primers A28-F:GTTTATGCC NNS CTGATTGCAGGTAGCGAACG and A28-R:TGCAATCAG SNN GGCATAAACGCTTTTCGGC, and polymerase chain reaction (PCR) was performed.

[0045] PCR reaction system (25 μL): 1 μL forward primer (100 μM), 1 μL reverse primer (100 μM), 12.5 μL 2×Phanta buffer, 0.5 μL dNTP mixture (10 mM each), 1 μL plasmid template, 0.5 μL DNA polymerase Phanta (Novozymes, China) and 8.5 μL ultrapure water.

[0046] The PCR program set up according to the Phanta Super-Fidelity DNA polymerase manual was as follows: pre-denaturation at 95°C for 5 min, followed by 30 cycles (denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 4 min), final extension at 72°C for 10 min, and incubation at 16°C.

[0047] The recombinant plasmid obtained by PCR amplification was transformed into competent E. coli BL21 (DE3) cells, spread on kanamycin-resistant LB plate culture medium, and cultured at 37° C. for 12 to 16 hours.

[0048] (2) Initial screening

[0049] Randomly select the positive clones and original strains on the plate, inoculate them in a 96-well plate, add 1000 μL LB medium (containing 50 μg / mL kanamycin), and culture at 37°C, 180 rpm for 10 hours to obtain seed liquid. Transfer 50 μL of seed liquid to another new 96-well plate (added with 950 μL LB medium containing 50 μg / mL kanamycin), shake culture at 37°C, 180 rpm for 4 hours, add IPTG (final concentration 0.1 mM), transfer to 28°C for 12 hours. The obtained cells are centrifuged in a 96-well plate centrifuge at 4000 rpm and 4°C for 10 minutes to obtain the wet bacteria of the mutant.

[0050] 300 μL of sodium phosphate buffer solution (50 mM pH 7.0) was added to each well of the 96-well plate containing wet bacteria to resuspend the cells. Then 100 μL of the bacterial suspension was added to the corresponding position of the 96-well ELISA plate. 2,6-dichlorophenol indophenol (DCPIP) with a final concentration of 100 μM was added to start the reaction. Then, L-pantolactone with a final concentration of 200 μM was added to start the reaction. The OD was measured at intervals of 30 s at 30 °C within 5 min in the ELISA reader Kinetics (MDSpectraMax M5, USA) mode. 600 The change of absorbance value. Correspondingly, the higher the enzyme activity of the mutant, the higher the OD 600 The more the decrease is, the mutants with relatively high activity in the mutant library are screened out for further rescreening and sequencing verification.

[0051] (3) GC rescreening

[0052] The mutants obtained in step (2) were screened for superior mutants, and the superior mutants were fermented in shake flasks to obtain wet cells, which were used for rescreening reaction. The rescreening conditions were as follows: the obtained mutant wet cells were added to PB (50mM) with a wet weight of 10g / L and resuspended, and then L-pantolactone with a final concentration of 10mM was added, and the reaction was carried out in a constant temperature oscillator at 30°C and 1200rpm for 30min, 200μL of the reaction solution was added with 50μL 6M hydrochloric acid (acidification), and 200μL ethyl acetate was added for extraction 3 times, and the ethyl acetate phase was combined. The concentration and conversion rate of L-pantolactone and ketopantolactone were detected by GC. The superior strain was screened with the conversion rate of the product ketopantolactone as an indicator.

[0053] Conversion rate = amount of ketopantoic acid lactone substance / (amount of ketopantoic acid lactone substance+amount of L-pantoic acid lactone substance).

[0054] The obtained dominant strain was sent to Hangzhou Qingke Biotechnology Co., Ltd. for sequencing and stored in a -80℃ refrigerator. The final dominant mutant obtained by screening was RopLPLDH A28S .

[0055] Gas phase detection conditions: chromatographic column Agilent CycloSil-B (0.25mm×0.25μm×30m), carrier gas: helium, flow rate: 1mL / min, injection port and detector temperature: 250℃; injection volume: 1μL; split ratio: 30:1; program: starting temperature 100℃, heating to 140℃ at a rate of 10℃ / min, maintaining for 5min, and then cooling to the starting temperature within 2min. Under this detection condition, the retention times of ketopantolactone, D-pantolactone and L-pantolactone are 6.6min, 8.8min and 9.0min respectively.

[0056] 4. Catalytic activity

[0057] The mutant and control strains were used as catalysts, respectively, and L-pantolactone was used as substrate to compare the cell viability of the mutants. The reaction system was selected as 1 mL, the catalyst dosage was 10 g / L of the wet weight of the bacteria, the final concentration of the substrate was 10 mM, pH 7.0, 50 mM Pb buffer was used as the reaction medium, 30 ° C, 1200 rpm vortex oscillation reaction for 30 min, 200 μL of the reaction solution was added with 50 μL of 6 M hydrochloric acid (acidification), 200 μL of ethyl acetate was added to extract 3 times, and the ethyl acetate phase was combined. The ethyl acetate sample was tested for the concentration of L-pantolactone and ketopantolactone using the GC described in Example 1.

[0058] The cell enzyme activity unit (U) is defined as: the amount of enzyme required to generate 1 μmol of ketopantolactone per minute at 30°C and pH 7.0. The specific cell enzyme activity is defined as the number of activity units per gram of bacteria, U / g.

[0059] The specific cell enzyme activities of the mutants are shown in Table 1.

[0060] Table 1: L-pantolactone dehydrogenase mutants and molecular chaperone recombinant bacteria specific cellular enzyme activities

[0061]

[0062] Example 2: Multiple strategies to enhance soluble expression of L-pantolactone dehydrogenase

[0063] 1. Strategy 1: Molecular chaperone co-expression promotes soluble expression

[0064] The recombinant plasmid pET28b(+)-RopLPLDH and the laboratory-preserved L-pantolactone dehydrogenase recombinant plasmid pET28b(+)-RhoLPLDH from Rhodococcus hoagii were respectively transformed into five Escherichia coli BL21(DE3) competent cells containing molecular chaperone plasmids by heat shock. The five molecular chaperone plasmids were pG-KJE8, pGro7, pKJE7, pG-Tf2 and pTf16. The recombinant engineered bacteria co-expressing L-pantolactone dehydrogenase and molecular chaperone were screened in LB solid culture medium containing double resistance of 25 μg / mL chloramphenicol and 50 μg / mL kanamycin at a final concentration.

[0065] 2. Strategy 2: Connecting soluble tags to promote soluble expression

[0066] The recombinant plasmids pET28b(+)-RopLPLDH and pET28b(+)-RhoLPLDH were connected to six lytic tags stored in the laboratory by seamless cloning technology, and transformed into Escherichia coli BL21(DE3) competent cells by heat shock. The six lytic tags were NT, MBP, PGB1, Sumo, PDI and Mistic. The recombinant engineered bacteria carrying L-pantolactone dehydrogenase with lytic tags were screened in LB solid medium containing kanamycin resistance at a final concentration of 50 μg / mL.

[0067] 3. Inducible expression of recombinant L-pantolactone dehydrogenase

[0068] The recombinant bacteria constructed in step 1 were inoculated into 10 mL LB liquid medium containing a final concentration of 25 μg / mL chloramphenicol, and cultured at 37°C and 180 rpm for 10 h to obtain seed solution. The seed solution was inoculated into a fresh 100 mL LB liquid medium shake flask containing a final concentration of 25 μg / mL chloramphenicol at a volume concentration of 1% (v / v), and the inducer of molecular chaperone expression (L-arabinose or tetracycline) was added according to the instructions of TakaraChaperone Set, and cultured at 37°C and 180 rpm until OD 600 is between 0.6 and 0.8, and then IPTG with a final concentration of 0.1 mM is added to the culture solution. After culturing at 28°C for 10 h, the culture solution is centrifuged at 4°C and 8000 rpm for 10 min to obtain the corresponding wet bacterial cells.

[0069] The recombinant bacteria constructed in step 2 were inoculated into 10 mL LB liquid medium containing a final concentration of 50 μg / mL kanamycin, and cultured at 37°C, 180 rpm for 10 h to obtain seed solution. The seed solution was inoculated into a fresh 100 mL LB liquid medium shake flask containing a final concentration of 50 μg / mL kanamycin at a volume concentration of 1% (v / v), and cultured at 37°C, 180 rpm until OD 600 is between 0.6 and 0.8, and then IPTG with a final concentration of 0.1 mM is added to the culture solution. After culturing at 28°C for 10 h, the culture solution is centrifuged at 4°C and 8000 rpm for 10 min to obtain the corresponding wet bacterial cells.

[0070] The cells obtained above produce corresponding proteins, which can be used for the preparation of pure protein enzyme solution, and can also be used for crude enzyme solution or whole cell catalysis of L-pantolactone.

[0071] The protein expression of each recombinant bacterium is shown in Figure 2 It can be seen that the molecular chaperone pGro7 significantly increased the supernatant expression of RopLPLDH, while pG-KJE8, pGro7 and pG-KJE7 reduced the expression of inclusion bodies. The inclusion body expression of RopLPLDH fused with Sumo, PDI and Mistic was reduced, while the supernatant expression of RopLPLDH fused with Mistic was higher.

[0072] 4. Catalytic activity and conversion rate

[0073] The wet cells of L-pantolactone dehydrogenase induced and expressed in step 3 were used as catalysts, and L-pantolactone was used as substrate to compare the volume enzyme activity and corresponding conversion rate of each recombinant bacteria. The reaction system was selected as 1 mL, the catalyst dosage was 2 mL of fermentation broth centrifuged and collected bacteria, the final substrate concentration was 10 mM, pH 7.0, 50 mM PB buffer was the reaction medium, 30 ° C, 1200 rpm vortex oscillation reaction 30 min and 12 h, 200 μL of the reaction solution was added with 50 μL 6M hydrochloric acid (acidified), 200 μL ethyl acetate was added to extract 3 times, and the ethyl acetate phase was combined. The ethyl acetate sample was tested for the concentration of L-pantolactone and ketopantolactone by GC described in Example 1.

[0074] The cellular enzyme activity unit (U) is defined as: the amount of enzyme required to generate 1 μmol of ketopantolactone per minute at 30°C and pH 7.0. The volumetric enzyme activity is defined as the number of activity units per liter of fermentation broth, U / L.

[0075] The volume enzyme activity and conversion rate of each recombinant bacteria are shown in Figure 3It can be seen that the co-expression of RopLPLDH with molecular chaperones pG-KJE8 and pGro7 had the highest volume enzyme activity, reaching 46.26U / L and 39.38U / L respectively, while RopLPLDH connected to the soluble tag almost completely lost its enzyme activity. It can be seen that the chaperones pG-KJE8 and pGro7 not only alleviated the inclusion body expression, but also maintained a high enzyme activity.

[0076] Example 3: Investigation of substrate specificity of L-pantolactone dehydrogenase

[0077] The wet cells obtained after induction expression of the genetically engineered bacteria E.coli BL21 (DE3) / pET-28b (+) -RopLPLDH and its mutants in Example 1 were used as biocatalysts. The substrate specificity of L-pantolactone dehydrogenase from Rhodococcus opacus was investigated by whole cell catalysis, using 10mM D-pantolactone and L-pantolactone as substrates, respectively. The reaction system of L-pantolactone dehydrogenase catalyzing the dehydrogenation of L-pantolactone was 1mL, containing: 10g / L whole cells, 10mM substrate and 50mM phosphate buffer (pH 7.0), respectively. In a constant temperature oscillating reactor, 30°C, 1200rpm reaction for 0.5h, 200μL of the reaction solution was added with 50μL 6M hydrochloric acid (acidified), and 200μL ethyl acetate was added for full extraction. After centrifugation of the extract, the upper organic phase was drawn into a centrifuge tube, anhydrous sodium sulfate was added to remove water, and 200 μL of ethyl acetate was added to the lower aqueous phase again for full extraction. Centrifuge again to take the upper organic phase and merge it into the first extraction organic phase. Take the second extraction ethyl acetate organic phase and transfer it into a gas phase sample bottle for gas chromatography detection. The substrate specificity results showed that the L-pantoate dehydrogenase from Rhodococcus opacus and its mutants could not catalyze D-pantoate lactone, but could catalyze L-pantoate lactone. The above results show that the L-pantoate dehydrogenase from Rhodococcus opacus specifically acts on the dehydrogenation reaction of L-pantoate lactone.

[0078] Example 4: L-pantolactone dehydrogenase and molecular chaperone co-expression bacteria catalyze L-pantolactone dehydrogenase

[0079] RopLPLDH prepared by the method of Example 2 A28SThe wet cells of the recombinant bacteria co-expressed with the molecular chaperone pGro7 catalyzed L-pantoic acid lactone. In a 5mL reaction system, the feeding amount of the substrate L-pantoic acid lactone was 500mM, 750mM and 1000mM, and the corresponding whole cell dosage was 0.5g, 0.75g and 1g, respectively. The conversion system was composed of a pH 7.0, 50mM PB buffer as the reaction medium, and the reaction was carried out at 35°C and 800rpm. 1M NaOH was used to adjust the reaction pH to maintain pH 7.0-8.0. The method of Example 1 was used for detection, and the conversion rate of the reaction process was Figure 4 The results showed that RopLPLDH A28S / pGro7 can catalyze 500mM and 750mM L-pantolactone, and the substrate conversion rate reaches 95%. RopLPLDH A28S / pGro7 catalyzed the reaction of 1000 mM L-pantolactone, and the substrate conversion rate reached 74%.

[0080] Example 5: Construction of a three-enzyme co-expression system of RopLPLDH, CglCPR and EsGDH

[0081] 1. Starting strain:

[0082] The laboratory preserved engineering bacteria E. coli BL21 (DE3) / pET28b (+) -RopLPLDH, E. coli BL21 (DE3) / pACYCDuet1-CglCPR and E. coli BL21 (DE3) / pET28b (+) -EsGDH were used as the original strains, and the plasmids pET28b (+) -RopLPLDH, pACYCDuet1-CglCPR and pET28b (+) -EsGDH were activated and extracted, wherein the amino acid sequence of L-pantolactone dehydrogenase RopLPLDH is shown in SEQ ID NO.1, and the coding gene sequence is shown in SEQ ID NO.2. The conjugated polyketide reductase CglCPR coding gene sequence is shown in SEQ ID NO.3. The glucose dehydrogenase EsGDH coding gene sequence is shown in SEQ ID NO.4.

[0083] 2. Construction of CglCPR and EsGDH co-expression plasmid:

[0084] (1) Amplification of fragments and vectors

[0085] CglCPR and EsGDH were inserted into two multiple cloning sites (mcs1 and mcs2) of the dual expression vector pACYCDuet1 to construct pACYCDuet1-mcs1-CglCPR-mcs2-EsGDH and pACYCDuet1-mcs1-EsGDH-mcs2-CglCPR dual enzyme co-expression plasmids. The target gene fragment was amplified by polymerase chain reaction (PCR) using plasmid pACYCDuet1-CglCPR or pET28b(+)-EsGDH as a template.

[0086] PCR reaction system (50 μL): 1 μL forward primer (100 μM), 1 μL reverse primer (100 μM), 25 μL 2× Phanta buffer, 1 μL dNTP mixture (10 mM each), 1 μL plasmid template, 1 μL DNA polymerase Phanta (Novozymes, China) and 20 μL ultrapure water.

[0087] The PCR program set up according to the Phanta Super-Fidelity DNA polymerase manual was as follows: pre-denaturation at 95°C for 5 min, followed by 30 cycles (denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 1 min), final extension at 72°C for 10 min, and incubation at 16°C.

[0088] The plasmid pACYCDuet1 was used as a template for the amplification of the vector, and the primers were shown in the table to perform polymerase chain reaction (PCR). The PCR reaction system (50 μL) was the same as above.

[0089] The PCR program was as follows: pre-denaturation at 95°C for 5 min, followed by 30 cycles (denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 3 min), final extension at 72°C for 10 min, and incubation at 16°C.

[0090] (2) Cleanup of PCR products

[0091] Add 3 volumes of Buffer PCR-A to the PCR reaction solution, mix well, and transfer to the DNA preparation tube. Place the DNA preparation tube in a 2mL centrifuge tube, centrifuge at 12,000×g for 1min, and discard the filtrate. Place the preparation tube back in the 2mL centrifuge tube, add 700μL Buffer W2, centrifuge at 12,000×g for 1min, and discard the filtrate. Place the preparation tube back in the 2mL centrifuge tube, add 400μL Buffer W2, and centrifuge at 12,000×g for 1min. Place the preparation tube in a clean 1.5mL centrifuge tube, add 30μL sterile water in the center of the DNA preparation membrane, let stand at room temperature for 1min, centrifuge at 12,000g for 1min, and elute the DNA.

[0092] (3) One-step cloning of the connecting fragment and vector

[0093] The nucleic acid concentration of the PCR clean product was measured by Nanodrop in ng / μL. According to the instruction manual of CloneExpress Ultra OneStep Cloning Kit C115 (Novogene, China), the recombination reaction system (10μL) for the next cloning was established: 5μL 2×CloneExpress Mix, XμL linearized vector, YμL linearized fragment, and sterile water to 10μL. React at 50℃ for 10min and keep warm at 4℃. The amount of cloning vector used = [0.02×the number of base pairs of cloning vector] ng. The amount of insert fragment used = [0.04×the number of base pairs of insert fragment] ng. Then calculate the volume of X and Y based on the measured nucleic acid concentrations of the vector and fragment.

[0094] The recombinant product was transformed into E. coli BL21(DE3) / pET28b(+)-RopLPLDH competent cells, spread on LB plate medium with kanamycin and chloramphenicol resistance, and cultured at 37°C for 12-16 hours.

[0095] (4) Colony PCR screening of positive clones

[0096] Three positive clones were randomly selected and placed in the colony PCR system to verify whether the target fragment was successfully inserted into the vector by PCR amplification.

[0097] Colony PCR reaction system (10 μL): 0.25 μL forward verification primer (100 μM), 0.25 μL reverse verification primer (100 μM), 5 μL 2× Phanta buffer, 0.25 μL dNTP mixture (10 mM each), pick a positive single colony as a template, 0.25 μL DNA polymerase Phanta (Novozymes, China) and 4 μL ultrapure water.

[0098] The PCR program was as follows: pre-denaturation at 95°C for 5 min, followed by 30 cycles (denaturation at 95°C for 15 s, annealing at 56°C for 15 s, extension at 72°C for 1 min), final extension at 72°C for 10 min, and incubation at 16°C.

[0099] The PCR products were verified by DNA electrophoresis to determine whether they contained the target fragment.

[0100] Single colonies that were positive for DNA electrophoresis were picked and sent to Hangzhou Qingke Biotechnology Co., Ltd. for sequencing verification.

[0101] (5) SDS-PAGE and catalytic verification

[0102] The E. coli BL21 (DE3) / pACYCDuet1-mcs1-CglCPR-mcs2-EsGDH / pET28b (+) -RopLPLDH (denoted as pA-CglCPR / EsGDH-pET-RopLPLDH) and E. coli BL21 (DE3) / pACYCDuet1-mcs1-EsGDH-mcs2-CglCPR / pET28b (+) -RopLPLDH (denoted as pA-EsGDH / CglCPR-pET-RopLPLDH) double plasmid co-expressing three enzymes recombinant engineering bacteria were inoculated into 10 mL LB liquid culture medium containing a final concentration of 25 μg / mL chloramphenicol and 50 μg / mL kanamycin, and cultured at 37 ° C, 180 rpm for 10 hours to obtain seed solution. The seed solution was inoculated into a fresh 100 mL LB liquid medium shake flask containing a final concentration of 25 μg / mL chloramphenicol and 50 μg / mL kanamycin at a volume concentration of 1% (v / v), and cultured at 37°C and 180 rpm until the OD 600 is between 0.6 and 0.8, and then 0.1 mM IPTG is added to the culture solution. After culturing at 28°C for 10 h, the solution is centrifuged at 4°C and 8000 rpm for 10 min to obtain the corresponding wet bacterial cells.

[0103] The obtained wet cells were resuspended in PB (50 mM) at pH 7.0 at a wet weight of 10 g / L, and 4× protein loading buffer was added. The cells were boiled in boiling water for 10 min, and electrophoresed at 120 V for 60 min to analyze protein expression.

[0104] SDS-PAGE is shown in Figure 5 The molecular weights of glucose dehydrogenase GDH, aldehyde-keto reductase CglCPR and RopLPLDH proteins are 28, 36 and 43 kDa, respectively. In the co-expression system, there is still a problem of high inclusion bodies of RopLPLDH, which also causes low expression levels of GDH and CglCPR. However, according to Example 6, the co-expression system still has good catalytic ability.

[0105] Example 6: RopLPLDH, CglCPR and EsGDH co-expressed recombinant bacteria catalyze the configuration flip of L-pantolactone to prepare D-pantolactone

[0106] The E. coli BL21 (DE3) / pACYCDuet1-mcs1-EsGDH-mcs2-CglCPR / pET28b (+) -RopLPLDH engineered bacteria prepared by the method of Example 5 catalyzes the configuration flipping of 100mM L-pantoic acid lactone to prepare D-pantoic acid lactone. In a 5mL reaction system, the wet cells were first resuspended with a pH 7.0, 50mM PB buffer. The amount of cell catalyst added to the transformation system was 30g / L, the amount of substrate L-pantoic acid lactone added was 100mM, the glucose concentration was 150mM, and the pH 7.0, 50mM PB buffer was used as the reaction medium to form a transformation system. The reaction was carried out at 30°C and 800rpm. 1M NaOH was used to adjust the reaction pH to maintain pH 7.0-7.5. The method of Example 1 was used for detection, and the conversion rate of the reaction process was found to be Figure 6 The results showed that the recombinant bacteria catalyzed the conformational inversion of 100 mM L-pantolactone to synthesize D-pantolactone, with a substrate conversion rate of 99% in 12 h and no accumulation of the intermediate byproduct KPL.

[0107] Example 7: RopLPLDH, CglCPR and EsGDH co-expressed recombinant bacteria catalyze the configuration flip of L-pantolactone to prepare D-pantolactone

[0108] The E. coli BL21(DE3) / pACYCDuet1-mcs1-EsGDH-mcs2-CglCPR / pET28b(+)-RopLPLDH and E. coli BL21(DE3) / pACYCDuet1-mcs1-CglCPR-mcs2-EsGDH / pET28b(+)-RopLPLDH engineered bacteria prepared by the method of Example 5 catalyzed the conformational reversal of 200 mM L-pantolactone to prepare D-pantolactone. In a 5 mL reaction system, wet cells were first resuspended with a pH 7.0, 50 mM PB buffer. The amount of cell catalyst added to the transformation system was 50 g / L, the amount of substrate L-pantolactone was 200 mM, the glucose concentration was 300 mM, and the pH 7.0, 50 mM PB buffer was used as the reaction medium to form a transformation system. The reaction was carried out at 30°C and 800 rpm. 1 M NaOH was used to adjust the reaction pH to maintain pH 7.0 to 7.5. The method of Example 1 was used for detection, and the conversion rate of the reaction process was Figure 7The results showed that the recombinant bacteria pA-CglCPR / EsGDH-pET-RopLPLDH and recombinant bacteria pA-EsGDH / CglCPR-pET-RopLPLDH catalyzed the conformational inversion of 200 mM L-pantolactone to synthesize D-pantolactone, with the 24h substrate conversion rates reaching 95% and 87%, respectively, and the accumulation of the intermediate byproduct KPL was detected to be 4.6% and 12.8%, respectively.

Claims

1. A L-pantolactone dehydrogenase mutant, characterized in that: The amino acid sequence of the mutant is shown in SEQ ID NO.

5.

2. A gene encoding the L-pantolactone dehydrogenase mutant according to claim 1.

3. A recombinant vector containing the gene according to claim 2.

4. A genetically engineered bacterium containing the gene according to claim 2.

5. Use of the L-pantolactone dehydrogenase mutant according to claim 1 in the preparation of ketopantolactone from L-pantolactone catalyzed by microorganisms.

6. Use of the L-pantolactone dehydrogenase mutant according to claim 1 in the preparation of D-pantolactone from L-pantolactone by microorganisms, the use being: constructing a L-pantolactone dehydrogenase mutant 、 Conjugated polyketide reductase 、 The glucose dehydrogenase co-expressing engineering bacteria uses the wet bacteria obtained by co-expression as a catalyst, L-pantolactone as a reaction substrate, glucose as a cosubstrate, and PB buffer as a reaction medium to form a conversion system, and performs a reaction to obtain D-pantolactone; the L-pantolactone dehydrogenase mutant encoding gene sequence is shown in SEQ ID NO.6, the conjugated polyketide reductase encoding gene sequence is shown in SEQ ID NO.3, and the glucose dehydrogenase encoding gene sequence is shown in SEQ ID NO.

4.

7. The use according to claim 6, characterized in that In the transformation system, the final concentration of the substrate added is 50-500 mM, the final concentration of glucose added is 75-750 mM, and the amount of the catalyst used is 1-100 g / L based on the wet weight of the bacteria.

Images